home *** CD-ROM | disk | FTP | other *** search
Text File | 1995-12-17 | 83.6 KB | 2,997 lines | [TEXT/R*ch] |
- // DSeqPrint.cpp
- // d.g.gilbert, 1991-95
-
- #define MASKS 1
-
- #include "DSequence.h"
- #include "DSeqList.h"
- #include "DSeqDoc.h"
- #include "DSeqPrint.h"
- #include "DREnzyme.h"
-
- #include <ncbi.h>
- #include <dgg.h>
- #include <Dvibrant.h>
- #include <DControl.h>
- #include <DDialogText.h>
- #include <DWindow.h>
- #include <DTableView.h>
- #include <DApplication.h>
- #include <DTask.h>
- #include <DTracker.h>
- #include <DMenu.h>
- #include <DUtil.h>
-
-
- enum FonStyles {
- kPlain = 0, kItalic = 1, kBold = 2, kUnderline = 4
- };
-
-
- enum {
-
- kShadeInvert = 1,
- kShadeGray50 = 2,
- kShadeGray25 = 3,
- kShadeGray75 = 4,
- kShadeStipple50 = 5,
- kShadeStipple25 = 6,
- kShadeStipple75 = 7,
-
- mColorButHit = 1001,
- mMonoButHit = 1002,
-
- kFontDescent = 2,
- kIndexRise = 1,
-
- kNameWidth = 80,
- kIndexWidth = 40,
- kItemWidth = 12,
- kNucSpace = 0, //was 2
- kBasesPerLine = 60, // was 50
- //kSeqWidth = kItemWidth * kBasesPerLine,
- kNucBorder = 6,
- kSeqLinesPerParag = 5,
- kLinesPerParag= 7, // kSeqLinesPerParag + 2; // 5 seq + top index + top spacer
-
- kMacdrawHeaderSize= 512
- };
-
- enum SeqRowType { kSpacer, kTopline, kSeqline };
-
-
- #if 0
-
- #define ShadeInvert() { PaintRect(myRect); TextMode(srcBIC); }
-
- kShadeInvert: BEGIN
- PaintRect(myRect);
- TextMode(srcBIC);
- END;
- #endif
-
-
-
-
- class DSeqPrintPrefs : public DWindow {
- public:
- enum {
- kSeqPrintPrefID = 1232,
- kStylePlain,kStyleItalic,kStyleBold,kStyleUnderline,
- cIndexLeft, cIndexRight, cIndexTop,
- cNameLeft, cNameRight,
- cColored,
- cShowComplement,cThreeLetAA,cOnlyORF,
- cShowAA1,cShowAA2,cShowAA3,
- cShowCompAA1,cShowCompAA2,cShowCompAA3,
- cShowCutpoints,cShowAllZymes,cShowExcludedCutters,cShowNoncutters
- };
-
- static char *gNameFontName, *gBaseFontName, *gIndexFontName;
- static Nlm_FonT gNameFont, gBaseFont, gIndexFont;
- static short gNameFontSize, gBaseFontSize, gIndexFontSize;
- static short gNameStyle, gBaseStyle, gIndexStyle;
- static Boolean gNameLeft,gNameRight,gIndexLeft,gIndexRight,gIndexTop, gColored;
- static short gBasesPerLine;
- // restmap prefs ..
- static Boolean gShowComplement,gThreeLetAA, gOnlyORF,
- gShowAA1,gShowAA2,gShowAA3,
- gShowCompAA1,gShowCompAA2,gShowCompAA3,
- gShowAllZymes,gShowCutpoints,gShowExcludedCutters,gShowNoncutters;
- static short gREMinCuts, gREMaxCuts;
-
- static void InitGlobals();
- static void SaveGlobals();
-
- DPopupMenu * fNameFontMenu, * fBaseFontMenu, *fIndexFontMenu,
- * fNameStyleMenu, *fBaseStyleMenu, *fIndexStyleMenu;
- DSwitchBox * fNameSizeSw, * fBaseSizeSw, *fIndexSizeSw;
- DEditText * fREMinCuts, * fREMaxCuts, * fBasePerLine;
- Boolean fNeedSave;
-
- DSeqPrintPrefs();
- virtual ~DSeqPrintPrefs();
- virtual void Initialize();
- virtual void Open();
- virtual void Close();
- virtual void OkayAction();
- virtual Boolean IsMyAction(DTaskMaster* action);
- virtual void NewFontCluster(char* title, DView* mainview,
- DPopupMenu*& mfont, DPopupMenu*& mstyle, DSwitchBox*& swsize,
- char* fontname, short fontstyle, short fontsize );
-
- };
-
- Global DSeqPrintPrefs* gSeqPrintPrefs = NULL;
-
- char* DSeqPrintPrefs::gNameFontName = (char*) "times";
- char* DSeqPrintPrefs::gBaseFontName = (char*) "courier";
- char* DSeqPrintPrefs::gIndexFontName = (char*) "times";
- Nlm_FonT
- DSeqPrintPrefs::gNameFont = NULL,
- DSeqPrintPrefs::gBaseFont = NULL,
- DSeqPrintPrefs::gIndexFont = NULL;
- short
- DSeqPrintPrefs::gNameFontSize = 10,
- DSeqPrintPrefs::gBaseFontSize = 10,
- DSeqPrintPrefs::gIndexFontSize = 9,
- DSeqPrintPrefs::gNameStyle = 0,
- DSeqPrintPrefs::gBaseStyle = 0,
- DSeqPrintPrefs::gIndexStyle = 0;
- Boolean
- DSeqPrintPrefs::gNameLeft = false,
- DSeqPrintPrefs::gNameRight = true,
- DSeqPrintPrefs::gIndexLeft = true,
- DSeqPrintPrefs::gIndexRight = false,
- DSeqPrintPrefs::gIndexTop = true,
- DSeqPrintPrefs::gColored = true;
-
- // restmap prefs ..
- Boolean
- DSeqPrintPrefs::gShowComplement = true,
- DSeqPrintPrefs::gThreeLetAA = false,
- DSeqPrintPrefs::gOnlyORF = false,
- DSeqPrintPrefs::gShowAA1 = false,
- DSeqPrintPrefs::gShowAA2 = false,
- DSeqPrintPrefs::gShowAA3 = false,
- DSeqPrintPrefs::gShowCompAA1 = false,
- DSeqPrintPrefs::gShowCompAA2 = false,
- DSeqPrintPrefs::gShowCompAA3 = false,
- DSeqPrintPrefs::gShowAllZymes = false,
- DSeqPrintPrefs::gShowCutpoints = false,
- DSeqPrintPrefs::gShowExcludedCutters = false,
- DSeqPrintPrefs::gShowNoncutters = false;
- short
- DSeqPrintPrefs::gBasesPerLine = 60,
- DSeqPrintPrefs::gREMinCuts = 1,
- DSeqPrintPrefs::gREMaxCuts = 999;
-
-
-
-
-
-
- // add this to ?? dgg.c
- inline void RectRgn(Nlm_RegioN rgn, Nlm_RectPtr r)
- {
- Nlm_LoadRectRgn( rgn, r->left, r->top, r->right, r->bottom);
- }
-
- inline short BaseCharWidth()
- {
- return Nlm_CharWidth('G');
- //return Nlm_MaxCharWidth();
- //return Nlm_stdCharWidth;
- }
-
-
- class DDrawMapRow : public DObject {
- public:
- enum { kNoIndex = -999, kMaxLinebuf= 1024 };
- static char fLinebuf[kMaxLinebuf+1];
- Nlm_FonT fFont;
- char * fName;
- short fHeight, fRowOffset, fLinecount, fItemrow;
-
- DDrawMapRow() :
- fFont(NULL), fName(NULL), fHeight(Nlm_stdLineHeight),
- fRowOffset(-1), fLinecount(0), fItemrow(0)
- {}
- virtual void Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem) {}
- virtual const char* Write( short row, short col, long startitem, long stopitem) { return ""; }
- virtual char* GetName(short row) { return fName; }
- virtual short GetIndex(short item) { return item; }
- virtual short GetHeight( Nlm_RecT& r, short row, long startitem, long stopitem) { return fHeight; }
- virtual Boolean DoLeftName() { return false; }
- virtual void Clip( Nlm_RecT& r, short row, long startitem, long stopitem,
- Nlm_RecT& viewr, Nlm_RegioN cliprgn)
- {
- Nlm_ClipRgn( cliprgn);
- }
- };
-
- char DDrawMapRow::fLinebuf[DDrawMapRow::kMaxLinebuf+1];
-
-
- class DDrawSpacer : public DDrawMapRow {
- public:
- char *fTitle;
- DDrawSpacer( char* title= NULL, Nlm_FonT itsFont = NULL) : fTitle(title) { fFont= itsFont; }
- virtual void Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem);
- virtual const char* Write( short row, short col, long startitem, long stopitem);
- virtual short GetIndex(short item) { return kNoIndex; }
- };
-
- void DDrawSpacer::Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem)
- {
- if (fTitle) {
- if (fFont) Nlm_SelectFont(fFont);
- Nlm_MoveTo( r.left, r.bottom-2);
- Nlm_PaintString(fTitle);
- }
- }
-
- const char* DDrawSpacer::Write( short row, short col, long startitem, long stopitem)
- {
- long len= Min( kMaxLinebuf, stopitem-startitem);
- Nlm_MemFill(fLinebuf, ' ', len);
- if (fTitle) MemCpy( fLinebuf, fTitle, Min( len, StrLen(fTitle)) );
- fLinebuf[len]= 0;
- return fLinebuf;
- }
-
-
-
-
- class DDrawIndexRow : public DDrawMapRow {
- public:
- Nlm_Boolean fIsUp;
- short fItemWidth;
- DDrawIndexRow( Nlm_FonT itsFont, short itemWidth, Nlm_Boolean upright= true) :
- fIsUp(upright),fItemWidth(itemWidth)
- {
- fFont= itsFont;
- if (fFont) Nlm_SelectFont(fFont);
- fHeight= 3 + Nlm_LineHeight();
- }
- virtual void Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem);
- virtual const char* Write( short row, short col, long startitem, long stopitem);
- virtual short GetIndex(short item) { return kNoIndex; }
- };
-
- void DDrawIndexRow::Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem)
- {
- short atx, aty, cleft, rowtop;
- short up1, up2, upFont;
-
- if (col>0) startitem += col;
-
- if (fFont) Nlm_SelectFont(fFont);
- cleft= r.left; // add a bit to move over bases
- if (fIsUp) {
- up1= -1;
- up2= -3;
- upFont= -4;
- rowtop= r.bottom - kIndexRise;
- }
- else {
- up1= 1;
- up2= 3;
- upFont= Nlm_FontHeight();
- rowtop= r.top + kIndexRise;
- }
- Nlm_MoveTo( cleft, rowtop);
- Nlm_LineTo( r.right, rowtop);
-
- cleft += fItemWidth / 2; // add a bit to put tics over bases
- for (long at= startitem; at <= stopitem; at++, cleft += fItemWidth) {
- atx= cleft;
- aty= rowtop;
- Nlm_MoveTo( atx, aty);
- if (at % 10 == 4) {
- char nums[128];
- sprintf(nums, "%d", at+1);
- short ws= Nlm_StringWidth(nums);
- aty += up1;
- Nlm_LineTo(atx, aty);
- aty += upFont;
- atx -= ws/2;
- Nlm_MoveTo( atx, aty);
- Nlm_PaintString(nums);
- }
- else {
- aty += up2;
- Nlm_LineTo(atx, aty);
- }
- }
- }
-
- const char* DDrawIndexRow::Write( short row, short col, long startitem, long stopitem)
- {
- long len, i, at;
- char * numline, * ticline, *cp;
-
- len= Min( kMaxLinebuf / 2, stopitem-startitem);
- Nlm_MemFill( fLinebuf, ' ', (len + 1)*2);
- if (fIsUp) {
- numline= fLinebuf;
- ticline= fLinebuf + len + 1;
- }
- else {
- ticline= fLinebuf;
- numline= fLinebuf + len + 1;
- }
-
- for (i= 0, at=startitem; i < len; i++, at++) {
- if (at % 10 == 4) {
- char nums[128];
- short ws;
- ticline[i]= '+';
- sprintf(nums, "%d", at+1);
- ws= StrLen(nums);
- cp= numline + i - ws / 2;
- MemCpy( cp, nums, ws);
- }
- //else if (fIsUp) ticline[i]= '_';
- else
- ticline[i]= '-';
- }
-
- fLinebuf[len]= '\n'; // newline !?
- len= 2*len + 1;
- fLinebuf[len]= 0;
- return fLinebuf;
- }
-
-
-
- class DDrawSeqRow : public DDrawMapRow {
- public:
- DSeqPrintView * fView;
- ulong * fColors;
- DSequence * fSeq, * fTopSeq, * fBotSeq;
- char * fBases;
- char * fFirstcommon, * fCommonbase;
- long fLength;
- short fItemWidth;
- DList * fStyles;
-
- DDrawSeqRow(Nlm_FonT itsFont, DSeqPrintView* itsView, DSequence* itsSeq,
- DList* itsStyles, char* name, ulong* colors);
- virtual void Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem);
- virtual const char* Write( short row, short col, long startitem, long stopitem);
- virtual DSeqStyle* GetStyle(long ibase, short masklevel, DSequence* aSeq);
- };
-
-
- DDrawSeqRow::DDrawSeqRow(Nlm_FonT itsFont, DSeqPrintView* itsView, DSequence* itsSeq,
- DList* itsStyles, char* name, ulong* colors) :
- fView(itsView), fColors(colors),
- fSeq(itsSeq), fTopSeq(NULL), fBotSeq(NULL),
- fStyles( itsStyles),
- fFirstcommon(NULL), fCommonbase(NULL),
- fBases(NULL), fLength(0)
- {
- if (fSeq) {
- fBases= fSeq->Bases();
- fLength= fSeq->LengthF();
- }
- fFont= itsFont;
- fName= name;
- if (fFont) Nlm_SelectFont(fFont);
- fHeight= Nlm_LineHeight();
- fItemWidth= BaseCharWidth();
- }
-
-
-
- DSeqStyle* DDrawSeqRow::GetStyle(long ibase, short masklevel, DSequence* aSeq)
- {
- short maskval= 0;
- if (aSeq) maskval= aSeq->MaskAt(ibase, masklevel);
- if (maskval>0)
- return (DSeqStyle*) fStyles->At(masklevel-1);
- else
- return NULL;
- }
-
-
- void DDrawSeqRow::Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem)
- {
- enum patvals { kNoPat, kHasFillPat, kHasFramePat };
- char* bases= fBases;
- if (bases && startitem < fLength) {
- char ch, lastch, *b;
- short atx, aty, masklevel, maskval;
- long ibase;
- ulong newcolor, curcolor, blackcolor;
- patvals haspat= kNoPat;
- DSeqStyle * style, * laststyle, * nextstyle, * topstyle, * botstyle;
-
- if (col>0) {
- bases += col;
- startitem += col;
- }
- if (stopitem > fLength) stopitem= fLength;
- long len= stopitem - startitem;
- atx= r.left;
- aty= r.bottom - 2;
-
- if (fFont) Nlm_SelectFont(fFont);
- Nlm_Black();
- Nlm_TextTransparent();
- curcolor= blackcolor= Nlm_GetColor();
-
- #if MASKS
- topstyle= botstyle= NULL;
- laststyle= nextstyle= NULL;
- if (startitem>0)
- for (masklevel=1; masklevel<5; masklevel++) {
- laststyle= GetStyle( startitem-1, masklevel, fSeq);
- if (laststyle) break;
- }
- #endif
-
- lastch= 0;
- for (b= bases + startitem, ibase=startitem; *b && ibase<stopitem; b++, ibase++) {
- Nlm_MoveTo( atx, aty);
- ch= *b;
- if (ch == DSequence::indelSoft) ch= DSequence::indelHard; //looks better for output...
