home *** CD-ROM | disk | FTP | other *** search
Text File | 2003-11-06 | 98.5 KB | 2,524 lines |
- =head1 NAME
-
- perlretut - Perl regular expressions tutorial
-
- =head1 DESCRIPTION
-
- This page provides a basic tutorial on understanding, creating and
- using regular expressions in Perl. It serves as a complement to the
- reference page on regular expressions L<perlre>. Regular expressions
- are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
- operators and so this tutorial also overlaps with
- L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
-
- Perl is widely renowned for excellence in text processing, and regular
- expressions are one of the big factors behind this fame. Perl regular
- expressions display an efficiency and flexibility unknown in most
- other computer languages. Mastering even the basics of regular
- expressions will allow you to manipulate text with surprising ease.
-
- What is a regular expression? A regular expression is simply a string
- that describes a pattern. Patterns are in common use these days;
- examples are the patterns typed into a search engine to find web pages
- and the patterns used to list files in a directory, e.g., C<ls *.txt>
- or C<dir *.*>. In Perl, the patterns described by regular expressions
- are used to search strings, extract desired parts of strings, and to
- do search and replace operations.
-
- Regular expressions have the undeserved reputation of being abstract
- and difficult to understand. Regular expressions are constructed using
- simple concepts like conditionals and loops and are no more difficult
- to understand than the corresponding C<if> conditionals and C<while>
- loops in the Perl language itself. In fact, the main challenge in
- learning regular expressions is just getting used to the terse
- notation used to express these concepts.
-
- This tutorial flattens the learning curve by discussing regular
- expression concepts, along with their notation, one at a time and with
- many examples. The first part of the tutorial will progress from the
- simplest word searches to the basic regular expression concepts. If
- you master the first part, you will have all the tools needed to solve
- about 98% of your needs. The second part of the tutorial is for those
- comfortable with the basics and hungry for more power tools. It
- discusses the more advanced regular expression operators and
- introduces the latest cutting edge innovations in 5.6.0.
-
- A note: to save time, 'regular expression' is often abbreviated as
- regexp or regex. Regexp is a more natural abbreviation than regex, but
- is harder to pronounce. The Perl pod documentation is evenly split on
- regexp vs regex; in Perl, there is more than one way to abbreviate it.
- We'll use regexp in this tutorial.
-
- =head1 Part 1: The basics
-
- =head2 Simple word matching
-
- The simplest regexp is simply a word, or more generally, a string of
- characters. A regexp consisting of a word matches any string that
- contains that word:
-
- "Hello World" =~ /World/; # matches
-
- What is this perl statement all about? C<"Hello World"> is a simple
- double quoted string. C<World> is the regular expression and the
- C<//> enclosing C</World/> tells perl to search a string for a match.
- The operator C<=~> associates the string with the regexp match and
- produces a true value if the regexp matched, or false if the regexp
- did not match. In our case, C<World> matches the second word in
- C<"Hello World">, so the expression is true. Expressions like this
- are useful in conditionals:
-
- if ("Hello World" =~ /World/) {
- print "It matches\n";
- }
- else {
- print "It doesn't match\n";
- }
-
- There are useful variations on this theme. The sense of the match can
- be reversed by using C<!~> operator:
-
- if ("Hello World" !~ /World/) {
- print "It doesn't match\n";
- }
- else {
- print "It matches\n";
- }
-
- The literal string in the regexp can be replaced by a variable:
-
- $greeting = "World";
- if ("Hello World" =~ /$greeting/) {
- print "It matches\n";
- }
- else {
- print "It doesn't match\n";
- }
-
- If you're matching against the special default variable C<$_>, the
- C<$_ =~> part can be omitted:
-
- $_ = "Hello World";
- if (/World/) {
- print "It matches\n";
- }
- else {
- print "It doesn't match\n";
- }
-
- And finally, the C<//> default delimiters for a match can be changed
- to arbitrary delimiters by putting an C<'m'> out front:
-
- "Hello World" =~ m!World!; # matches, delimited by '!'
- "Hello World" =~ m{World}; # matches, note the matching '{}'
- "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
- # '/' becomes an ordinary char
-
- C</World/>, C<m!World!>, and C<m{World}> all represent the
- same thing. When, e.g., C<""> is used as a delimiter, the forward
- slash C<'/'> becomes an ordinary character and can be used in a regexp
- without trouble.
-
- Let's consider how different regexps would match C<"Hello World">:
-
- "Hello World" =~ /world/; # doesn't match
- "Hello World" =~ /o W/; # matches
- "Hello World" =~ /oW/; # doesn't match
- "Hello World" =~ /World /; # doesn't match
-
- The first regexp C<world> doesn't match because regexps are
- case-sensitive. The second regexp matches because the substring
- S<C<'o W'> > occurs in the string S<C<"Hello World"> >. The space
- character ' ' is treated like any other character in a regexp and is
- needed to match in this case. The lack of a space character is the
- reason the third regexp C<'oW'> doesn't match. The fourth regexp
- C<'World '> doesn't match because there is a space at the end of the
- regexp, but not at the end of the string. The lesson here is that
- regexps must match a part of the string I<exactly> in order for the
- statement to be true.