-
- #if MASKS
- Boolean needdraw= true;
- Nlm_RecT crec;
- maskval= fSeq->MaskAt(ibase,0); // val for all masks
- if (maskval>0)
- for (masklevel=1; needdraw && masklevel<5; masklevel++) {
- // LATER: want to allow drawing of all mask forms for each base !?
- style= GetStyle( ibase, masklevel, fSeq);
- if (style) {
- Nlm_LoadRect( &crec, atx, r.top, atx+fItemWidth, r.bottom);
- nextstyle= GetStyle( ibase+1, masklevel, fSeq);
- topstyle= GetStyle( ibase, masklevel, fTopSeq);
- botstyle= GetStyle( ibase, masklevel, fBotSeq);
-
- #if 1
- if (style->repeatchar && fItemrow > 0
- && fCommonbase && fFirstcommon
- && fCommonbase[ibase] != '!'
- && fItemrow > (unsigned char)fFirstcommon[ibase]
- && toupper(ch) == fCommonbase[ibase])
- ch= style->repeatchar;
- #else
- if (style->repeatchar && fItemrow > 0
- && DStyleTable::fToprow
- && ibase < DStyleTable::fToprowlen
- && ch == DStyleTable::fToprow[ibase])
- ch= style->repeatchar;
- #endif
-
- if (style->uppercase) ch= toupper(ch);
- else if (style->lowercase) ch= tolower(ch);
-
- if (style->font &&
- (style->font != Nlm_fontInUse || style->font != DStyleTable::fLaststyle.font))
- Nlm_SelectFont(style->font);
-
- // this is good only w/ backcolor !?
- if (style->dofontpat) {
- if ( haspat == kHasFillPat ||
- (Nlm_MemCmp(style->fontpattern, DStyleTable::fLaststyle.fontpattern, 8) != 0)
- ) {
- Nlm_PenPattern(style->fontpattern);
- haspat= kHasFillPat;
- }
- }
- else if (haspat) { Nlm_Solid(); haspat= kNoPat; }
-
- if (style->dobackcolor) {
- newcolor= style->backcolor;
- if (curcolor != newcolor) {
- curcolor= newcolor;
- Nlm_SetColor( curcolor);
- }
- Nlm_PaintRect(&crec);
- }
-
- if (style->dofontcolor) newcolor= style->fontcolor;
- else if (fColors) newcolor= fColors[ch-' '];
- else newcolor= blackcolor;
- if (curcolor != newcolor) {
- curcolor= newcolor;
- Nlm_SetColor( curcolor);
- }
-
- //if (style->invertcolor) Nlm_InvertColors();
- //if (style->invertcolor) Nlm_EraseMode();//TextMode(srcBIC);
-
- Nlm_PaintChar(ch);
- needdraw= false;
-
- //if (style->invertcolor) Nlm_CopyMode();
- if (style->invertcolor) Nlm_InvertRect( &crec);
-
- if (style->frame) {
- Boolean anyframe, leftframe, rightframe, topframe, botframe;
- leftframe = (!(laststyle && laststyle->frame));
- rightframe= (!(nextstyle && nextstyle->frame));
- topframe = (!(topstyle && topstyle->frame));
- botframe = (!(botstyle && botstyle->frame));
- anyframe = leftframe||rightframe||topframe||botframe;
-
- if (anyframe) {
- if (style->doframecolor) newcolor= style->framecolor;
- else newcolor= blackcolor;
- if (curcolor != newcolor) {
- curcolor= newcolor;
- Nlm_SetColor( curcolor);
- }
- if (style->framestyle) {
- switch (style->framestyle) {
- case DSeqStyle::kFrameSolid : Nlm_Solid(); break;
- case DSeqStyle::kFrameDark : Nlm_Dark(); break;
- case DSeqStyle::kFrameMedium: Nlm_Medium(); break;
- case DSeqStyle::kFrameLight : Nlm_Light(); break;
- case DSeqStyle::kFrameDotted: Nlm_Dotted(); break;
- case DSeqStyle::kFrameDashed: Nlm_Dashed(); break;
- }
- }
- haspat= kHasFramePat;
- }
-
- if (leftframe) {
- Nlm_MoveTo(crec.left,crec.top);
- Nlm_LineTo(crec.left,crec.bottom);
- }
- if (rightframe) {
- Nlm_MoveTo(crec.right-1,crec.top);
- Nlm_LineTo(crec.right-1,crec.bottom);
- }
- if (topframe) {
- Nlm_MoveTo(crec.left,crec.top);
- Nlm_LineTo(crec.right,crec.top);
- }
- if (botframe) {
- Nlm_MoveTo(crec.left,crec.bottom-1);
- Nlm_LineTo(crec.right,crec.bottom-1);
- }
- if (anyframe) Nlm_TextTransparent(); // MSWin LineTo/DrawLine resets Opaque!
- }
-
- DStyleTable::fLaststyle= *style;
- laststyle= style;
- }
- }
-
- if (needdraw) {
- if (haspat) { Nlm_Solid(); haspat= kNoPat; }
- if (Nlm_fontInUse != fFont) Nlm_SelectFont(fFont);
- if (fColors) {
- newcolor= fColors[ch-' '];
- if (curcolor != newcolor) {
- curcolor= newcolor;
- Nlm_SetColor( curcolor);
- }
- }
- else if (curcolor != blackcolor) {
- Nlm_Black(); // if WithStyle left a color set.... !!
- curcolor= blackcolor;
- }
- Nlm_PaintChar(ch);
- laststyle= NULL;
- }
-
- #else
- if (fColors) {
- // if (swapBackcolor) Nlm_SetBackColor( fColors[ch-' ']); else
- if (ch!=lastch) Nlm_SetColor( fColors[ch-' ']);
- }
- Nlm_PaintChar(ch);
- #endif
- lastch= ch;
- atx += fItemWidth;
- }
- Nlm_TextOpaque();
- Nlm_Black();
- if (haspat) { Nlm_Solid(); haspat= kNoPat; }
- curcolor= blackcolor;
- }
- }
-
- const char* DDrawSeqRow::Write( short row, short col, long startitem, long stopitem)
- {
- long len, i;
- char* bases= fBases;
- len= Min( kMaxLinebuf, stopitem-startitem);
- if (bases && startitem < fLength) {
- char ch, *b;
- if (stopitem > fLength) stopitem= fLength;
- for (b= bases + startitem, i=0; *b && i<len; b++, i++) {
- ch= *b;
- if (ch == DSequence::indelSoft) ch= DSequence::indelHard; //looks better
- fLinebuf[i]= ch;
- }
- for ( ; i<len; i++) fLinebuf[i]= ' ';
- }
- fLinebuf[len]= 0;
- return fLinebuf;
- }
-
-
-
- class DDrawManySeqRow : public DDrawSeqRow {
- public:
- DSeqList * fSeqList;
- //short fLinesPerparag, fTopPerparag;
-
- DDrawManySeqRow(Nlm_FonT itsFont, DSeqPrintView* itsView,
- DSeqList* seqlist, long seqIndex, DList* itsStyles, ulong* colors,
- char* commonbases, char* firstcommon);
- #if 0
- virtual ~DDrawManySeqRow();
- virtual void Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem);
- virtual const char* Write( short row, short col, long startitem, long stopitem);
- virtual char* GetName(short row);
- #endif
- };
-
-
- DDrawManySeqRow::DDrawManySeqRow(Nlm_FonT itsFont, DSeqPrintView* itsView,
- DSeqList* seqlist, long seqIndex, DList* itsStyles, ulong* colors,
- char* commonbases, char* firstcommon) :
- DDrawSeqRow( itsFont, itsView, NULL, itsStyles, NULL, colors),
- fSeqList(seqlist)
- {
- fItemrow= seqIndex;
- fSeq= seqlist->SeqAt( fItemrow);
- if (fSeq) {
- fName= fSeq->Name();
- fBases= fSeq->Bases();
- fLength= fSeq->LengthF();
- }
- fTopSeq= seqlist->SeqAt(fItemrow-1);
- fBotSeq= seqlist->SeqAt(fItemrow+1);
- fCommonbase= commonbases;
- fFirstcommon= firstcommon;
- //fCommonbase= fSeqList->FindCommonBases(DSeqList::gMinCommonPercent, fFirstcommon);
- }
-
- #if 0
- DDrawManySeqRow::~DDrawManySeqRow()
- {
- }
-
- char* DDrawManySeqRow::GetName(short row)
- {
- //DSequence* aSeq= NULL;
- //short atseq= (row % fLinesPerparag) - fTopPerparag;
- //if (fItemrow>=0) aSeq= (DSequence*) fSeqList->At( fItemrow);
- //if (fSeq) return fSeq->Name(); else
- return fName;
- }
-
- void DDrawManySeqRow::Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem)
- {
- //DSequence* aSeq= NULL;
- // short atseq= (row % fLinesPerparag) - fTopPerparag; // == fItemrow
- //if (fItemrow>=0) aSeq= (DSequence*) fSeqList->At(fItemrow);
- if (fSeq) {
- //fSeq= aSeq;
- //fTopSeq= (DSequence*) fSeqList->At(fItemrow-1);
- //fBotSeq= (DSequence*) fSeqList->At(fItemrow+1);
- //fBases= aSeq->Bases();
- //fLength= aSeq->LengthF();
- DDrawSeqRow::Draw( r, row, col, startitem, stopitem);
- }
- }
-
- const char* DDrawManySeqRow::Write( short row, short col, long startitem, long stopitem)
- {
- //DSequence* aSeq= NULL;
- // short atseq= (row % fLinesPerparag) - fTopPerparag;
- //if (fItemrow>=0) aSeq= (DSequence*) fSeqList->At(fItemrow);
- if (fSeq) {
- //fSeq= aSeq;
- //fBases= aSeq->Bases();
- //fLength= aSeq->LengthF();
- return DDrawSeqRow::Write( row, col, startitem, stopitem);
- }
- else
- return "";
- }
-
- #endif
-
-
-
- class DDrawAminoRow : public DDrawMapRow {
- public:
- char fNameStore[20];
- char * fBases;
- short fFrame, fItemWidth;
- Boolean fThreeLet, fOnlyORF;
- DSequence * fAAseq;
- long fLength;
-
- DDrawAminoRow(Nlm_FonT itsFont, DSequence* itsSeq, short frame);
- virtual ~DDrawAminoRow() { if (fAAseq) delete fAAseq; }
- virtual void Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem);
- virtual const char* Write( short row, short col, long startitem, long stopitem);
- virtual short GetIndex(short item) { return kNoIndex; }
- };
-
-
- DDrawAminoRow::DDrawAminoRow(Nlm_FonT itsFont, DSequence* itsSeq, short frame) :
- fAAseq(NULL), fFrame( frame), fLength(0),
- fOnlyORF(DSeqPrintPrefs::gOnlyORF),
- fThreeLet(DSeqPrintPrefs::gThreeLetAA)
- {
- Boolean iscomp = frame > 2;
- short offset = frame % 3;
- fFont= itsFont;
- if (fFont) Nlm_SelectFont(fFont);
- fHeight= Nlm_LineHeight();
- fItemWidth= BaseCharWidth();
- sprintf( fNameStore, "aa%d", frame);
- fName= fNameStore;
- if (iscomp) {
- itsSeq->SetSelection( -1,-1);
- itsSeq= itsSeq->Reverse();
- // strange patches...
- if (offset==1) offset= 2;
- else if (offset==2) offset= 1;
- if (offset==2) itsSeq->InsertSpacers(itsSeq->LengthF(),offset,'?');
- }
- itsSeq->SetSelection( offset, itsSeq->LengthF() - offset);
- fAAseq= itsSeq->Translate(false);
- if (iscomp) { delete itsSeq; itsSeq= NULL; }
- if (fAAseq) {
- fBases= fAAseq->Bases();
- fLength= fAAseq->LengthF();
- if (fOnlyORF) {
- long i;
- Boolean isorf;
- char startamino= DCodons::startamino();
- for (isorf= true, i= 0; i<fLength; i++) {
- if (isorf) {
- if (fBases[i] == '*') isorf= false;
- }
- else {
- if (fBases[i] == startamino) isorf= true;
- if (!isorf) fBases[i]= ' ';
- }
- }
- }
- if (iscomp) {
- fAAseq->SetSelection( -1,-1);
- DSequence* unrevAA= fAAseq->Reverse();
- delete fAAseq;
- fAAseq= unrevAA;
- fBases= fAAseq->Bases();
- fLength= fAAseq->LengthF();
- }
- }
- }
-
- void DDrawAminoRow::Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem)
- {
- long len;
- short leftindent;
- char* bases= fBases;
- if (bases) {
- if (col) {
- bases += col;
- startitem += col;
- }
- #if 0
- short indents[3,3] = {
- {0,1,2},
- {2,0,1},
- {1,2,0}
- };
- // at 0 -> 0,1,2 now & want 0%3=0
- // at 50 -> 2,0,1 now -> 1,2,0 want 50%3=2
- // at 100 -> 1,2,0 now -> 2,0,1 want 100%3=1
- // at 150 -> 0,1,2 now & want 150%3=0
- #endif
- leftindent= (fFrame + (3 - (startitem % 3)) % 3) % 3;
-
- len= (stopitem - startitem + 2) / 3;
- startitem = (startitem + 2) / 3; // adjust for 3-to-1 NA-to-AA translate
- if (startitem + len > fLength) len= fLength - startitem;
- if (startitem < fLength) {
- char *b;
- short chleft, chvert, chwidth;
-
- chvert= r.bottom-2;
- chwidth = fItemWidth;
- chleft = r.left + chwidth * leftindent;
- chwidth *= 3;
- if (fFont) Nlm_SelectFont(fFont);
- if (fThreeLet) for (b= bases+startitem; *b && len; b++, len--) {
- Nlm_MoveTo( chleft, chvert);
- Nlm_PaintString( (char*) DSequence::Amino123(*b));
- chleft += chwidth;
- }
- else for (b= bases+startitem; *b && len; b++, len--) {
- Nlm_MoveTo( chleft, chvert);
- Nlm_PaintChar(*b);
- chleft += chwidth;
- }
- }
- }
- }
-
- const char* DDrawAminoRow::Write( short row, short col, long startitem, long stopitem)
- {
- long len, alen;
- short leftindent;
- char* bases= fBases;
- if (bases) {
- len= Min( kMaxLinebuf, 1+stopitem-startitem);
- Nlm_MemFill( fLinebuf, ' ', len);
-
- leftindent= (fFrame + (3 - (startitem % 3)) % 3) % 3;
-
- alen= (stopitem - startitem + 2) / 3;
- startitem = (startitem + 2) / 3; // adjust for 3-to-1 NA-to-AA translate
- if (startitem + alen > fLength) alen= fLength - startitem;
- if (startitem < fLength) {
- char *b, *cp;
- long i;
- i= leftindent;
- if (fThreeLet)
- for (b= bases+startitem; *b && alen && i<len; b++, alen--, i += 3) {
- char * amino3= (char*) DSequence::Amino123(*b);
- cp= fLinebuf + i;
- MemCpy( cp, amino3, 3);
- }
- else
- for (b= bases+startitem; *b && alen && i<len; b++, alen--, i += 3) {
- fLinebuf[i]= *b;
- }
- }
- }
- fLinebuf[len]= 0;
- return fLinebuf;
- }
-
-
-
- class DDrawZymeTable : public DDrawMapRow {
- public:
- char** fLinelist;
- char * fTableTitle;
-
- DDrawZymeTable(Nlm_FonT itsFont, DREMap* itsREMap, short rowoffset);
- virtual ~DDrawZymeTable();
- virtual void Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem);
- virtual const char* Write( short row, short col, long startitem, long stopitem);
- virtual short GetIndex(short item) { return kNoIndex; }
- virtual char* TableLine(short atline);
- virtual void Clip( Nlm_RecT& r, short row, long startitem, long stopitem,
- Nlm_RecT& viewr, Nlm_RegioN cliprgn);
- };
-
- class DDrawAllZymeTable : public DDrawZymeTable {
- public:
- DDrawAllZymeTable(Nlm_FonT itsFont, DREMap* itsREMap, short rowoffset);
- };
-
- class DDrawNocutZymeTable : public DDrawZymeTable {
- public:
- DDrawNocutZymeTable(Nlm_FonT itsFont, DREMap* itsREMap, short rowoffset,
- short mincuts = 0, short maxcuts = 0);
- };
-
-
- DDrawZymeTable::DDrawZymeTable(Nlm_FonT itsFont, DREMap * itsREMap, short rowoffset) :
- fLinelist(NULL)
- {
- fName= "";
- fFont= itsFont;
- if (fFont) Nlm_SelectFont(fFont);
- fHeight= Nlm_LineHeight();
- fTableTitle= "TABLE of enzymes";
- fRowOffset= rowoffset;
- }
-
- DDrawZymeTable::~DDrawZymeTable()
- {
- for (short i=0; i<fLinecount; i++) MemFree( fLinelist[i]);
- MemFree( fLinelist);
- }
-
-
- char* DDrawZymeTable::TableLine(short atline)
- {
- //if (atline == 0) return fTableTitle; else
- if (atline>=0 && atline<fLinecount) return fLinelist[atline];
- else return "";
- }
-
- void DDrawZymeTable::Clip( Nlm_RecT& r, short row, long startitem, long stopitem,
- Nlm_RecT& viewr, Nlm_RegioN cliprgn)
- {
- //Nlm_ClipRgn( cliprgn);
- Nlm_RecT clipr= r;
- clipr.left= viewr.left + 10;
- clipr.right= viewr.right - 10;
- clipr.bottom= Min( r.bottom, viewr.bottom);
- clipr.top= Max(r.top, viewr.top);
- Nlm_ClipRect( &clipr);
- }
-
- void DDrawZymeTable::Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem)
- {
- short chleft, chvert, atline;
- char * tabline;
-
- chleft = r.left;
- chvert = r.bottom-2;
- atline = row - fRowOffset;
- tabline= TableLine(atline);
- if (tabline) {
- if (col) {
- if (StrLen(tabline)>col) tabline += col; // ??? offset TableLine by # cols ?
- else tabline= "";
- }
- if (fFont) Nlm_SelectFont(fFont);
- if (atline == 0) {
- Nlm_MoveTo( chleft, chvert-1);
- Nlm_PaintString( tabline);
- Nlm_MoveTo( r.left, r.bottom-1);
- Nlm_LineTo( r.right, r.bottom-1);
- }
- else if (atline >= 0 && atline < fLinecount) {
- Nlm_MoveTo( chleft, chvert);
- Nlm_PaintString( tabline);
- }
- }
- }
-
- const char* DDrawZymeTable::Write( short row, short col, long startitem, long stopitem)
- {
- long len, atline;
- char * cp;
-
- atline = row - fRowOffset;
- len= Min( kMaxLinebuf, 80);
- if (atline == 0) {
- Nlm_MemFill( fLinebuf, '_', len);
- StrCpy( fLinebuf, TableLine(atline));
- cp= StrChr(fLinebuf, '\0');
- if (cp) *cp= ' ';
- }
- else if (atline >= 0 && atline < fLinecount) {
- Nlm_MemFill( fLinebuf, ' ', len);
- cp = TableLine(atline);
- StrCpy( fLinebuf, cp);
- cp= StrChr(fLinebuf, '\0');
- if (cp) *cp= ' ';
- }
- else {
- Nlm_MemFill( fLinebuf, ' ', len);
- }
- fLinebuf[len]= 0;
- return fLinebuf;
- }
-
-
-
- DDrawAllZymeTable::DDrawAllZymeTable(Nlm_FonT itsFont, DREMap * itsREMap, short rowoffset) :
- DDrawZymeTable( itsFont, itsREMap, rowoffset)
- {
- fTableTitle= "TABLE of all enzymes";
- if (1) {
- char * zymeline = NULL;
- long i, nzymes, linelen, linecount;
- char buf[128], comma;
-
- nzymes= DREMap::fREnzymes->GetSize();
- linecount= 4 + nzymes / 4;
- fLinelist= (char**) MemNew( linecount * sizeof(char*));
- fLinecount= 0;
- sprintf( buf, " TABLE of All Enzymes (name: cut count)");
- fLinelist[fLinecount++]= StrDup(buf);
- //sprintf( buf, " ");
- //fLinelist[fLinecount++]= StrDup(buf);
-
- for (i=0, comma = ','; i<nzymes; i++) {
- if (i == nzymes-1) comma= ' ';
- DREnzyme* re= (DREnzyme*) DREMap::fREnzymes->At(i);
- if (re) {
- //sprintf( buf, "%10s:%3d%c ", re->fName, re->fCutcount, comma);
- sprintf( buf, "%9s:%3d ", re->fName, re->fCutcount, comma);
- if (zymeline)
- zymeline= Dgg_StrExtendCat( &zymeline, buf);
- else {
- zymeline= StrDup(buf);
- }
- linelen= StrLen(zymeline);
- if (linelen > 70) {
- fLinelist[fLinecount++]= zymeline;
- zymeline= NULL;
- }
- }
-
- if (fLinecount >= linecount) {
- linecount += 10;
- fLinelist= (char**) Nlm_MemMore( fLinelist, linecount * sizeof(char*));
- }
- }
- if (zymeline) fLinelist[fLinecount++]= zymeline;
- }
- }
-
-
- DDrawNocutZymeTable::DDrawNocutZymeTable( Nlm_FonT itsFont, DREMap * itsREMap,
- short rowoffset, short mincuts, short maxcuts) :
- DDrawZymeTable( itsFont, itsREMap, rowoffset)
- {
- if (maxcuts) fTableTitle= "TABLE of excluded enzymes";
- else fTableTitle= "TABLE of non-cutting enzymes";
- if (1) {
- char * zymeline = NULL;
- long i, nzymes, linelen, linecount;
- char buf[128], comma;
- Boolean dolist;
-
- nzymes= DREMap::fREnzymes->GetSize();
- linecount= 4 + nzymes / 6;
- fLinelist= (char**) MemNew( linecount * sizeof(char*));
- fLinecount= 0;
- if (maxcuts) sprintf( buf, " TABLE of Excluded Enzymes");
- else sprintf( buf, " TABLE of Noncutting Enzymes");
- fLinelist[fLinecount++]= StrDup(buf);
- if (maxcuts) {
- sprintf( buf, " (cut with less than %d or more than %d cuts)", mincuts, maxcuts);
- fLinelist[fLinecount++]= StrDup(buf);
- }
-
- for (i=0, comma = ','; i<nzymes; i++) {
- //if (i == nzymes-1) comma= ' ';
- DREnzyme* re= (DREnzyme*) DREMap::fREnzymes->At(i);
- if (re) {
- if (maxcuts)
- dolist= (re->fCutcount > 0 && (re->fCutcount < mincuts || re->fCutcount > maxcuts));
- else
- dolist= re->fCutcount == 0;
- if (dolist) {
- //sprintf( buf, "%9s%c ", re->fName,comma);
- sprintf( buf, "%9s ", re->fName);
- if (zymeline)
- zymeline= Dgg_StrExtendCat( &zymeline, buf);
- else {
- zymeline= StrDup(buf);
- }
- linelen= StrLen(zymeline);
- if (linelen > 60) {
- fLinelist[fLinecount++]= zymeline;
- zymeline= NULL;
- }
- }
- }
-
- if (fLinecount >= linecount) {
- linecount += 10;
- fLinelist= (char**) Nlm_MemMore( fLinelist, linecount * sizeof(char*));
- }
- }
- if (zymeline) fLinelist[fLinecount++]= zymeline;
- }
- }
-
-
-
-
-
-
-
-
- class DDrawZymeCutTable : public DDrawZymeTable {
- public:
- DRECutsItem * fCutList;
- long fCutcount;
- short fCuttersCount; //# zymes that cut
-
- DDrawZymeCutTable(Nlm_FonT itsFont, DREMap* itsREMap, short rowoffset);
- virtual ~DDrawZymeCutTable();
- virtual char* TableLine(short atline);
- virtual char* GetName(short row);
- virtual Boolean DoLeftName() { return true; }
- };
-
-
- #ifdef WIN_MSWIN
- static int LIBCALLBACK
- #else
- static int
- #endif
- zymenameCompare(void* a, void* b)
- {
- short diff = StringCmp(((DRECutsItem*)a)->fREnzyme->fName, ((DRECutsItem*)b)->fREnzyme->fName);
- if (diff == 0) {
- return ((DRECutsItem*)a)->fSeqIndex - ((DRECutsItem*)b)->fSeqIndex;
- }
- else
- return diff;
- }
-
-
-
- DDrawZymeCutTable::DDrawZymeCutTable(Nlm_FonT itsFont, DREMap * itsREMap, short rowoffset) :
- DDrawZymeTable( itsFont, itsREMap, rowoffset),
- fCutList(NULL), fCutcount(0), fCuttersCount(0)
- {
- fTableTitle= "TABLE of cut points";
- if (itsREMap) {
- fCutcount= itsREMap->fCutcount;
- fCuttersCount= itsREMap->fCuttersCount;
- fCutList= (DRECutsItem*) Nlm_MemDup( itsREMap->fSeqCuts, fCutcount * sizeof(DRECutsItem));
- if (fCutList) {
- long i, at, lastat, linecount, linelen;
- char *name, *zymeline = NULL, *lastname="";
- char buf[128];
-
- Nlm_HeapSort( fCutList, fCutcount, sizeof(DRECutsItem), zymenameCompare);
-
- // what if we need more than one line for zyme cut list !!
- for (i=0, linecount= 0; i<fCutcount; i++) {
- name= fCutList[i].fREnzyme->fName;
- if (StringCmp(name, lastname)!=0) linecount++;
- lastname= name;
- }
- linecount += 3;
- fLinelist= (char**) MemNew( linecount * sizeof(char*));
-
- fLinecount= 0;
- sprintf( buf, " TABLE of Cut Points");
- fLinelist[fLinecount++]= StrDup(buf);
- //sprintf( buf, " ");
- //fLinelist[fLinecount++]= StrDup(buf);
-
- linelen= 0;
- lastname= ""; lastat= -1;
- for (i=0; i<fCutcount && fLinecount < linecount; i++) {
- name= fCutList[i].fREnzyme->fName;
- at= fCutList[i].fSeqIndex;
- if (StringCmp(name, lastname)==0 && linelen<70) {
- if (at != lastat) {
- sprintf(buf, " %d", at);
- if (zymeline) {
- zymeline= Dgg_StrExtendCat( &zymeline, buf);
- linelen= StrLen(zymeline);
- }
- }
- }
- else {
- if (zymeline) fLinelist[fLinecount++]= zymeline;
- sprintf(buf, "%s: %d", name, at);
- zymeline= (char*) MemNew(StrLen(buf)+1);
- Nlm_StringCpy(zymeline, buf);
- linelen= StrLen(buf);
- }
-
- lastname= name;
- lastat= at;
- if (fLinecount >= linecount) {
- linecount += 10;
- fLinelist= (char**) Nlm_MemMore( fLinelist, linecount * sizeof(char*));
- }
- }
- if (zymeline) fLinelist[fLinecount++]= zymeline;
- }
- }
- }
-
-
- DDrawZymeCutTable::~DDrawZymeCutTable()
- {
- MemFree( fCutList);
- }
-
- char* DDrawZymeCutTable::TableLine(short atline)
- {
- //if (atline == 0) return fTableTitle; else
- if (atline>=0 && atline<fLinecount) {
- char * name = fLinelist[atline];
- char * cp= StrChr(name,':');
- if (cp) cp++; else cp= name;
- return cp;
- }
- else return "";
- }
-
- char* DDrawZymeCutTable::GetName(short row)
- {
- enum { kNameLen = 80 };
- static char name[kNameLen];
- short atline = row - fRowOffset;
- if (atline == 0) {
- return "ENZYME";
- }
- else if (atline> 0 && atline < fLinecount) {
- StrNCpy(name, fLinelist[atline], kNameLen-1);
- name[kNameLen-1]= 0;
- char* cp= StrChr(name,':'); if (cp) *cp= 0;
- return name;
- }
- else
- return fName;
- }
-
-
-
- class DDrawZymeRow : public DDrawMapRow {
- public:
- DSequence * fSeq, * fCoSeq;
- DREMap * fREMap;
- short fMinCuts, fMaxCuts;
- DRECutsItem * fCutList;
- Boolean fGoodMap;
-
- DDrawZymeRow( Nlm_FonT itsFont, DSequence* itsSeq);
- virtual ~DDrawZymeRow() { delete fREMap; }
- virtual short DrawOrMeasure( Nlm_Boolean doDraw, Nlm_RecT& r, short row, long startitem, long stopitem);
- virtual void Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem);
- virtual const char* Write( short row, short col, long startitem, long stopitem);
- virtual short GetIndex(short item) { return kNoIndex; }
- virtual short GetHeight( Nlm_RecT& r, short row, long startitem, long stopitem);
- virtual void Clip( Nlm_RecT& r, short row, long startitem, long stopitem,
- Nlm_RecT& viewr, Nlm_RegioN cliprgn);
- };
-
-
- DDrawZymeRow::DDrawZymeRow(Nlm_FonT itsFont, DSequence* itsSeq) :
- fSeq( itsSeq), fGoodMap(false), fCoSeq(NULL), fCutList(NULL),
- fMinCuts(DSeqPrintPrefs::gREMinCuts),
- fMaxCuts(DSeqPrintPrefs::gREMaxCuts)
- {
- fName= "zyme";
- fFont= itsFont;
- if (fFont) Nlm_SelectFont(fFont);
- fHeight= 4 * Nlm_LineHeight(); // ! need to calc line height for each row !?