-
- If a regexp matches in more than one place in the string, perl will
- always match at the earliest possible point in the string:
-
- "Hello World" =~ /o/; # matches 'o' in 'Hello'
- "That hat is red" =~ /hat/; # matches 'hat' in 'That'
-
- With respect to character matching, there are a few more points you
- need to know about. First of all, not all characters can be used 'as
- is' in a match. Some characters, called B<metacharacters>, are reserved
- for use in regexp notation. The metacharacters are
-
- {}[]()^$.|*+?\
-
- The significance of each of these will be explained
- in the rest of the tutorial, but for now, it is important only to know
- that a metacharacter can be matched by putting a backslash before it:
-
- "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
- "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
- "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
- "The interval is [0,1)." =~ /\[0,1\)\./ # matches
- "/usr/bin/perl" =~ /\/usr\/bin\/perl/; # matches
-
- In the last regexp, the forward slash C<'/'> is also backslashed,
- because it is used to delimit the regexp. This can lead to LTS
- (leaning toothpick syndrome), however, and it is often more readable
- to change delimiters.
-
- "/usr/bin/perl" =~ m!/usr/bin/perl!; # easier to read
-
- The backslash character C<'\'> is a metacharacter itself and needs to
- be backslashed:
-
- 'C:\WIN32' =~ /C:\\WIN/; # matches
-
- In addition to the metacharacters, there are some ASCII characters
- which don't have printable character equivalents and are instead
- represented by B<escape sequences>. Common examples are C<\t> for a
- tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
- bell. If your string is better thought of as a sequence of arbitrary
- bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
- sequence, e.g., C<\x1B> may be a more natural representation for your
- bytes. Here are some examples of escapes:
-
- "1000\t2000" =~ m(0\t2) # matches
- "1000\n2000" =~ /0\n20/ # matches
- "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
- "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
-
- If you've been around Perl a while, all this talk of escape sequences
- may seem familiar. Similar escape sequences are used in double-quoted
- strings and in fact the regexps in Perl are mostly treated as
- double-quoted strings. This means that variables can be used in
- regexps as well. Just like double-quoted strings, the values of the
- variables in the regexp will be substituted in before the regexp is
- evaluated for matching purposes. So we have:
-
- $foo = 'house';
- 'housecat' =~ /$foo/; # matches
- 'cathouse' =~ /cat$foo/; # matches
- 'housecat' =~ /${foo}cat/; # matches
-
- So far, so good. With the knowledge above you can already perform
- searches with just about any literal string regexp you can dream up.
- Here is a I<very simple> emulation of the Unix grep program:
-
- % cat > simple_grep
- #!/usr/bin/perl
- $regexp = shift;
- while (<>) {
- print if /$regexp/;
- }
- ^D
-
- % chmod +x simple_grep
-
- % simple_grep abba /usr/dict/words
- Babbage
- cabbage
- cabbages
- sabbath
- Sabbathize
- Sabbathizes
- sabbatical
- scabbard
- scabbards
-
- This program is easy to understand. C<#!/usr/bin/perl> is the standard
- way to invoke a perl program from the shell.
- S<C<$regexp = shift;> > saves the first command line argument as the
- regexp to be used, leaving the rest of the command line arguments to
- be treated as files. S<C<< while (<>) >> > loops over all the lines in
- all the files. For each line, S<C<print if /$regexp/;> > prints the
- line if the regexp matches the line. In this line, both C<print> and
- C</$regexp/> use the default variable C<$_> implicitly.
-
- With all of the regexps above, if the regexp matched anywhere in the
- string, it was considered a match. Sometimes, however, we'd like to
- specify I<where> in the string the regexp should try to match. To do
- this, we would use the B<anchor> metacharacters C<^> and C<$>. The
- anchor C<^> means match at the beginning of the string and the anchor
- C<$> means match at the end of the string, or before a newline at the
- end of the string. Here is how they are used:
-
- "housekeeper" =~ /keeper/; # matches
- "housekeeper" =~ /^keeper/; # doesn't match
- "housekeeper" =~ /keeper$/; # matches
- "housekeeper\n" =~ /keeper$/; # matches
-
- The second regexp doesn't match because C<^> constrains C<keeper> to
- match only at the beginning of the string, but C<"housekeeper"> has
- keeper starting in the middle. The third regexp does match, since the
- C<$> constrains C<keeper> to match only at the end of the string.
-
- When both C<^> and C<$> are used at the same time, the regexp has to
- match both the beginning and the end of the string, i.e., the regexp
- matches the whole string. Consider
-
- "keeper" =~ /^keep$/; # doesn't match
- "keeper" =~ /^keeper$/; # matches
- "" =~ /^$/; # ^$ matches an empty string
-
- The first regexp doesn't match because the string has more to it than
- C<keep>. Since the second regexp is exactly the string, it
- matches. Using both C<^> and C<$> in a regexp forces the complete
- string to match, so it gives you complete control over which strings
- match and which don't. Suppose you are looking for a fellow named
- bert, off in a string by himself:
-
- "dogbert" =~ /bert/; # matches, but not what you want
-
- "dilbert" =~ /^bert/; # doesn't match, but ..