- fREMap= new DREMap();
- if (fREMap) {
- fREMap->MapSeq(fSeq);
- fCoSeq= fREMap->fCoSeq;
- fCutList= fREMap->fSeqCuts;
- }
- fGoodMap= (fREMap && fCoSeq && fCutList);
- }
-
- void DDrawZymeRow::Clip( Nlm_RecT& r, short row, long startitem, long stopitem,
- Nlm_RecT& viewr, Nlm_RegioN cliprgn)
- {
- //Nlm_ClipRgn( cliprgn);
- Nlm_RecT clipr= r;
- clipr.left= viewr.left + 10;
- clipr.right= viewr.right - 10;
- clipr.bottom= Min( r.bottom, viewr.bottom);
- clipr.top= Max(r.top, viewr.top);
- Nlm_ClipRect( &clipr);
- }
-
-
- #define znameCenter 0
-
- short DDrawZymeRow::DrawOrMeasure( Nlm_Boolean doDraw, Nlm_RecT& r, short row, long startitem, long stopitem)
- {
- /*====
- gctcggctgctgctcggctg
- || | ||
- abcI cbaII
- hcgX
- ====*/
-
- short nameHeight, rowLeft, rowTop;
- short chwidth, chleft, ncuts, cutindx;
- short cuts, wd, ws, rowBot, lasti, i;
- Nlm_PoinT at;
- Boolean first,overlap;
- char * lastzyme, * zymes;
- Nlm_RecT fillRect, bRect, cRect;
- Nlm_RegioN filledArea, aRgn;
-
- if (!fGoodMap) return 0;
- cutindx = 0; //cutindx= fLastZymeCut;
- fREMap->CutsAtBase( startitem, cutindx, ncuts); //!? don't care if startbase has no cuts
- //fLastZymeCut= cutindx; // ????
-
- if (fFont) Nlm_SelectFont(fFont);
-
- //atcellh= col;
- nameHeight= Nlm_FontHeight(); // cHeight;
- rowTop= r.top;
- rowLeft= r.left;
- rowBot= rowTop;
- chwidth= (r.right - r.left) / (stopitem - startitem);
-
- filledArea= Nlm_CreateRgn();
- aRgn= Nlm_CreateRgn();
-
- chleft= rowLeft + kNucSpace;
- Nlm_LoadRect( &fillRect, chleft, rowTop, chleft+1, rowTop+1);
- RectRgn( filledArea, &fillRect); //must start w/ non-empty rgn
- Nlm_MoveTo( chleft, rowTop);
- for ( i= startitem; i<=stopitem; i++) {
- while (fCutList[cutindx].fSeqIndex < i) cutindx++;
- first= true;
- lasti= -1;
- lastzyme= "";
- while (fCutList[cutindx].fSeqIndex == i) {
- zymes= fCutList[cutindx].fREnzyme->fName;
- cuts = fCutList[cutindx].fREnzyme->fCutcount;
- cutindx++;
- if (cuts < fMinCuts || cuts > fMaxCuts) goto nextZyme;
- //! Kludge til we fix REMap to stop dups
- if ( i==lasti && StringCmp(zymes,lastzyme)==0) goto nextZyme;
- lasti= i;
- lastzyme= zymes;
-
- if (first) {
- Nlm_MoveTo( chleft, rowTop);
- if (doDraw) Nlm_LineTo( chleft, rowTop+2/*kTicSize*/);
- else Nlm_MoveTo( chleft, rowTop+2);
- }
-
- ws= Nlm_StringWidth( zymes);
- wd= 2 + ws / 2;
- do {
- Nlm_GetPen( &at);
- #if znameCenter
- Nlm_LoadRect( &cRect, at.x-wd, at.y, at.x+wd, at.y+nameHeight);
- #else
- Nlm_LoadRect( &cRect, at.x-1, at.y, at.x+ws+1, at.y+nameHeight);
- #endif
- overlap= Nlm_RectInRgn( &cRect, filledArea);
-
- if (doDraw && overlap && !first) {
- //!? replace this w/ draw top to bottom of line, then overwrite zyme names
- Nlm_LoadRect( &bRect, at.x, at.y-nameHeight, at.x+1, at.y);
- if (!Nlm_RectInRgn( &bRect, filledArea)) {
- Nlm_MoveTo( chleft, at.y-nameHeight+1);
- Nlm_LineTo( chleft, at.y);
- }
- }
- first= false;
- Nlm_MoveTo( chleft, at.y+nameHeight);
- } while (overlap);
-
- RectRgn( aRgn, &cRect);
- Nlm_UnionRgn(filledArea, aRgn, filledArea);
- #if znameCenter
- Nlm_MoveTo( chleft - (ws / 2), at.y+nameHeight);
- #else
- Nlm_MoveTo( chleft, at.y+nameHeight);
- #endif
- if (doDraw) {
- //TextMode(srcCopy); //erase line overlaps...
- Nlm_PaintString( zymes);
- //TextMode(srcOr);
- }
- Nlm_GetPen( &at);
- rowBot = Max( rowBot, at.y);
- nextZyme:
- lasti= i;
- }
-
- //spaceright();
- //chright= chleft + GetColWidth(atCellh) - fColInset;
- //chleft = chright + fColInset;
- //atcellh++;
- chleft += chwidth;
- }
- Nlm_DestroyRgn( filledArea);
- Nlm_DestroyRgn( aRgn);
- return (rowBot - rowTop + 2); //+ 12); /* lineHeight + fudge factor*/
- }
-
-
-
-
- const char* DDrawZymeRow::Write( short row, short col, long startitem, long stopitem)
- {
- /*====
- gctcggctgctgctcggctg
- || | ||
- abcI cbaII
- hcgX
- ====*/
-
- short chleft, ncuts, cutindx;
- short cuts, ws, lasti;
- Boolean first,overlap;
- char * lastzyme, * zymes;
-
- short linelen;
- long len, i, nlines, maxlines;
- char ** lines;
- short zlen, zat, atleft, atline;
-
-
- if (!fGoodMap) return 0;
- len= Min( kMaxLinebuf, stopitem-startitem);
- Nlm_MemFill( fLinebuf, ' ', kMaxLinebuf);
-
- linelen= stopitem-startitem + 5; // +2;
- maxlines= kMaxLinebuf / linelen;
- lines= (char**) MemNew( (maxlines+1) * sizeof(char*));
- for (i=0; i<maxlines; i++) lines[i]= fLinebuf + (linelen * i);
- nlines= 0;
-
- cutindx = 0; //cutindx= fLastZymeCut;
- fREMap->CutsAtBase( startitem, cutindx, ncuts); //!? don't care if startbase has no cuts
- //fLastZymeCut= cutindx; // ????
-
- for ( i= startitem; i<=stopitem; i++) {
- while (fCutList[cutindx].fSeqIndex < i) cutindx++;
- first= true;
- lasti= -1;
- lastzyme= "";
- chleft= i - startitem;
- while (fCutList[cutindx].fSeqIndex == i) {
- zymes= fCutList[cutindx].fREnzyme->fName;
- cuts = fCutList[cutindx].fREnzyme->fCutcount;
- cutindx++;
- if (cuts < fMinCuts || cuts > fMaxCuts) goto nextZyme;
- //! Kludge til we fix REMap to stop dups
- if ( i==lasti && StringCmp(zymes,lastzyme)==0) goto nextZyme;
- lasti= i;
- lastzyme= zymes;
-
- if (first) {
- lines[0][chleft]= '|';
- first= false;
- }
-
- ws= StrLen( zymes);
- #if znameCenter
- wd= ws / 2;
- atleft= chleft - wd;
- #else
- atleft= chleft;
- #endif
- atline= 1;
- do {
- for (zlen=0, zat=atleft, overlap= false; zlen<ws; zlen++, zat++)
- if (lines[atline][zat] != ' ') { overlap= true; break; }
- if (overlap) atline++;
- } while (overlap && atline<maxlines);
- MemCpy( lines[atline]+atleft, zymes, ws);
- if (++atline > nlines) nlines= atline;
- first= false;
-
- nextZyme:
- lasti= i;
- }
-
- }
-
- //return (rowBot - rowTop + 12); /* lineHeight + fudge factor*/
-
- for (i=1; i<nlines; i++) *(lines[i]-1)= '\n';
- if (nlines) lines[nlines-1][linelen-1]= 0;
- MemFree(lines);
- fLinebuf[kMaxLinebuf]= 0;
- return fLinebuf;
- }
-
-
-
- short DDrawZymeRow::GetHeight( Nlm_RecT& r, short row, long startitem, long stopitem)
- {
- return DrawOrMeasure( false, r, row, startitem, stopitem);
- }
-
- void DDrawZymeRow::Draw( Nlm_RecT& r, short row, short col, long startitem, long stopitem)
- {
- if (col) { startitem += col; } // ???
- (void) DrawOrMeasure( true, r, row, startitem, stopitem);
- }
-
-
-
-
-
- /********
- methods & fields for various draw objects:
- single-seq
- multi-seq
- single-seq [+rezymes] [+complement] [+amino-trans] [+... others]
- multi-seq [+?consensus] [+?? annotations of various kinds for mseq ]
-
- fSeqsPerParag
- fSeqLinesPerParag
- fSpacersPerParag
-
- DRowDrawer* GetRowDrawer( atseq):
- Spacer, TopIndex,
- SeqLine(s), ComplSeqLine,
- AA[1-3], CompAA[1-3], RestEnzyme
-
- make fRowsList [1..fLinesPerParag] of DRowDrawer objects...
-
- calcs:
- //linesPerParag = fSeqLinesPerParag + fSpacersPerParag
- atseq = (row % fLinesPerParag)
- seqline= (row / fLinesPerParag) * seqsperparag;
- startcol= seqline * fBasesPerLine;
- stopcol = startcol + fBasesPerLine;
- *****/
-
-
-
-
-
- // class DSeqPrintView
-
- class DSeqPrintView : public DTableView
- {
- public:
- Boolean fOneseq, fDoLeftName, fDoRightName,
- fDoTopIndex, fDoLeftIndex, fDoRightIndex;
- Nlm_FonT fNameFont, fNumFont, fBaseFont;
- short fBaseWidth, fIndexWidth, fIndexWidthCnt, fNameWidth, fNameWidthCnt,
- fSeqsperparag, fExtrarows, fSeqLinesPerParag, fLinesPerParag,
- fTopPerparag, fBasesPerLine, fTenSpacer;
- long fFirstBase, fNbases, fMaxbases, fSeqWidth;
- DSeqPrintDoc * fDoc;
- DSeqList * fSeqList;
- DSequence * fSeq;
- DList * fDrawRowList, * fStyles;
- DFile * fFile;
- char * fCommonbase, * fFirstcommon;
-
- //DCheckBox* fLeftName, fRightName, fTopIndex, fLeftIndex, fRightIndex ;
- //DDlogTextView* fStyleName, fStyleBase, fStyleNums;
-
- DSeqPrintView( long id, DView* itsSuper, DSeqPrintDoc* itsDocument,
- DSeqList* itsSeqList, long firstbase, long nbases,
- long pixwidth, long pixheight);
- virtual ~DSeqPrintView();
- virtual void Initialize();
-
- virtual void MakeDrawList();
- virtual void Draw();
- virtual void DrawRow(Nlm_RecT r, short row);
- virtual void IndexFromRow( short row, long& itemrow, long& seqline, long& startitem, long& stopitem);
- virtual void GetReadyToShow();
- virtual void DrawSideIndex( Nlm_RecT& aRect, long atBase, long leftBorder);
- virtual void WriteSideIndex( long atBase, long leftBorder);
- virtual void DrawName( Nlm_RecT& aRect, short rightBorder, char* name);
- virtual void WriteName( short rightBorder, char* name);
- virtual short GetExtraRows() { return fExtrarows; }
-
- virtual void WriteTo(DFile* aFile);
- virtual void WriteRow(short row);
- };
-
-
-
- DSeqPrintView::DSeqPrintView( long id, DView* itsSuper, DSeqPrintDoc* itsDocument,
- DSeqList* itsSeqList, long firstbase, long nbases,
- long pixwidth, long pixheight):
- DTableView( id, itsSuper, pixwidth, pixheight, 0, 0,
- Nlm_stdCharWidth, Nlm_stdLineHeight, true, true),
- fDoc(itsDocument), fSeqList(itsSeqList), fSeq(NULL),
- fDrawRowList(NULL), fStyles(NULL),
- fCommonbase(NULL), fFirstcommon(NULL),
- fFirstBase(firstbase), fNbases(nbases), fMaxbases(nbases),
- fSeqLinesPerParag(kSeqLinesPerParag), fTopPerparag(2),
- fLinesPerParag(kSeqLinesPerParag+2), fSeqWidth(0),
- fBasesPerLine(DSeqPrintPrefs::gBasesPerLine), fExtrarows(0),
- fIndexWidth(kIndexWidth), fIndexWidthCnt(5),
- fNameWidth(kNameWidth), fNameWidthCnt(8)
-
- {
- this->SetSlateBorder( false);
- this->SetResize( DView::relsuper, DView::relsuper);
- this->SetTableFont(gTextFont);
- fBaseWidth= BaseCharWidth();
- fOneseq= fSeqList->GetSize()<2;
-
- fSeq= (DSequence*) fSeqList->At(0);
-
- Initialize();
- }
-
-
- DSeqPrintView::~DSeqPrintView()
- {
- fDrawRowList= FreeListIfObject(fDrawRowList);
- fStyles= FreeListIfObject(fStyles);
- MemFree( fCommonbase);
- MemFree( fFirstcommon);
- }
-
- void DSeqPrintView::Initialize()
- {
- fDoTopIndex= DSeqPrintPrefs::gIndexTop;
- fDoLeftIndex= DSeqPrintPrefs::gIndexLeft;
- fDoRightIndex= DSeqPrintPrefs::gIndexRight;
- fDoLeftName= DSeqPrintPrefs::gNameLeft;
- fDoRightName= DSeqPrintPrefs::gNameRight;
-
- fNameFont = DSeqPrintPrefs::gNameFont;
- fNumFont = DSeqPrintPrefs::gIndexFont;
- fBaseFont = DSeqPrintPrefs::gBaseFont;
- }
-
-
- void DSeqPrintView::MakeDrawList()
- {
- short i, n;
- fDrawRowList= FreeListIfObject(fDrawRowList);
- fDrawRowList= new DList(NULL, DList::kDeleteObjects);
- fDrawRowList->InsertLast( new DDrawSpacer());
- if (fDoTopIndex)
- fDrawRowList->InsertLast( new DDrawIndexRow(fNumFont,fBaseWidth));
-
- ulong * colors;
- //if (!fDoc->fUseColor) colors= NULL;
- if (!DSeqPrintPrefs::gColored) colors= NULL;
- else if (fSeq->Kind() == DSequence::kAmino) colors= DBaseColors::gAAcolors;
- else colors= DBaseColors::gNAcolors;
-
- fStyles= FreeListIfObject(fStyles);
- fStyles= new DList(NULL,DList::kDeleteObjects);
- n= DStyleTable::fStyles->GetSize();
- for (i=0; i<n; i++) {
- DSeqStyle * astyle= (DSeqStyle*) DStyleTable::fStyles->At(i);
- astyle= (DSeqStyle*) astyle->Clone();
- fStyles->InsertLast( astyle);
- }
-
- if (!fOneseq) {
- fCommonbase= fSeqList->FindCommonBases(DSeqList::gMinCommonPercent, fFirstcommon);
- for (i= 0; i < fSeqLinesPerParag; i++) {
- DDrawManySeqRow* dd= new DDrawManySeqRow( fBaseFont, this, fSeqList, i,
- fStyles, colors, fCommonbase, fFirstcommon);
- fDrawRowList->InsertLast(dd);
- }
- }
- else {
- for (i= 0; i < fSeqLinesPerParag; i++) {
- DDrawSeqRow* dd= new DDrawSeqRow( fBaseFont, this, fSeq, fStyles, fSeq->Name(), colors);
- fDrawRowList->InsertLast( dd);
- }
- }
- }
-
-
- void DSeqPrintView::GetReadyToShow()
- {
- char nums[50];
- long diff, nrows, nbases= 0;
-
- if (fOneseq) {
- fSeqsperparag = fSeqLinesPerParag;
- }
- else {
- fSeqLinesPerParag= fSeqList->GetSize(); //?? or leave to subclasses?
- fSeqsperparag = 1;
- }
- /* if (dospacer) */ fLinesPerParag = 1; fTopPerparag= 1;
- if (fDoTopIndex) { fLinesPerParag++; fTopPerparag++; }
- fLinesPerParag += fSeqLinesPerParag;
-
- #if 1
- if (fNbases) nbases= fNbases;
- else
- #endif
- if (fSeqList) {
- short i, nseq= fSeqList->GetSize();
- for (i=0; i<nseq; i++) {
- DSequence* aseq= fSeqList->SeqAt(i);
- nbases= Max(nbases, aseq->LengthF());
- }
- fNbases= nbases;
- }
- else if (fSeq) { nbases= fSeq->LengthF(); fNbases= nbases; }
- fMaxbases= nbases;
-
- // assume port is set??
- SelectFont();
- if (fNameFont) Nlm_SelectFont(fNameFont);
- fNameWidth= 5 + Nlm_StringWidth("Sequence");
- fNameWidthCnt= 8;
-
- if (fNumFont) Nlm_SelectFont(fNumFont);
- sprintf( nums, "%d", fMaxbases);
- fIndexWidthCnt= StrLen(nums);
- fIndexWidth= 5 + fIndexWidthCnt * Nlm_CharWidth('0');
-
- if (fBaseFont) Nlm_SelectFont(fBaseFont);
- fBaseWidth= BaseCharWidth();
-
- short ncols= fBasesPerLine + 4;
- if (ncols > GetMaxCols()) ChangeColSize( -1, ncols-GetMaxCols());
-
- MakeDrawList();
-
- SetItemWidth( 0, 1, (fDoLeftName)?fNameWidth:1);
- SetItemWidth( 1, 1, (fDoLeftIndex)?fIndexWidth:1);
- SetItemWidth( 2, fBasesPerLine, fBaseWidth);
- fSeqWidth= fBasesPerLine * fBaseWidth; //!?!?
- SetItemWidth( fBasesPerLine+2, 1, (fDoRightIndex)?fIndexWidth:1);
- SetItemWidth( fBasesPerLine+3, 1, (fDoRightName)?fNameWidth:1);
-
- nrows= 1 + (nbases / fBasesPerLine) / fSeqsperparag;
- nrows *= fLinesPerParag;
- nrows += GetExtraRows();
- diff = Max( 3, nrows) - GetMaxRows();
- ChangeRowSize( -1, diff); // -1 prevents redraw..else use fMaxRows
-
- Nlm_RecT r;
- ViewRect(r);
- nrows= GetMaxRows();
- for (long irow=0; irow<nrows; irow++) {
- long itemrow, seqline, startitem, stopitem;
- IndexFromRow( irow, itemrow, seqline, startitem, stopitem);
- DDrawMapRow* drawer= (DDrawMapRow*) fDrawRowList->At(itemrow);
- SetItemHeight( irow, 1,
- (drawer) ? drawer->GetHeight(r, irow, startitem, stopitem) : Nlm_stdLineHeight);
- }
-
- }
-
-
- void DSeqPrintView::DrawSideIndex( Nlm_RecT& aRect, long index, long leftBorder)
- {
- if (index != DDrawMapRow::kNoIndex) {
- char nums[128];
- Nlm_SelectFont(fNumFont);
- sprintf(nums, "%d", index); // or char* nump= ltoa(index);
- short atx= aRect.right - leftBorder - Nlm_StringWidth(nums);
- Nlm_MoveTo( atx, aRect.bottom - kFontDescent);
- Nlm_PaintString(nums);
- }
- }
-
- void DSeqPrintView::WriteSideIndex( long index, long leftBorder)
- {
- char fmt[30];
- if (index != DDrawMapRow::kNoIndex) {
- if (leftBorder > 0) sprintf( fmt, " %%%dd",fIndexWidthCnt);
- else sprintf( fmt, " %%-%dd",fIndexWidthCnt);
- fprintf( fFile->fFile, fmt, index);
- }
- else {
- sprintf( fmt, " %%%ds",fIndexWidthCnt);
- fprintf( fFile->fFile, fmt, "");
- }
- }
-
- void DSeqPrintView::DrawName( Nlm_RecT& aRect, short rightBorder, char* name)
- {
- if (name) {
- Nlm_SelectFont(fNameFont);
- short ht= 2 * Nlm_stdLineHeight;
- if (aRect.bottom - aRect.top > ht)
- Nlm_MoveTo( aRect.left + rightBorder, aRect.top + ht);
- else
- Nlm_MoveTo( aRect.left + rightBorder, aRect.bottom - kFontDescent);
- Nlm_PaintString( name);
- }
- }
-
- void DSeqPrintView::WriteName( short rightBorder, char* name)
- {
- char fmt[30];
- if (rightBorder > 0) sprintf( fmt, " %%-%ds",fNameWidthCnt);
- else sprintf( fmt, "%%%ds ",fNameWidthCnt);
- if (!name) name= "";
- fprintf( fFile->fFile, fmt, name);
- }
-
-
- void DSeqPrintView::IndexFromRow( short row, long& itemrow, long& seqline, long& startitem, long& stopitem)
- {
- itemrow = (row % fLinesPerParag);
- seqline = (row / fLinesPerParag) * fSeqsperparag;
- if (fOneseq) seqline += Max( 0, itemrow - fTopPerparag);
- #if 1
- startitem = fFirstBase + seqline * fBasesPerLine;
- stopitem = Min(startitem + fBasesPerLine, fFirstBase+fNbases);
- if (startitem>stopitem) { startitem= stopitem; }
- #else
- startitem = seqline * fBasesPerLine;
- stopitem = startitem + fBasesPerLine;
- #endif
- }
-
-
- void DSeqPrintView::Draw()
- {
- #if MASKS
- // !! toprowbases should be just CONSENSUS/Common bases, not rare ones
- #if 0
- short minCommonPerCent= 70;
- char * commons= FindCommonBases( minCommonPerCent);
- // ^^ OOPs, this is made new for each draw .. bad news
- DStyleTable::StartDraw( commons, StrLen(commons));
- #else
- //DSequence* aSeq= fSeqList->SeqAt(0);
- DStyleTable::StartDraw( fSeq->Bases(), fSeq->LengthF());
- #endif
- #endif
-
- DTableView::Draw();
-
- #if MASKS
- DStyleTable::EndDraw();
- #endif
- }
-
- void DSeqPrintView::DrawRow(Nlm_RecT r, short row)
- {
- long itemrow, seqline, startitem, stopitem;
- short col, ncols;
- Nlm_RecT r1, viewr;
- Nlm_RegioN cliprgn;
- DDrawMapRow * drawer;
-
- col = GetLeft();
- if (fWidths && col <= fMaxCols) r.right= r.left + fWidths[col];
- else r.right= r.left + fItemWidth;
- ViewRect( viewr);
-
- IndexFromRow( row, itemrow, seqline, startitem, stopitem);
- cliprgn= Nlm_CreateRgn();
- drawer= (DDrawMapRow*) fDrawRowList->At(itemrow);
-
- if (drawer) {
- drawer->fItemrow= itemrow - fTopPerparag;// so we know which seq line in array
- while (r.left < fRect.right && col < fMaxCols) {
- if (col < 2 || col > fBasesPerLine+1) {
- // do name & index borders
- ncols= 1;
- if (col == 0 && !fDoLeftName && drawer->DoLeftName()) // special case, fiddle w/ clip rgn...
- { r.right += fItemWidth; }
- (void) Nlm_SectRect( &r, &viewr, &r1);
- RectRgn( cliprgn, &r1);
- Nlm_SectRgn( cliprgn, Nlm_updateRgn, cliprgn);
- if ( !Nlm_EmptyRgn( cliprgn)) {
- Nlm_ClipRgn(cliprgn);
- r1= r;
- if (col == 0) {
- if (fDoLeftName || drawer->DoLeftName()) DrawName( r1, 0, drawer->GetName(row));
- }
- else if (col == 1) {
- if (fDoLeftIndex) DrawSideIndex( r1, drawer->GetIndex(startitem), kNucBorder);
- }
- else if (col == fBasesPerLine+2) {
- if (fDoRightIndex) DrawSideIndex( r1, drawer->GetIndex(stopitem), 0);
- }
- else if (col == fBasesPerLine+3) {
- if (fDoRightName) DrawName( r1, kNucBorder, drawer->GetName(row));
- }
- }
- }
-
- else if (col < fBasesPerLine+2) {
- r.right= r.left + fSeqWidth;
- ncols= fBasesPerLine; //stopitem - startitem;
- (void) Nlm_SectRect( &r, &viewr, &r1);
- RectRgn( cliprgn, &r1);
- Nlm_SectRgn( cliprgn, Nlm_updateRgn, cliprgn);
- if ( !Nlm_EmptyRgn( cliprgn)) {
- r1= r;
- //Nlm_ClipRgn(cliprgn);
- //drawer->fItemrow= itemrow - fTopPerparag;// so we know which seq line in array
- drawer->Clip( r1, row, startitem, stopitem, viewr, cliprgn);
- drawer->Draw( r1, row, col-2, startitem, stopitem);
- }
- }
-
- col += ncols;
- r.left= r.right;
- if (fWidths) r.right += fWidths[col];
- else r.right += fItemWidth;
- }
- }
- //Nlm_ClipRgn(Nlm_updateRgn);
- fColsDrawn= col - GetLeft();
- Nlm_ResetClip();
- Nlm_DestroyRgn(cliprgn);
- }
-
-
- void DSeqPrintView::WriteTo(DFile* aFile)
- {
- if (aFile) {
- long irow, nrows;
- fFile= aFile;
- fFile->Open("a");
- nrows= GetMaxRows();
- for (irow=0; irow<nrows; irow++) WriteRow( irow);
- fFile->Close();
- }
- }
-
- void DSeqPrintView::WriteRow(short row)
- {
- long itemrow, seqline, startitem, stopitem;
- short col, ncols;
- DDrawMapRow * drawer;
- char * newline, * atline;
-
- IndexFromRow( row, itemrow, seqline, startitem, stopitem);
- drawer= (DDrawMapRow*) fDrawRowList->At(itemrow);
- if (!drawer) return;
- drawer->fItemrow= itemrow - fTopPerparag;// so we know which seq line in array
-
- atline= (char*) drawer->Write( row, 0, startitem, stopitem);
- while (atline) {
- newline= StrChr(atline, '\n');
- if (newline) *newline++= 0; // risky: (const char*) drawer->Write()
-
- for (col=0, ncols=1; col<fMaxCols; col += ncols) {
- if (col < 2 || col > fBasesPerLine+1) {
- // do name & index borders
- ncols= 1;
- if (col == 0) {
- if (fDoLeftName || drawer->DoLeftName()) WriteName( 0, drawer->GetName(row));
- }
- else if (col == 1) {
- if (fDoLeftIndex) WriteSideIndex( drawer->GetIndex(startitem), kNucBorder);
- }
- else if (col == fBasesPerLine+2) {
- if (fDoRightIndex) WriteSideIndex( drawer->GetIndex(stopitem), 0);
- }
- else if (col == fBasesPerLine+3) {
- if (fDoRightName) WriteName( kNucBorder, drawer->GetName(row));
- }
- }
- else {
- ncols= fBasesPerLine;
- fFile->WriteLine( " ", false);
- fFile->WriteLine( atline, false);
- }
- }
-
- atline= newline;
- fFile->WriteLine("\n");
- }
- }
-
-
-
-
-
-
-
-
-
- // class DSeqPrintDoc
-
-
- Nlm_RecT DSeqPrintDoc::fgPrWinRect = { 0, 0, 0, 0 };
-
- DSeqPrintDoc::DSeqPrintDoc( long id, DSeqDoc* itsDoc, DSeqList* itsSeqList, long firstbase, long nbases) :
- DWindow( kSeqPrintDoc, gApplication),
- fView(NULL),
- fSeqList(itsSeqList),
- fFirstBase(firstbase), fNbases(nbases),
- //fHeadline(NULL), fFormatPop(NULL),
- //fLockButton(NULL), fColorButton(NULL), fMonoButton(NULL),
- fColorCheck(NULL), fLockCheck(NULL),
- fUseColor(itsDoc->fUseColor)
- {
- short width= -1, height= -1, left= -10, top= -20; // default window loc
- if (id != 0) fId= id;
-
- //gTextFont = Nlm_GetFont( "Courier", 10, false, false, false, "Fixed");
- //if (gTextFont == NULL) gTextFont= Nlm_programFont;
-
- if (!Nlm_EmptyRect(&fgPrWinRect)) {
- left= MAX(20,fgPrWinRect.left);
- top = MAX(40,fgPrWinRect.top);
- }
-
- char * winname= NULL;
- this->InitWindow( document, width, height, left, top); //, winname);
-
- DSequence * aSeq;
- char title[256];
- if (!fSeqList) {
- fSeqList= new DSeqList();
- fSeqList->AddNewSeq(); // install 1 blank seq for new doc
- aSeq= NULL;
- }
- else {
- aSeq= (DSequence*) fSeqList->At(0);
- }
- if (aSeq)
- StrCpy(title, aSeq->Name());
- else
- itsDoc->GetTitle( title, sizeof(title));
- StrCat( title, " Print");
- SetTitle( title);
- }
-
-
- DSeqPrintDoc::~DSeqPrintDoc()
- {
- if (fSeqList) {
- // we don't own DSeq objects in this list !!