- "bertram" =~ /^bert/; # matches, so still not good enough
-
- "bertram" =~ /^bert$/; # doesn't match, good
- "dilbert" =~ /^bert$/; # doesn't match, good
- "bert" =~ /^bert$/; # matches, perfect
-
- Of course, in the case of a literal string, one could just as easily
- use the string equivalence S<C<$string eq 'bert'> > and it would be
- more efficient. The C<^...$> regexp really becomes useful when we
- add in the more powerful regexp tools below.
-
- =head2 Using character classes
-
- Although one can already do quite a lot with the literal string
- regexps above, we've only scratched the surface of regular expression
- technology. In this and subsequent sections we will introduce regexp
- concepts (and associated metacharacter notations) that will allow a
- regexp to not just represent a single character sequence, but a I<whole
- class> of them.
-
- One such concept is that of a B<character class>. A character class
- allows a set of possible characters, rather than just a single
- character, to match at a particular point in a regexp. Character
- classes are denoted by brackets C<[...]>, with the set of characters
- to be possibly matched inside. Here are some examples:
-
- /cat/; # matches 'cat'
- /[bcr]at/; # matches 'bat, 'cat', or 'rat'
- /item[0123456789]/; # matches 'item0' or ... or 'item9'
- "abc" =~ /[cab]/; # matches 'a'
-
- In the last statement, even though C<'c'> is the first character in
- the class, C<'a'> matches because the first character position in the
- string is the earliest point at which the regexp can match.
-
- /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
- # 'yes', 'Yes', 'YES', etc.
-
- This regexp displays a common task: perform a case-insensitive
- match. Perl provides away of avoiding all those brackets by simply
- appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
- can be rewritten as C</yes/i;>. The C<'i'> stands for
- case-insensitive and is an example of a B<modifier> of the matching
- operation. We will meet other modifiers later in the tutorial.
-
- We saw in the section above that there were ordinary characters, which
- represented themselves, and special characters, which needed a
- backslash C<\> to represent themselves. The same is true in a
- character class, but the sets of ordinary and special characters
- inside a character class are different than those outside a character
- class. The special characters for a character class are C<-]\^$>. C<]>
- is special because it denotes the end of a character class. C<$> is
- special because it denotes a scalar variable. C<\> is special because
- it is used in escape sequences, just like above. Here is how the
- special characters C<]$\> are handled:
-
- /[\]c]def/; # matches ']def' or 'cdef'
- $x = 'bcr';
- /[$x]at/; # matches 'bat', 'cat', or 'rat'
- /[\$x]at/; # matches '$at' or 'xat'
- /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
-
- The last two are a little tricky. in C<[\$x]>, the backslash protects
- the dollar sign, so the character class has two members C<$> and C<x>.
- In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
- variable and substituted in double quote fashion.
-
- The special character C<'-'> acts as a range operator within character
- classes, so that a contiguous set of characters can be written as a
- range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
- become the svelte C<[0-9]> and C<[a-z]>. Some examples are
-
- /item[0-9]/; # matches 'item0' or ... or 'item9'
- /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
- # 'baa', 'xaa', 'yaa', or 'zaa'
- /[0-9a-fA-F]/; # matches a hexadecimal digit
- /[0-9a-zA-Z_]/; # matches a "word" character,
- # like those in a perl variable name
-
- If C<'-'> is the first or last character in a character class, it is
- treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
- all equivalent.
-
- The special character C<^> in the first position of a character class
- denotes a B<negated character class>, which matches any character but
- those in the brackets. Both C<[...]> and C<[^...]> must match a
- character, or the match fails. Then
-
- /[^a]at/; # doesn't match 'aat' or 'at', but matches
- # all other 'bat', 'cat, '0at', '%at', etc.
- /[^0-9]/; # matches a non-numeric character
- /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
-
- Now, even C<[0-9]> can be a bother the write multiple times, so in the
- interest of saving keystrokes and making regexps more readable, Perl
- has several abbreviations for common character classes:
-
- =over 4
-
- =item *
-
- \d is a digit and represents [0-9]
-
- =item *
-
- \s is a whitespace character and represents [\ \t\r\n\f]
-
- =item *
-
- \w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_]
-
- =item *
-
- \D is a negated \d; it represents any character but a digit [^0-9]
-
- =item *
-
- \S is a negated \s; it represents any non-whitespace character [^\s]
-
- =item *
-
- \W is a negated \w; it represents any non-word character [^\w]
-
- =item *
-
- The period '.' matches any character but "\n"
-
- =back
-
- The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
- of character classes. Here are some in use:
-
- /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
- /[\d\s]/; # matches any digit or whitespace character
- /\w\W\w/; # matches a word char, followed by a
- # non-word char, followed by a word char
- /..rt/; # matches any two chars, followed by 'rt'
- /end\./; # matches 'end.'
- /end[.]/; # same thing, matches 'end.'
-
- Because a period is a metacharacter, it needs to be escaped to match
- as an ordinary period. Because, for example, C<\d> and C<\w> are sets
- of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
- fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
- C<[\W]>. Think DeMorgan's laws.
-
- An anchor useful in basic regexps is the S<B<word anchor> >
- C<\b>. This matches a boundary between a word character and a non-word
- character C<\w\W> or C<\W\w>:
-
- $x = "Housecat catenates house and cat";
- $x =~ /cat/; # matches cat in 'housecat'
- $x =~ /\bcat/; # matches cat in 'catenates'
- $x =~ /cat\b/; # matches cat in 'housecat'
- $x =~ /\bcat\b/; # matches 'cat' at end of string
-
- Note in the last example, the end of the string is considered a word
- boundary.
-
- You might wonder why C<'.'> matches everything but C<"\n"> - why not
- every character? The reason is that often one is matching against
- lines and would like to ignore the newline characters. For instance,
- while the string C<"\n"> represents one line, we would like to think
- of as empty. Then
-
- "" =~ /^$/; # matches
- "\n" =~ /^$/; # matches, "\n" is ignored
-
- "" =~ /./; # doesn't match; it needs a char
- "" =~ /^.$/; # doesn't match; it needs a char
- "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
- "a" =~ /^.$/; # matches
- "a\n" =~ /^.$/; # matches, ignores the "\n"
-
- This behavior is convenient, because we usually want to ignore
- newlines when we count and match characters in a line. Sometimes,
- however, we want to keep track of newlines. We might even want C<^>
- and C<$> to anchor at the beginning and end of lines within the
- string, rather than just the beginning and end of the string. Perl
- allows us to choose between ignoring and paying attention to newlines
- by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
- single line and multi-line and they determine whether a string is to
- be treated as one continuous string, or as a set of lines. The two
- modifiers affect two aspects of how the regexp is interpreted: 1) how
- the C<'.'> character class is defined, and 2) where the anchors C<^>
- and C<$> are able to match. Here are the four possible combinations:
-
- =over 4
-
- =item *
-
- no modifiers (//): Default behavior. C<'.'> matches any character
- except C<"\n">. C<^> matches only at the beginning of the string and
- C<$> matches only at the end or before a newline at the end.
-
- =item *
-
- s modifier (//s): Treat string as a single long line. C<'.'> matches
- any character, even C<"\n">. C<^> matches only at the beginning of
- the string and C<$> matches only at the end or before a newline at the
- end.
-
- =item *
-
- m modifier (//m): Treat string as a set of multiple lines. C<'.'>
- matches any character except C<"\n">. C<^> and C<$> are able to match
- at the start or end of I<any> line within the string.
-
- =item *
-
- both s and m modifiers (//sm): Treat string as a single long line, but
- detect multiple lines. C<'.'> matches any character, even
- C<"\n">. C<^> and C<$>, however, are able to match at the start or end
- of I<any> line within the string.
-
- =back
-
- Here are examples of C<//s> and C<//m> in action:
-
- $x = "There once was a girl\nWho programmed in Perl\n";
-
- $x =~ /^Who/; # doesn't match, "Who" not at start of string
- $x =~ /^Who/s; # doesn't match, "Who" not at start of string
- $x =~ /^Who/m; # matches, "Who" at start of second line
- $x =~ /^Who/sm; # matches, "Who" at start of second line
-
- $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
- $x =~ /girl.Who/s; # matches, "." matches "\n"
- $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
- $x =~ /girl.Who/sm; # matches, "." matches "\n"
-
- Most of the time, the default behavior is what is want, but C<//s> and
- C<//m> are occasionally very useful. If C<//m> is being used, the start
- of the string can still be matched with C<\A> and the end of string
- can still be matched with the anchors C<\Z> (matches both the end and
- the newline before, like C<$>), and C<\z> (matches only the end):
-
- $x =~ /^Who/m; # matches, "Who" at start of second line
- $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
-
- $x =~ /girl$/m; # matches, "girl" at end of first line
- $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
-
- $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
- $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
-
- We now know how to create choices among classes of characters in a
- regexp. What about choices among words or character strings? Such
- choices are described in the next section.
-
- =head2 Matching this or that
-
- Sometimes we would like to our regexp to be able to match different
- possible words or character strings. This is accomplished by using
- the B<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
- form the regexp C<dog|cat>. As before, perl will try to match the
- regexp at the earliest possible point in the string. At each
- character position, perl will first try to match the first
- alternative, C<dog>. If C<dog> doesn't match, perl will then try the
- next alternative, C<cat>. If C<cat> doesn't match either, then the
- match fails and perl moves to the next position in the string. Some
- examples:
-
- "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
- "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
-
- Even though C<dog> is the first alternative in the second regexp,
- C<cat> is able to match earlier in the string.
-
- "cats" =~ /c|ca|cat|cats/; # matches "c"
- "cats" =~ /cats|cat|ca|c/; # matches "cats"
-
- Here, all the alternatives match at the first string position, so the
- first alternative is the one that matches. If some of the
- alternatives are truncations of the others, put the longest ones first
- to give them a chance to match.
-
- "cab" =~ /a|b|c/ # matches "c"
- # /a|b|c/ == /[abc]/
-
- The last example points out that character classes are like
- alternations of characters. At a given character position, the first
- alternative that allows the regexp match to succeed will be the one
- that matches.
-
- =head2 Grouping things and hierarchical matching
-
- Alternation allows a regexp to choose among alternatives, but by
- itself it unsatisfying. The reason is that each alternative is a whole
- regexp, but sometime we want alternatives for just part of a
- regexp. For instance, suppose we want to search for housecats or
- housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
- inefficient because we had to type C<house> twice. It would be nice to
- have parts of the regexp be constant, like C<house>, and some
- parts have alternatives, like C<cat|keeper>.