- //fSeqList->FreeAllObjects();
- fSeqList->suicide();
- }
- }
-
-
- void DSeqPrintDoc::MakeGlobalsCurrent()
- {
- ViewRect( fViewrect); // get current rect...
- if (!Nlm_EmptyRect(&fViewrect)) fgPrWinRect= fViewrect;
- //fgUseColor= fColorCheck->GetStatus();
- }
-
- void DSeqPrintDoc::Close()
- {
- MakeGlobalsCurrent();
- DWindow::Close();
- }
-
- void DSeqPrintDoc::ResizeWin()
- {
- DWindow::ResizeWin();
- MakeGlobalsCurrent();
- }
-
-
- // static
- void DSeqPrintDoc::GetGlobals()
- {
-
- //char* onoffs= (fgUseColor) ? "1" : "0";
- //fgUseColor= gApplication->GetPrefVal( "fgUseColor", "windows", onoffs);
- {
- char* srect = gApplication->GetPref( "fgPrWinRect", "windows", "30 40 450 220");
- #if 1
- // sscanf is failing on Mac/codewar !! used to work
- if (srect) {
- char* cp= srect;
- while (*cp && isspace(*cp)) cp++;
- fgPrWinRect.left= atoi( cp);
-
- while (*cp && !isspace(*cp)) cp++;
- while (*cp && isspace(*cp)) cp++;
- fgPrWinRect.top= atoi( cp);
-
- while (*cp && !isspace(*cp)) cp++;
- while (*cp && isspace(*cp)) cp++;
- fgPrWinRect.right= atoi( cp);
-
- while (*cp && !isspace(*cp)) cp++;
- while (*cp && isspace(*cp)) cp++;
- fgPrWinRect.bottom= atoi( cp);
- }
- #else
- if (srect) sscanf( srect, "%d%d%d%d", &fgPrWinRect.left, &fgPrWinRect.top,
- &fgPrWinRect.right, &fgPrWinRect.bottom);
- #endif
- Nlm_MemFree(srect);
- }
- }
-
- // static
- void DSeqPrintDoc::SaveGlobals()
- {
- //gApplication->SetPref( (int) fgUseColor, "fgUseColor","windows");
- if (!Nlm_EmptyRect(&fgPrWinRect)) {
- char srect[128];
- sprintf( srect, "%d %d %d %d", fgPrWinRect.left, fgPrWinRect.top,
- fgPrWinRect.right, fgPrWinRect.bottom);
- gApplication->SetPref( srect, "fgPrWinRect", "windows");
- }
- }
-
-
- void DSeqPrintDoc::Open()
- {
- DView* super;
- short width, height;
- Nlm_PoinT nps;
-
- //if (!fSeqList) fSeqList= new DSeqList();
- if (!fView) {
- super= this;
-
- width= 450; height= 350;
- super->GetNextPosition( &nps);
- width = MAX( 40, fgPrWinRect.right - fgPrWinRect.left) - Nlm_vScrollBarWidth - nps.x;
- height= MAX( 60, fgPrWinRect.bottom - fgPrWinRect.top) - Nlm_hScrollBarHeight - nps.y;
- fView= new DSeqPrintView(0,super,this,fSeqList,fFirstBase,fNbases,width,height);
- }
-
- fSaveHandler= this;
- fPrintHandler= this;
-
- this->Select(); // for motif
- this->CalcWindowSize();
- fView->GetReadyToShow();
-
- DWindow::Open();
- }
-
-
-
-
- void DSeqPrintDoc::WriteTo(DFile* aFile)
- {
- // offer user choice of Text or PICT (or other? - PS) output
- // need popup choice in save-as dialog...
- if (gKeys->shift())
- fView->WriteTo( aFile); // TEXT
- else
- fView->WriteToPICT( aFile); // PICT
- }
-
-
- void DSeqPrintDoc::Print()
- {
- fView->Print();
- }
-
-
-
-
-
-
-
-
-
-
-
-
- // class DAlnPrintView
-
- class DAlnPrintView : public DSeqPrintView {
- public:
-
- DAlnPrintView( long id, DView* itsSuper, DSeqPrintDoc* itsDocument,
- DSeqList* itsSeqList, long firstbase, long nbases, long pixwidth, long pixheight);
- };
-
- DAlnPrintView::DAlnPrintView( long id, DView* itsSuper, DSeqPrintDoc* itsDocument,
- DSeqList* itsSeqList, long firstbase, long nbases, long pixwidth, long pixheight):
- DSeqPrintView( id, itsSuper, itsDocument, itsSeqList, firstbase, nbases, pixwidth, pixheight)
- {
- fSeqLinesPerParag= fSeqList->GetSize();
- }
-
- // class DAlnPrintDoc
-
- DAlnPrintDoc::DAlnPrintDoc( long id, DSeqDoc* itsDoc, DSeqList* itsSeqList, long firstbase, long nbases) :
- DSeqPrintDoc( id, itsDoc, itsSeqList, firstbase, nbases)
- {
-
- short width= 450, height= 350;
- //super->GetNextPosition( &nps);
- //width = MAX( 40, fgWinRect.right - fgWinRect.left) - Nlm_vScrollBarWidth - nps.x;
- //height= MAX( 60, fgWinRect.bottom - fgWinRect.top) - Nlm_hScrollBarHeight - nps.y;
- fView= new DAlnPrintView(0,this,this,fSeqList,fFirstBase,fNbases,width,height);
-
- char title[256];
- itsDoc->GetTitle( title, sizeof(title));
- StrCat( title, " Print");
- SetTitle( title);
- }
-
-
-
-
-
-
-
-
-
- // class DREMapPrintView
-
- class DREMapPrintView : public DSeqPrintView {
- public:
- Boolean fDoAAline[6];
- Boolean fDoSeqLine,fDoMidIndex,fDoCoseqLine,fDoZymeLine;
- short fMaxseqrow;
-
- DREMapPrintView( long id, DView* itsSuper, DSeqPrintDoc* itsDocument,
- DSeqList* itsSeqList, long firstbase, long nbases, long pixwidth, long pixheight);
- virtual void Initialize();
- virtual void MakeDrawList();
- virtual void SetScrollPage();
- virtual void IndexFromRow( short row, long& itemrow, long& seqline, long& startitem, long& stopitem);
- };
-
-
-
- DREMapPrintView::DREMapPrintView( long id, DView* itsSuper, DSeqPrintDoc* itsDocument,
- DSeqList* itsSeqList, long firstbase, long nbases, long pixwidth, long pixheight):
- DSeqPrintView( id, itsSuper, itsDocument, itsSeqList, firstbase,
- nbases, pixwidth, pixheight)
- {
- Initialize();
- }
-
- void DREMapPrintView::IndexFromRow( short row, long& itemrow, long& seqline, long& startitem, long& stopitem)
- {
- // !! modify itemrow to return drawer item row for tables after all of sequence as been drawn
- if (row > fMaxseqrow) {
- #if 1
- short i, n = fDrawRowList->GetSize();
- itemrow= fLinesPerParag;
- seqline= row - fMaxseqrow - 2; //??
- for (i= fLinesPerParag; i<n; i++) {
- DDrawMapRow* drawer= (DDrawMapRow*) fDrawRowList->At(i);
- if (drawer &&
- row >= drawer->fRowOffset && row < drawer->fRowOffset + drawer->fLinecount) {
- itemrow= i;
- seqline= row - drawer->fRowOffset; //??
- break;
- }
- }
- #else
- itemrow= fLinesPerParag; // need to adjust this for each spacer, etc...
- if (row > fMaxseqrow + 1) itemrow++;
- seqline= row - fMaxseqrow - 2; //??
- #endif
- startitem = seqline;
- stopitem = startitem+1; //??
- }
- else {
- itemrow = (row % fLinesPerParag);
- seqline = (row / fLinesPerParag) * fSeqsperparag;
- if (fOneseq) seqline += Max( 0, itemrow - fTopPerparag);
- #if 1
- startitem = fFirstBase + seqline * fBasesPerLine;
- stopitem = Min(startitem + fBasesPerLine, fFirstBase+fNbases);
- #else
- startitem = seqline * fBasesPerLine;
- stopitem = startitem + fBasesPerLine;
- #endif
- }
- }
-
- void DREMapPrintView::Initialize()
- {
- DSeqPrintView::Initialize();
-
- fSeqLinesPerParag= 1;
- fOneseq= false;
- fDoMidIndex= fDoTopIndex;
- fDoTopIndex= false;
- fDoSeqLine= true;
- fDoCoseqLine= DSeqPrintPrefs::gShowComplement;
- fDoZymeLine= true;
-
- fDoAAline[0]= DSeqPrintPrefs::gShowAA1;
- fDoAAline[1]= DSeqPrintPrefs::gShowAA2;
- fDoAAline[2]= DSeqPrintPrefs::gShowAA3;
- fDoAAline[3]= DSeqPrintPrefs::gShowCompAA1;
- fDoAAline[4]= DSeqPrintPrefs::gShowCompAA2;
- fDoAAline[5]= DSeqPrintPrefs::gShowCompAA3;
-
- }
-
- void DREMapPrintView::SetScrollPage()
- {
- fItemHeight= Nlm_stdLineHeight;
- DTableView::SetScrollPage();
- }
-
- void DREMapPrintView::MakeDrawList()
- {
- short i, n;
- ulong * colors = NULL;
- DDrawZymeRow * zymerow = NULL;
- DSequence* coseq = NULL;
- Boolean anyamino;
-
- fDrawRowList= FreeListIfObject(fDrawRowList);
- fDrawRowList= new DList(NULL, DList::kDeleteObjects);
- fDrawRowList->InsertLast(new DDrawSpacer());
- if (fDoTopIndex)
- fDrawRowList->InsertLast(new DDrawIndexRow(fNumFont,fBaseWidth));
-
- if (fDoZymeLine) {
- fSeq->SetSelection(fFirstBase, fNbases); // !? zyme map for only selected section
- zymerow= new DDrawZymeRow( fNameFont, fSeq);
- if (zymerow) {
- if (!zymerow->fGoodMap) { delete zymerow; zymerow= NULL; }
- else coseq= zymerow->fCoSeq;
- }
- }
- else if (fDoCoseqLine) {
- fSeq->SetSelection(0,0); // for Complement...