-
- The B<grouping> metacharacters C<()> solve this problem. Grouping
- allows parts of a regexp to be treated as a single unit. Parts of a
- regexp are grouped by enclosing them in parentheses. Thus we could solve
- the C<housecat|housekeeper> by forming the regexp as
- C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
- C<house> followed by either C<cat> or C<keeper>. Some more examples
- are
-
- /(a|b)b/; # matches 'ab' or 'bb'
- /(ac|b)b/; # matches 'acb' or 'bb'
- /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
- /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
-
- /house(cat|)/; # matches either 'housecat' or 'house'
- /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
- # 'house'. Note groups can be nested.
-
- /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
- "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
- # because '20\d\d' can't match
-
- Alternations behave the same way in groups as out of them: at a given
- string position, the leftmost alternative that allows the regexp to
- match is taken. So in the last example at the first string position,
- C<"20"> matches the second alternative, but there is nothing left over
- to match the next two digits C<\d\d>. So perl moves on to the next
- alternative, which is the null alternative and that works, since
- C<"20"> is two digits.
-
- The process of trying one alternative, seeing if it matches, and
- moving on to the next alternative if it doesn't, is called
- B<backtracking>. The term 'backtracking' comes from the idea that
- matching a regexp is like a walk in the woods. Successfully matching
- a regexp is like arriving at a destination. There are many possible
- trailheads, one for each string position, and each one is tried in
- order, left to right. From each trailhead there may be many paths,
- some of which get you there, and some which are dead ends. When you
- walk along a trail and hit a dead end, you have to backtrack along the
- trail to an earlier point to try another trail. If you hit your
- destination, you stop immediately and forget about trying all the
- other trails. You are persistent, and only if you have tried all the
- trails from all the trailheads and not arrived at your destination, do
- you declare failure. To be concrete, here is a step-by-step analysis
- of what perl does when it tries to match the regexp
-
- "abcde" =~ /(abd|abc)(df|d|de)/;
-
- =over 4
-
- =item 0
-
- Start with the first letter in the string 'a'.
-
- =item 1
-
- Try the first alternative in the first group 'abd'.
-
- =item 2
-
- Match 'a' followed by 'b'. So far so good.
-
- =item 3
-
- 'd' in the regexp doesn't match 'c' in the string - a dead
- end. So backtrack two characters and pick the second alternative in
- the first group 'abc'.
-
- =item 4
-
- Match 'a' followed by 'b' followed by 'c'. We are on a roll
- and have satisfied the first group. Set $1 to 'abc'.
-
- =item 5
-
- Move on to the second group and pick the first alternative
- 'df'.
-
- =item 6
-
- Match the 'd'.
-
- =item 7
-
- 'f' in the regexp doesn't match 'e' in the string, so a dead
- end. Backtrack one character and pick the second alternative in the
- second group 'd'.
-
- =item 8
-
- 'd' matches. The second grouping is satisfied, so set $2 to
- 'd'.
-
- =item 9
-
- We are at the end of the regexp, so we are done! We have
- matched 'abcd' out of the string "abcde".
-
- =back
-
- There are a couple of things to note about this analysis. First, the
- third alternative in the second group 'de' also allows a match, but we
- stopped before we got to it - at a given character position, leftmost
- wins. Second, we were able to get a match at the first character
- position of the string 'a'. If there were no matches at the first
- position, perl would move to the second character position 'b' and
- attempt the match all over again. Only when all possible paths at all
- possible character positions have been exhausted does perl give
- up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
-
- Even with all this work, regexp matching happens remarkably fast. To
- speed things up, during compilation stage, perl compiles the regexp
- into a compact sequence of opcodes that can often fit inside a
- processor cache. When the code is executed, these opcodes can then run
- at full throttle and search very quickly.
-
- =head2 Extracting matches
-
- The grouping metacharacters C<()> also serve another completely
- different function: they allow the extraction of the parts of a string
- that matched. This is very useful to find out what matched and for
- text processing in general. For each grouping, the part that matched
- inside goes into the special variables C<$1>, C<$2>, etc. They can be
- used just as ordinary variables:
-
- # extract hours, minutes, seconds
- if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
- $hours = $1;
- $minutes = $2;
- $seconds = $3;
- }
-
- Now, we know that in scalar context,
- S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false
- value. In list context, however, it returns the list of matched values
- C<($1,$2,$3)>. So we could write the code more compactly as
-
- # extract hours, minutes, seconds
- ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
-
- If the groupings in a regexp are nested, C<$1> gets the group with the
- leftmost opening parenthesis, C<$2> the next opening parenthesis,
- etc. For example, here is a complex regexp and the matching variables
- indicated below it:
-
- /(ab(cd|ef)((gi)|j))/;
- 1 2 34
-
- so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'. For
- convenience, perl sets C<$+> to the string held by the highest numbered
- C<$1>, C<$2>, ... that got assigned (and, somewhat related, C<$^N> to the
- value of the C<$1>, C<$2>, ... most-recently assigned; i.e. the C<$1>,
- C<$2>, ... associated with the rightmost closing parenthesis used in the
- match).
-
- Closely associated with the matching variables C<$1>, C<$2>, ... are
- the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply
- matching variables that can be used I<inside> a regexp. This is a
- really nice feature - what matches later in a regexp can depend on
- what matched earlier in the regexp. Suppose we wanted to look
- for doubled words in text, like 'the the'. The following regexp finds
- all 3-letter doubles with a space in between:
-
- /(\w\w\w)\s\1/;
-
- The grouping assigns a value to \1, so that the same 3 letter sequence
- is used for both parts. Here are some words with repeated parts:
-
- % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
- beriberi
- booboo
- coco
- mama
- murmur
- papa
-
- The regexp has a single grouping which considers 4-letter
- combinations, then 3-letter combinations, etc. and uses C<\1> to look for
- a repeat. Although C<$1> and C<\1> represent the same thing, care should be
- taken to use matched variables C<$1>, C<$2>, ... only outside a regexp
- and backreferences C<\1>, C<\2>, ... only inside a regexp; not doing
- so may lead to surprising and/or undefined results.
-
- In addition to what was matched, Perl 5.6.0 also provides the
- positions of what was matched with the C<@-> and C<@+>
- arrays. C<$-[0]> is the position of the start of the entire match and
- C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
- position of the start of the C<$n> match and C<$+[n]> is the position
- of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
- this code
-
- $x = "Mmm...donut, thought Homer";
- $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
- foreach $expr (1..$#-) {
- print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
- }
-
- prints
-
- Match 1: 'Mmm' at position (0,3)
- Match 2: 'donut' at position (6,11)
-
- Even if there are no groupings in a regexp, it is still possible to
- find out what exactly matched in a string. If you use them, perl
- will set C<$`> to the part of the string before the match, will set C<$&>
- to the part of the string that matched, and will set C<$'> to the part
- of the string after the match. An example:
-
- $x = "the cat caught the mouse";
- $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
- $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
-
- In the second match, S<C<$` = ''> > because the regexp matched at the
- first character position in the string and stopped, it never saw the
- second 'the'. It is important to note that using C<$`> and C<$'>
- slows down regexp matching quite a bit, and C< $& > slows it down to a
- lesser extent, because if they are used in one regexp in a program,
- they are generated for <all> regexps in the program. So if raw
- performance is a goal of your application, they should be avoided.
- If you need them, use C<@-> and C<@+> instead:
-
- $` is the same as substr( $x, 0, $-[0] )
- $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
- $' is the same as substr( $x, $+[0] )
-
- =head2 Matching repetitions
-
- The examples in the previous section display an annoying weakness. We
- were only matching 3-letter words, or syllables of 4 letters or
- less. We'd like to be able to match words or syllables of any length,
- without writing out tedious alternatives like
- C<\w\w\w\w|\w\w\w|\w\w|\w>.
-
- This is exactly the problem the B<quantifier> metacharacters C<?>,
- C<*>, C<+>, and C<{}> were created for. They allow us to determine the
- number of repeats of a portion of a regexp we consider to be a
- match. Quantifiers are put immediately after the character, character
- class, or grouping that we want to specify. They have the following
- meanings:
-
- =over 4
-
- =item *
-
- C<a?> = match 'a' 1 or 0 times
-
- =item *
-
- C<a*> = match 'a' 0 or more times, i.e., any number of times
-
- =item *
-
- C<a+> = match 'a' 1 or more times, i.e., at least once
-
- =item *
-
- C<a{n,m}> = match at least C<n> times, but not more than C<m>
- times.
-
- =item *
-
- C<a{n,}> = match at least C<n> or more times
-
- =item *
-
- C<a{n}> = match exactly C<n> times
-
- =back
-
- Here are some examples:
-
- /[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
- # any number of digits
- /(\w+)\s+\1/; # match doubled words of arbitrary length
- /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
- $year =~ /\d{2,4}/; # make sure year is at least 2 but not more
- # than 4 digits
- $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
- $year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
- # this produces $1 and the other does not.
-
- % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
- beriberi
- booboo
- coco
- mama
- murmur
- papa
-
- For all of these quantifiers, perl will try to match as much of the
- string as possible, while still allowing the regexp to succeed. Thus
- with C</a?.../>, perl will first try to match the regexp with the C<a>
- present; if that fails, perl will try to match the regexp without the
- C<a> present. For the quantifier C<*>, we get the following:
-
- $x = "the cat in the hat";
- $x =~ /^(.*)(cat)(.*)$/; # matches,
- # $1 = 'the '
- # $2 = 'cat'
- # $3 = ' in the hat'
-
- Which is what we might expect, the match finds the only C<cat> in the
- string and locks onto it. Consider, however, this regexp:
-
- $x =~ /^(.*)(at)(.*)$/; # matches,
- # $1 = 'the cat in the h'
- # $2 = 'at'
- # $3 = '' (0 matches)
-
- One might initially guess that perl would find the C<at> in C<cat> and
- stop there, but that wouldn't give the longest possible string to the
- first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
- much of the string as possible while still having the regexp match. In
- this example, that means having the C<at> sequence with the final C<at>
- in the string. The other important principle illustrated here is that
- when there are two or more elements in a regexp, the I<leftmost>
- quantifier, if there is one, gets to grab as much the string as
- possible, leaving the rest of the regexp to fight over scraps. Thus in
- our example, the first quantifier C<.*> grabs most of the string, while
- the second quantifier C<.*> gets the empty string. Quantifiers that
- grab as much of the string as possible are called B<maximal match> or
- B<greedy> quantifiers.