- coseq= fSeq->Complement();
- }
-
- anyamino= false;
- for (i=0; i<6; i++) if (fDoAAline[i]) anyamino= true;
-
- fStyles= FreeListIfObject(fStyles);
- fStyles= new DList(NULL,DList::kDeleteObjects);
- n= DStyleTable::fStyles->GetSize();
- for (i=0; i<n; i++) fStyles->InsertLast( DStyleTable::fStyles->At(i));
-
- #if 1
- /* if (dospacer) */ fLinesPerParag = 1; fTopPerparag= 1;
- if (fDoTopIndex) { fLinesPerParag++; fTopPerparag++; }
- if (fDoSeqLine)
- fDrawRowList->InsertLast(
- new DDrawSeqRow( fBaseFont, this, fSeq, fStyles, fSeq->Name(), colors));
- if (fDoSeqLine) { fLinesPerParag++; }
- if (fDoMidIndex)
- fDrawRowList->InsertLast(new DDrawIndexRow(fNumFont,fBaseWidth,false));
- if (fDoMidIndex) { fLinesPerParag++; }
- if (fDoCoseqLine && coseq)
- fDrawRowList->InsertLast(
- new DDrawSeqRow( fBaseFont, this, coseq, fStyles, "compl", colors));
- if (fDoCoseqLine && coseq) { fLinesPerParag++;}
- if (fDoZymeLine && zymerow)
- fDrawRowList->InsertLast( zymerow);
- if (fDoZymeLine && zymerow) { fLinesPerParag++; }
- if (anyamino)
- fDrawRowList->InsertLast(new DDrawSpacer()); fLinesPerParag++;
-
- for (i= 0; i<3; i++) if (fDoAAline[i])
- fDrawRowList->InsertLast( new DDrawAminoRow( fBaseFont, fSeq, i));
- for (i= 0; i<3; i++) if (fDoAAline[i]) { fLinesPerParag++; }
- if (fDoMidIndex)
- fDrawRowList->InsertLast(new DDrawIndexRow(fNumFont,fBaseWidth,false));
- if (fDoMidIndex) { fLinesPerParag++; }
- for (i= 3; i<6; i++) if (fDoAAline[i] && coseq)
- fDrawRowList->InsertLast( new DDrawAminoRow( fBaseFont, coseq, i));
- for (i= 3; i<6; i++) if (fDoAAline[i]) fLinesPerParag++;
-
- fDrawRowList->InsertLast(new DDrawSpacer()); fLinesPerParag++;
-
- #else
- for (i= 0; i<3; i++) if (fDoAAline[i])
- fDrawRowList->InsertLast( new DDrawAminoRow( fBaseFont, fSeq, i));
- if (fDoSeqLine)
- fDrawRowList->InsertLast(
- new DDrawSeqRow( fBaseFont, this, fSeq, fStyles, fSeq->Name(), colors));
- if (fDoMidIndex)
- fDrawRowList->InsertLast(new DDrawIndexRow(fNumFont,fBaseWidth,false));
- if (fDoMidIndex) { fLinesPerParag++; }
- if (fDoCoseqLine && coseq)
- fDrawRowList->InsertLast(
- new DDrawSeqRow( fBaseFont, this, coseq, fStyles, "compl", colors));
- for (i= 3; i<6; i++) if (fDoAAline[i] && coseq)
- fDrawRowList->InsertLast( new DDrawAminoRow( fBaseFont, coseq, i));
- if (fDoZymeLine && zymerow)
- fDrawRowList->InsertLast( zymerow);
- /* if (dospacer) */ fLinesPerParag = 1; fTopPerparag= 1;
- if (fDoTopIndex) { fLinesPerParag++; fTopPerparag++; }
- for (i= 0; i<3; i++) if (fDoAAline[i]) { fLinesPerParag++; fTopPerparag++; }
- if (fDoSeqLine) { fLinesPerParag++; }
- if (fDoCoseqLine && coseq) { fLinesPerParag++;}
- for (i= 3; i<6; i++) if (fDoAAline[i]) fLinesPerParag++;
- if (fDoZymeLine) { fLinesPerParag++; }
- #endif
-
- fMaxseqrow= 1 + (fMaxbases / fBasesPerLine);
- fMaxseqrow *= fLinesPerParag;
- if (zymerow && DSeqPrintPrefs::gShowCutpoints) {
- fDrawRowList->InsertLast(new DDrawSpacer()); fExtrarows++;
- DDrawZymeCutTable* ztab= new DDrawZymeCutTable( gTextFont/*fNumFont*/,
- zymerow->fREMap, fMaxseqrow+fExtrarows);
- fDrawRowList->InsertLast( ztab);
- fExtrarows += ztab->fLinecount + 1;
- }
- if (zymerow && DSeqPrintPrefs::gShowAllZymes) {
- fDrawRowList->InsertLast(new DDrawSpacer()); fExtrarows++;
- DDrawAllZymeTable* ztab= new DDrawAllZymeTable( gTextFont, zymerow->fREMap,
- fMaxseqrow+fExtrarows);
- fDrawRowList->InsertLast( ztab);
- fExtrarows += ztab->fLinecount + 1;
- }
- if (zymerow && DSeqPrintPrefs::gShowNoncutters) {
- fDrawRowList->InsertLast(new DDrawSpacer()); fExtrarows++;
- DDrawNocutZymeTable* ztab= new DDrawNocutZymeTable( gTextFont, zymerow->fREMap,
- fMaxseqrow+fExtrarows);
- fDrawRowList->InsertLast( ztab);
- fExtrarows += ztab->fLinecount + 1;
- }
- if (zymerow && DSeqPrintPrefs::gShowExcludedCutters) {
- fDrawRowList->InsertLast(new DDrawSpacer()); fExtrarows++;
- DDrawNocutZymeTable* ztab= new DDrawNocutZymeTable( gTextFont, zymerow->fREMap,
- fMaxseqrow+fExtrarows,
- DSeqPrintPrefs::gREMinCuts,
- DSeqPrintPrefs::gREMaxCuts);
- fDrawRowList->InsertLast( ztab);
- fExtrarows += ztab->fLinecount + 1;
- }
-
- }
-
-
-
- // class DREMapPrintDoc
-
- DREMapPrintDoc::DREMapPrintDoc( long id, DSeqDoc* itsDoc, DSeqList* itsSeqList, long firstbase, long nbases) :
- DSeqPrintDoc( id, itsDoc, itsSeqList, firstbase, nbases)
- {
- short width= 450, height= 350;
- //super->GetNextPosition( &nps);
- //width = MAX( 40, fgWinRect.right - fgWinRect.left) - Nlm_vScrollBarWidth - nps.x;
- //height= MAX( 60, fgWinRect.bottom - fgWinRect.top) - Nlm_hScrollBarHeight - nps.y;
- fView= new DREMapPrintView(0,this,this,fSeqList,fFirstBase,fNbases,width,height);
-
- char title[256];
- DSequence * aSeq= (DSequence*) fSeqList->At(0);
- if (aSeq)
- StrCpy(title, aSeq->Name());
- else
- itsDoc->GetTitle( title, sizeof(title));
- StrCat( title, " Restr. Map");
- SetTitle( title);
- }
-
-
-
-
-
-
-
-
-
-
-
-
- //class DSeqPrintPrefs : public DWindow
-
-
-
- DSeqPrintPrefs::DSeqPrintPrefs() :
- DWindow( 0, NULL, DWindow::fixed, -10, -10, -50, -20, "SeqPrint prefs", kDontFreeOnClose),
- fNameFontMenu(NULL), fBaseFontMenu(NULL), fIndexFontMenu(NULL),
- fNameStyleMenu(NULL), fBaseStyleMenu(NULL), fIndexStyleMenu(NULL),
- fNameSizeSw(NULL), fBaseSizeSw(NULL), fIndexSizeSw(NULL),
- fREMinCuts(NULL), fREMaxCuts(NULL), fBasePerLine(NULL),
- fNeedSave(false)
- {
- }
-
- DSeqPrintPrefs::~DSeqPrintPrefs()
- {
- }
-
-
- inline Nlm_FonT GetAFont( char* fname, short fsize, short fstyle)
- {
- if (StrICmp(fname,"System")==0) return Nlm_systemFont;
- else if (StrICmp(fname,"Program")==0) return Nlm_programFont;
- else return Nlm_GetFont( fname, fsize,
- fstyle & kBold, fstyle & kItalic, fstyle & kUnderline, NULL);
- }
-
- // static
- void DSeqPrintPrefs::InitGlobals()
- {
-
- gNameFontName= gApplication->GetPref( "gNameFontName", "fonts", gNameFontName);
- gNameFontSize= gApplication->GetPrefVal( "gNameFontSize", "fonts", "10");
- gNameStyle= gApplication->GetPrefVal( "gNameStyle", "fonts", "0");
- gNameFont= ::GetAFont(gNameFontName,gNameFontSize, gNameStyle);
-
- gBaseFontName= gApplication->GetPref( "gBaseFontName", "fonts", gBaseFontName);
- gBaseFontSize= gApplication->GetPrefVal( "gBaseFontSize", "fonts", "10");
- gBaseStyle= gApplication->GetPrefVal( "gBaseStyle", "fonts", "0");
- gBaseFont= ::GetAFont(gBaseFontName,gBaseFontSize, gBaseStyle);
-
- gIndexFontName= gApplication->GetPref( "gIndexFontName", "fonts", gIndexFontName);
- gIndexFontSize= gApplication->GetPrefVal( "gIndexFontSize", "fonts", "9");
- gIndexStyle= gApplication->GetPrefVal( "gIndexStyle", "fonts", "0");
- gIndexFont= ::GetAFont(gIndexFontName,gIndexFontSize, gIndexStyle);
-
- gNameLeft= gApplication->GetPrefVal( "gNameLeft", "seqprint","0");
- gNameRight= gApplication->GetPrefVal( "gNameRight", "seqprint","1");
- gIndexLeft= gApplication->GetPrefVal( "gIndexLeft", "seqprint","1");
- gIndexRight= gApplication->GetPrefVal( "gIndexRight", "seqprint","0");
- gIndexTop= gApplication->GetPrefVal( "gIndexTop", "seqprint","1");
- gColored= gApplication->GetPrefVal( "gColored", "seqprint","1");
- gBasesPerLine= gApplication->GetPrefVal( "gBasesPerLine", "seqprint","60");
-
- gShowComplement= gApplication->GetPrefVal( "gShowComplement", "seqprint","1");
- gThreeLetAA= gApplication->GetPrefVal( "gThreeLetAA", "seqprint","0");
- gOnlyORF= gApplication->GetPrefVal( "gOnlyORF", "seqprint","0");
- gShowAA1= gApplication->GetPrefVal( "gShowAA1", "seqprint","0");
- gShowAA2= gApplication->GetPrefVal( "gShowAA2", "seqprint","0");
- gShowAA3= gApplication->GetPrefVal( "gShowAA3", "seqprint","0");
- gShowCompAA1= gApplication->GetPrefVal( "gShowCompAA1", "seqprint","0");
- gShowCompAA2= gApplication->GetPrefVal( "gShowCompAA2", "seqprint","0");
- gShowCompAA3= gApplication->GetPrefVal( "gShowCompAA3", "seqprint","0");
-
- gShowAllZymes= gApplication->GetPrefVal( "gShowAllZymes", "remap","0");
- gShowCutpoints= gApplication->GetPrefVal( "gShowCutpoints", "remap","0");
- gShowNoncutters= gApplication->GetPrefVal( "gShowNoncutters", "remap","0");
- gShowExcludedCutters= gApplication->GetPrefVal( "gShowExcludedCutters", "remap","0");
-
- gREMinCuts= gApplication->GetPrefVal( "gREMinCuts", "remap","1");
- gREMaxCuts= gApplication->GetPrefVal( "gREMaxCuts", "remap","999");
-
- #if 0
- {
- char* srect = gApplication->GetPref( "gSeqPrintDocRect", "windows", "20 20 450 220");
- // sscanf is failing on Mac/codewar !? used to work
- if (srect) {
- char* cp= srect;
- while (*cp && isspace(*cp)) cp++;
- gSeqPrintDocRect.left= atoi( cp);
-
- while (*cp && !isspace(*cp)) cp++;
- while (*cp && isspace(*cp)) cp++;
- gSeqPrintDocRect.top= atoi( cp);
-
- while (*cp && !isspace(*cp)) cp++;
- while (*cp && isspace(*cp)) cp++;
- gSeqPrintDocRect.right= atoi( cp);
-
- while (*cp && !isspace(*cp)) cp++;
- while (*cp && isspace(*cp)) cp++;
- gSeqPrintDocRect.bottom= atoi( cp);
- }
- MemFree(srect);
- }
- #endif
-
- }
-
-
- //static
- void DSeqPrintPrefs::SaveGlobals()
- {
- gApplication->SetPref( gNameFontName, "gNameFontName", "fonts");
- gApplication->SetPref( gNameFontSize, "gNameFontSize", "fonts");
- gApplication->SetPref( gNameStyle, "gNameStyle", "fonts");
- gApplication->SetPref( gBaseFontName, "gBaseFontName", "fonts");
- gApplication->SetPref( gBaseFontSize, "gBaseFontSize", "fonts");
- gApplication->SetPref( gBaseStyle, "gBaseStyle", "fonts");
- gApplication->SetPref( gIndexFontName, "gIndexFontName", "fonts");
- gApplication->SetPref( gIndexFontSize, "gIndexFontSize", "fonts");
- gApplication->SetPref( gIndexStyle, "gIndexStyle", "fonts");
-
- gApplication->SetPref( gNameLeft, "gNameLeft", "seqprint");
- gApplication->SetPref( gNameRight, "gNameRight", "seqprint");
- gApplication->SetPref( gIndexLeft, "gIndexLeft", "seqprint");
- gApplication->SetPref( gIndexRight, "gIndexRight", "seqprint");
- gApplication->SetPref( gIndexTop, "gIndexTop", "seqprint");
- gApplication->SetPref( gColored, "gColored", "seqprint");
- gApplication->SetPref( gBasesPerLine, "gBasesPerLine", "seqprint");
-
- // restrict map
- gApplication->SetPref( gShowComplement, "gShowComplement", "seqprint");
- gApplication->SetPref( gThreeLetAA, "gThreeLetAA", "seqprint");
- gApplication->SetPref( gOnlyORF, "gOnlyORF", "seqprint");
-
- gApplication->SetPref( gShowAA1, "gShowAA1", "seqprint");
- gApplication->SetPref( gShowAA2, "gShowAA2", "seqprint");
- gApplication->SetPref( gShowAA3, "gShowAA3", "seqprint");
- gApplication->SetPref( gShowCompAA1, "gShowCompAA1", "seqprint");
- gApplication->SetPref( gShowCompAA2, "gShowCompAA2", "seqprint");
- gApplication->SetPref( gShowCompAA3, "gShowCompAA3", "seqprint");
-
- // rest. map tables
- gApplication->SetPref( gShowAllZymes, "gShowAllZymes", "remap");
- gApplication->SetPref( gShowCutpoints, "gShowCutpoints", "remap");
- gApplication->SetPref( gShowNoncutters, "gShowNoncutters", "remap");
- gApplication->SetPref( gShowExcludedCutters, "gShowExcludedCutters", "remap");
- gApplication->SetPref( gREMinCuts, "gREMinCuts", "remap");
- gApplication->SetPref( gREMaxCuts, "gREMaxCuts", "remap");
-
- }
-
-
-
-
- void DSeqPrintPrefs::NewFontCluster(char* title, DView* mainview,
- DPopupMenu*& mfont, DPopupMenu*& mstyle, DSwitchBox*& swsize,
- char* fontname, short fontstyle, short fontsize )
- {
- // Name style -- font, font size, font style
- DPopupMenu* popm;
- DSwitchBox* sw;
- DPrompt* pr;
- DView* super;
-
- super= mainview;
- super->NextSubviewBelowLeft();
-
- DCluster* maincluster= new DCluster( 0, super, 30, 10, true, NULL); //false, title);
- super= maincluster;
-
- popm= new DPopupMenu( 0, (Nlm_GrouP)super->GetNlmObject(), "Font ");
- mfont= popm;
- popm->AddFonts();
- popm->SetFontChoice( fontname);
- //super->NextSubviewToRight();
-
- popm= new DPopupMenu( 0, (Nlm_GrouP)super->GetNlmObject(), "Style ");
- mstyle= popm;
- popm->AddItem( kStylePlain, "Plain", true);
- popm->AddItem( kStyleItalic, "Italic", true);
- popm->AddItem( kStyleBold, "Bold", true);
- popm->AddItem( kStyleUnderline, "Underline", true);
- popm->SetItemStatus( kStylePlain, fontstyle==0);
- popm->SetItemStatus( kStyleItalic, fontstyle & kItalic);
- popm->SetItemStatus( kStyleBold, fontstyle & kBold);
- popm->SetItemStatus( kStyleUnderline, fontstyle & kUnderline);
- //super->NextSubviewToRight();
-
- DCluster* cluster= new DCluster(0, super, 30, 10, true, NULL);
- super= cluster;
-
- pr= new DPrompt( 0, super, "font size", 0, 0, Nlm_programFont);
- //super->NextSubviewToRight();
- super->NextSubviewBelowLeft();
- sw = new DSwitchBox(0, super, true, true);
- swsize= sw;
- sw->SetValues(fontsize,99);
- //super->NextSubviewBelowLeft();
-
- super= mainview;
- super->NextSubviewBelowLeft();
- }
-
-
- void DSeqPrintPrefs::Initialize()
- {
- DView* super;
- DPrompt* pr;
- DCheckBox* ck;
- DCluster* clu;
- char nums[128];
-
- super= this;
- clu= new DCluster( 0, super, 30, 10, false, "Bases");
- super= clu;
-
- NewFontCluster( "Base style", super, fBaseFontMenu, fBaseStyleMenu, fBaseSizeSw,
- gBaseFontName, gBaseStyle, gBaseFontSize);
-
- ck= new DCheckBox(cColored, super, "Color ");
- ck->SetStatus(gColored);
- super->NextSubviewToRight();
-
- sprintf( nums, "%d", gBasesPerLine);
- fBasePerLine= new DEditText( 0, super, nums, 4, Nlm_programFont);
- this->SetEditText( fBasePerLine);
- super->NextSubviewToRight();
- pr= new DPrompt( 0, super, "bases/line", 0, 0, Nlm_programFont);
-
- super = this;
- //super->NextSubviewToRight();
- //super->NextSubviewBelowLeft();
-
- clu= new DCluster( 0, super, 30, 10, false, "Indices");
- super= clu;
-
- NewFontCluster( "Index style", super, fIndexFontMenu, fIndexStyleMenu, fIndexSizeSw,
- gIndexFontName, gIndexStyle, gIndexFontSize);
-
- ck= new DCheckBox(cIndexLeft, super, "Left");
- ck->SetStatus(gIndexLeft);
- ck= new DCheckBox(cIndexRight, super, "Right");
- ck->SetStatus(gIndexRight);
- ck= new DCheckBox(cIndexTop, super, "Top");
- ck->SetStatus(gIndexTop);
-
- super = this;
- //super->NextSubviewToRight();
- //super->NextSubviewBelowLeft();
-
- clu= new DCluster( 0, super, 30, 10, false, "Names");
- super= clu;
-
- NewFontCluster( "Name style", super, fNameFontMenu, fNameStyleMenu, fNameSizeSw,
- gNameFontName, gNameStyle, gNameFontSize);
-
- ck= new DCheckBox(cNameLeft, super, "Left");
- ck->SetStatus(gNameLeft);
- ck= new DCheckBox(cNameRight, super, "Right");
- ck->SetStatus(gNameRight);
-
- super = this;
- //super->NextSubviewToRight();
- //super->NextSubviewBelowLeft();
-
- #if 1
-
- // turn this into 2nd dialog window...