-
- When a regexp can match a string in several different ways, we can use
- the principles above to predict which way the regexp will match:
-
- =over 4
-
- =item *
-
- Principle 0: Taken as a whole, any regexp will be matched at the
- earliest possible position in the string.
-
- =item *
-
- Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
- that allows a match for the whole regexp will be the one used.
-
- =item *
-
- Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
- C<{n,m}> will in general match as much of the string as possible while
- still allowing the whole regexp to match.
-
- =item *
-
- Principle 3: If there are two or more elements in a regexp, the
- leftmost greedy quantifier, if any, will match as much of the string
- as possible while still allowing the whole regexp to match. The next
- leftmost greedy quantifier, if any, will try to match as much of the
- string remaining available to it as possible, while still allowing the
- whole regexp to match. And so on, until all the regexp elements are
- satisfied.
-
- =back
-
- As we have seen above, Principle 0 overrides the others - the regexp
- will be matched as early as possible, with the other principles
- determining how the regexp matches at that earliest character
- position.
-
- Here is an example of these principles in action:
-
- $x = "The programming republic of Perl";
- $x =~ /^(.+)(e|r)(.*)$/; # matches,
- # $1 = 'The programming republic of Pe'
- # $2 = 'r'
- # $3 = 'l'
-
- This regexp matches at the earliest string position, C<'T'>. One
- might think that C<e>, being leftmost in the alternation, would be
- matched, but C<r> produces the longest string in the first quantifier.
-
- $x =~ /(m{1,2})(.*)$/; # matches,
- # $1 = 'mm'
- # $2 = 'ing republic of Perl'
-
- Here, The earliest possible match is at the first C<'m'> in
- C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
- a maximal C<mm>.
-
- $x =~ /.*(m{1,2})(.*)$/; # matches,
- # $1 = 'm'
- # $2 = 'ing republic of Perl'
-
- Here, the regexp matches at the start of the string. The first
- quantifier C<.*> grabs as much as possible, leaving just a single
- C<'m'> for the second quantifier C<m{1,2}>.
-
- $x =~ /(.?)(m{1,2})(.*)$/; # matches,
- # $1 = 'a'
- # $2 = 'mm'
- # $3 = 'ing republic of Perl'
-
- Here, C<.?> eats its maximal one character at the earliest possible
- position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
- the opportunity to match both C<m>'s. Finally,
-
- "aXXXb" =~ /(X*)/; # matches with $1 = ''
-
- because it can match zero copies of C<'X'> at the beginning of the
- string. If you definitely want to match at least one C<'X'>, use
- C<X+>, not C<X*>.
-
- Sometimes greed is not good. At times, we would like quantifiers to
- match a I<minimal> piece of string, rather than a maximal piece. For
- this purpose, Larry Wall created the S<B<minimal match> > or
- B<non-greedy> quantifiers C<??>,C<*?>, C<+?>, and C<{}?>. These are
- the usual quantifiers with a C<?> appended to them. They have the
- following meanings:
-
- =over 4
-
- =item *
-
- C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
-
- =item *
-
- C<a*?> = match 'a' 0 or more times, i.e., any number of times,
- but as few times as possible
-
- =item *
-
- C<a+?> = match 'a' 1 or more times, i.e., at least once, but
- as few times as possible
-
- =item *
-
- C<a{n,m}?> = match at least C<n> times, not more than C<m>
- times, as few times as possible
-
- =item *
-
- C<a{n,}?> = match at least C<n> times, but as few times as
- possible
-
- =item *
-
- C<a{n}?> = match exactly C<n> times. Because we match exactly
- C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
- notational consistency.
-
- =back
-
- Let's look at the example above, but with minimal quantifiers:
-
- $x = "The programming republic of Perl";
- $x =~ /^(.+?)(e|r)(.*)$/; # matches,
- # $1 = 'Th'
- # $2 = 'e'
- # $3 = ' programming republic of Perl'
-
- The minimal string that will allow both the start of the string C<^>
- and the alternation to match is C<Th>, with the alternation C<e|r>
- matching C<e>. The second quantifier C<.*> is free to gobble up the
- rest of the string.
-
- $x =~ /(m{1,2}?)(.*?)$/; # matches,
- # $1 = 'm'
- # $2 = 'ming republic of Perl'
-
- The first string position that this regexp can match is at the first
- C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
- matches just one C<'m'>. Although the second quantifier C<.*?> would
- prefer to match no characters, it is constrained by the end-of-string
- anchor C<$> to match the rest of the string.
-
- $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
- # $1 = 'The progra'
- # $2 = 'm'
- # $3 = 'ming republic of Perl'
-
- In this regexp, you might expect the first minimal quantifier C<.*?>
- to match the empty string, because it is not constrained by a C<^>
- anchor to match the beginning of the word. Principle 0 applies here,
- however. Because it is possible for the whole regexp to match at the
- start of the string, it I<will> match at the start of the string. Thus
- the first quantifier has to match everything up to the first C<m>. The
- second minimal quantifier matches just one C<m> and the third
- quantifier matches the rest of the string.