-
- clu= new DCluster( 0, super, 30, 10, false, "Restriction Maps");
- super= clu;
-
- ck= new DCheckBox(cShowComplement, super, "Show Complement");
- ck->SetStatus(gShowComplement);
- super->NextSubviewBelowLeft();
-
- DCluster* pclu= new DCluster( 0, super, 30, 10, false, "Protein translate frame");
- super= pclu;
- pr= new DPrompt( 0, super, " sequence", 0, 0, Nlm_programFont);
- super->NextSubviewToRight();
- ck= new DCheckBox(cShowAA1, super, "1st");
- ck->SetStatus(gShowAA1);
- super->NextSubviewToRight();
- ck= new DCheckBox(cShowAA2, super, "2nd");
- ck->SetStatus(gShowAA2);
- super->NextSubviewToRight();
- ck= new DCheckBox(cShowAA3, super, "3rd");
- ck->SetStatus(gShowAA3);
- super->NextSubviewBelowLeft();
-
- pr= new DPrompt( 0, super, "complement", 0, 0, Nlm_programFont);
- super->NextSubviewToRight();
- ck= new DCheckBox(cShowCompAA1, super, "1st");
- ck->SetStatus(gShowCompAA1);
- super->NextSubviewToRight();
- ck= new DCheckBox(cShowCompAA2, super, "2nd");
- ck->SetStatus(gShowCompAA2);
- super->NextSubviewToRight();
- ck= new DCheckBox(cShowCompAA3, super, "3rd");
- ck->SetStatus(gShowCompAA3);
-
- super->NextSubviewBelowLeft();
- ck= new DCheckBox(cThreeLetAA, super, "3-letter code");
- ck->SetStatus(gThreeLetAA);
- super->NextSubviewToRight();
- ck= new DCheckBox(cOnlyORF, super, "ORFs only");
- ck->SetStatus(gOnlyORF);
- super= clu;
- super->NextSubviewBelowLeft();
-
- DCluster* rclu= new DCluster( 0, super, 30, 10, false, "Restriction enzymes");
- super= rclu;
-
- pr= new DPrompt( 0, super, "Min. cuts", 0, 0, Nlm_programFont);
- super->NextSubviewToRight();
- sprintf( nums, "%d", gREMinCuts);
- fREMinCuts= new DEditText( 0, super, nums, 4, Nlm_programFont);
- this->SetEditText( fREMinCuts);
- pr= new DPrompt( 0, super, "Max. cuts", 0, 0, Nlm_programFont);
- super->NextSubviewToRight();
- sprintf( nums, "%d", gREMaxCuts);
- fREMaxCuts= new DEditText( 0, super, nums, 4, Nlm_programFont);
- super->NextSubviewBelowLeft();
-
- pr= new DPrompt( 0, super, "Tables", 0, 0, Nlm_programFont);
- super->NextSubviewToRight();
- ck= new DCheckBox(cShowCutpoints, super, "Cutpoints");
- ck->SetStatus(gShowCutpoints);
- ck= new DCheckBox(cShowAllZymes, super, "All zymes");
- ck->SetStatus(gShowAllZymes);
- super->NextSubviewBelowLeft();
- ck= new DCheckBox(cShowNoncutters, super, "Noncutters");
- ck->SetStatus(gShowNoncutters);
- ck= new DCheckBox(cShowExcludedCutters, super, "Excluded cutters");
- ck->SetStatus(gShowExcludedCutters);
-
- super= clu;
-
- super= this;
- #endif
-
- this->AddOkayCancelButtons();
-
- }
-
-
- void DSeqPrintPrefs::OkayAction()
- {
- short aSize, aStyle;
- char name[256], *nums;
- DMenu * aFontMenu, * aStyleMenu;
- Nlm_FonT aFont;
-
- if (fREMinCuts) {
- nums= fREMinCuts->GetTitle(name, sizeof(name));
- gREMinCuts= atol(nums);
- }
- if (fREMaxCuts) {
- nums= fREMaxCuts->GetTitle(name, sizeof(name));
- gREMaxCuts= atol(nums);
- }
- if (fBasePerLine) {
- nums= fBasePerLine->GetTitle(name, sizeof(name));
- gBasesPerLine= atol(nums);
- }
-
- for (short imenu= 0; imenu<3; imenu++) {
-
- switch (imenu) {
- case 0:
- aFontMenu= fNameFontMenu;
- aStyleMenu= fNameStyleMenu;
- aSize= fNameSizeSw->GetValue();// aSize= gNameFontSize;
- break;
- case 1:
- aFontMenu= fBaseFontMenu;
- aStyleMenu= fBaseStyleMenu;
- aSize= fBaseSizeSw->GetValue();// aSize= gBaseFontSize;
- break;
- case 2:
- aFontMenu= fIndexFontMenu;
- aStyleMenu= fIndexStyleMenu;
- aSize= fIndexSizeSw->GetValue();// aSize= gIndexFontSize;
- break;
- }
-
- if (aFontMenu && aFontMenu->GetFontChoice(name, sizeof(name))) {
- aStyle= 0;
- #ifdef WIN_MAC
- if (!aStyleMenu->GetItemStatus(kStylePlain)) {
- if (aStyleMenu->GetItemStatus(kStyleItalic )) aStyle |= kItalic;
- if (aStyleMenu->GetItemStatus(kStyleBold )) aStyle |= kBold;
- if (aStyleMenu->GetItemStatus(kStyleUnderline)) aStyle |= kUnderline;
- }
- #else
- short item= Nlm_GetValue(((DPopupMenu*)aStyleMenu)->fPopup);
- switch (item) {
- case 1: aStyle= 0; break;
- case 2: aStyle |= kItalic; break;
- case 3: aStyle |= kBold; break;
- case 4: aStyle |= kUnderline; break;
- }
- #endif
- if (StringCmp(name,"System")==0) aFont= Nlm_systemFont;
- else if (StringCmp(name,"Program")==0) aFont= Nlm_programFont;
- else aFont= Nlm_GetFont( name, aSize, aStyle & kBold,
- aStyle & kItalic, aStyle & kUnderline, NULL);
-
- switch (imenu) {
- case 0:
- if (aSize != gNameFontSize || aStyle != gNameStyle || StringCmp(name,gNameFontName)!=0) {
- if (gNameFontName) MemFree(gNameFontName);
- gNameFontName= StrDup(name);
- gNameFont= aFont;
- gNameFontSize= aSize;
- gNameStyle= aStyle;
- fNeedSave= true;
- }
- break;
-
- case 1:
- if (aSize != gBaseFontSize || aStyle != gBaseStyle || StringCmp(name,gBaseFontName)!=0) {
- if (gBaseFontName) MemFree(gBaseFontName);
- gBaseFontName= StrDup(name);
- gBaseFont= aFont;
- gBaseFontSize= aSize;
- gBaseStyle= aStyle;
- fNeedSave= true;
- }
- break;
-
- case 2:
- if (aSize != gIndexFontSize || aStyle != gBaseStyle || StringCmp(name,gIndexFontName)!=0) {
- if (gIndexFontName) MemFree(gIndexFontName);
- gIndexFontName= StrDup(name);
- gIndexFont= aFont;
- gIndexFontSize= aSize;
- gIndexStyle= aStyle;
- fNeedSave= true;
- }
- break;
- }
-
- }
- }
-
- #if 0
- #if 1
- // CurrentWindow gets prefs dlog window, not one we want
- //DSeqPrintDoc* awin= (DSeqPrintDoc*) gWindowManager->CurrentWindow();
- DList* wins= gWindowManager->GetWindowList();
- if (wins) {
- short last1= wins->GetSize() - 2;
- if (last1>0) {
- DSeqPrintDoc* awin= (DSeqPrintDoc*) wins->At(last1);
- if (awin && awin->Id() == DSeqPrintDoc::kSeqPrintDoc) {
- awin->fView->Initialize();
- awin->fView->GetReadyToShow();
- awin->fView->Invalidate();
- }
- }
- }
- #else
- DList* wins= gWindowManager->GetWindowList();
- if (wins) {
- long i, nwin= wins->GetSize();
- for (i= nwin-1; i>=0; i--) {
- DSeqPrintDoc* awin= (DSeqPrintDoc*) wins->At(i);
- if (awin && awin->Id() == DSeqPrintDoc::kSeqPrintDoc) {
- awin->fView->Initialize();
- awin->fView->GetReadyToShow();
- awin->fView->Invalidate();
- break; // do only 1st we find ...
- }
- }
- }
- #endif
- #endif
-
- }
-
-
-
- Boolean DSeqPrintPrefs::IsMyAction(DTaskMaster* action)
- {
- DView* aview= (DView*) action;
-
- switch (action->Id()) {
-
- case cIndexLeft : gIndexLeft= aview->GetStatus(); break;
- case cIndexRight: gIndexRight= aview->GetStatus(); break;
- case cIndexTop : gIndexTop= aview->GetStatus(); break;
- case cNameLeft : gNameLeft= aview->GetStatus(); break;
- case cNameRight : gNameRight= aview->GetStatus(); break;
- case cColored : gColored= aview->GetStatus(); break;
-
- case cShowComplement: gShowComplement= aview->GetStatus(); break;
- case cThreeLetAA : gThreeLetAA= aview->GetStatus(); break;
- case cOnlyORF : gOnlyORF= aview->GetStatus(); break;
- case cShowAA1 : gShowAA1= aview->GetStatus(); break;
- case cShowAA2 : gShowAA2= aview->GetStatus(); break;
- case cShowAA3 : gShowAA3= aview->GetStatus(); break;
- case cShowCompAA1 : gShowCompAA1= aview->GetStatus(); break;
- case cShowCompAA2 : gShowCompAA2= aview->GetStatus(); break;
- case cShowCompAA3 : gShowCompAA3= aview->GetStatus(); break;
- case cShowCutpoints : gShowCutpoints= aview->GetStatus(); break;
- case cShowAllZymes : gShowAllZymes= aview->GetStatus(); break;
- case cShowNoncutters : gShowNoncutters= aview->GetStatus(); break;
- case cShowExcludedCutters : gShowExcludedCutters= aview->GetStatus(); break;
-
- default : return DWindow::IsMyAction(action);
- }
-
- fNeedSave= true;
- return true;
- }
-
-
- void DSeqPrintPrefs::Open()
- {
- DWindow::Open();
- }
-
- void DSeqPrintPrefs::Close()
- {
- if (fNeedSave) {
- DSeqPrintPrefs::SaveGlobals();
- fNeedSave= false;
- }
- DWindow::Close();
- }
-
-
-
- // global calling function
- void SeqPrintPrefs(short id)
- {
- switch (id) {
-
- case kSeqPrintPrefInit:
- DSeqPrintPrefs::InitGlobals();
- break;
-
- case kSeqPrintPrefDialog:
- if (!gSeqPrintPrefs) {
- gSeqPrintPrefs = new DSeqPrintPrefs();
- gSeqPrintPrefs->Initialize();
- }
- if (gSeqPrintPrefs && gSeqPrintPrefs->PoseModally()) ;
- break;
-
- case kAlnPrintPrefDialog:
- case kREMapPrefDialog:
- break;
- }
-
- }
-
-
-