-
- $x =~ /(.??)(m{1,2})(.*)$/; # matches,
- # $1 = 'a'
- # $2 = 'mm'
- # $3 = 'ing republic of Perl'
-
- Just as in the previous regexp, the first quantifier C<.??> can match
- earliest at position C<'a'>, so it does. The second quantifier is
- greedy, so it matches C<mm>, and the third matches the rest of the
- string.
-
- We can modify principle 3 above to take into account non-greedy
- quantifiers:
-
- =over 4
-
- =item *
-
- Principle 3: If there are two or more elements in a regexp, the
- leftmost greedy (non-greedy) quantifier, if any, will match as much
- (little) of the string as possible while still allowing the whole
- regexp to match. The next leftmost greedy (non-greedy) quantifier, if
- any, will try to match as much (little) of the string remaining
- available to it as possible, while still allowing the whole regexp to
- match. And so on, until all the regexp elements are satisfied.
-
- =back
-
- Just like alternation, quantifiers are also susceptible to
- backtracking. Here is a step-by-step analysis of the example
-
- $x = "the cat in the hat";
- $x =~ /^(.*)(at)(.*)$/; # matches,
- # $1 = 'the cat in the h'
- # $2 = 'at'
- # $3 = '' (0 matches)
-
- =over 4
-
- =item 0
-
- Start with the first letter in the string 't'.
-
- =item 1
-
- The first quantifier '.*' starts out by matching the whole
- string 'the cat in the hat'.
-
- =item 2
-
- 'a' in the regexp element 'at' doesn't match the end of the
- string. Backtrack one character.
-
- =item 3
-
- 'a' in the regexp element 'at' still doesn't match the last
- letter of the string 't', so backtrack one more character.
-
- =item 4
-
- Now we can match the 'a' and the 't'.
-
- =item 5
-
- Move on to the third element '.*'. Since we are at the end of
- the string and '.*' can match 0 times, assign it the empty string.
-
- =item 6
-
- We are done!
-
- =back
-
- Most of the time, all this moving forward and backtracking happens
- quickly and searching is fast. There are some pathological regexps,
- however, whose execution time exponentially grows with the size of the
- string. A typical structure that blows up in your face is of the form
-
- /(a|b+)*/;
-
- The problem is the nested indeterminate quantifiers. There are many
- different ways of partitioning a string of length n between the C<+>
- and C<*>: one repetition with C<b+> of length n, two repetitions with
- the first C<b+> length k and the second with length n-k, m repetitions
- whose bits add up to length n, etc. In fact there are an exponential
- number of ways to partition a string as a function of length. A
- regexp may get lucky and match early in the process, but if there is
- no match, perl will try I<every> possibility before giving up. So be
- careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
- I<Mastering regular expressions> by Jeffrey Friedl gives a wonderful
- discussion of this and other efficiency issues.
-
- =head2 Building a regexp
-
- At this point, we have all the basic regexp concepts covered, so let's
- give a more involved example of a regular expression. We will build a
- regexp that matches numbers.
-
- The first task in building a regexp is to decide what we want to match
- and what we want to exclude. In our case, we want to match both
- integers and floating point numbers and we want to reject any string
- that isn't a number.
-
- The next task is to break the problem down into smaller problems that
- are easily converted into a regexp.
-
- The simplest case is integers. These consist of a sequence of digits,
- with an optional sign in front. The digits we can represent with
- C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
- regexp is
-
- /[+-]?\d+/; # matches integers
-
- A floating point number potentially has a sign, an integral part, a
- decimal point, a fractional part, and an exponent. One or more of these
- parts is optional, so we need to check out the different
- possibilities. Floating point numbers which are in proper form include
- 123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
- front is completely optional and can be matched by C<[+-]?>. We can
- see that if there is no exponent, floating point numbers must have a
- decimal point, otherwise they are integers. We might be tempted to
- model these with C<\d*\.\d*>, but this would also match just a single
- decimal point, which is not a number. So the three cases of floating
- point number sans exponent are
-
- /[+-]?\d+\./; # 1., 321., etc.
- /[+-]?\.\d+/; # .1, .234, etc.
- /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
-
- These can be combined into a single regexp with a three-way alternation:
-
- /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
-
- In this alternation, it is important to put C<'\d+\.\d+'> before
- C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
- and ignore the fractional part of the number.
-
- Now consider floating point numbers with exponents. The key
- observation here is that I<both> integers and numbers with decimal
- points are allowed in front of an exponent. Then exponents, like the
- overall sign, are independent of whether we are matching numbers with
- or without decimal points, and can be 'decoupled' from the
- mantissa. The overall form of the regexp now becomes clear:
-
- /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
-
- The exponent is an C<e> or C<E>, followed by an integer. So the
- exponent regexp is
-
- /[eE][+-]?\d+/; # exponent
-
- Putting all the parts together, we get a regexp that matches numbers:
-
- /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
-
- Long regexps like this may impress your friends, but can be hard to
- decipher. In complex situations like this, the C<//x> modifier for a
- match is invaluable. It allows one to put nearly arbitrary whitespace
- and comments into a regexp without affecting their meaning. Using it,
- we can rewrite our 'extended' regexp in the more pleasing form
-
- /^
- [+-]? # first, match an optional sign
- ( # then match integers or f.p. mantissas:
- \d+\.\d+ # mantissa of the form a.b
- |\d+\. # mantissa of the form a.
- |\.\d+ # mantissa of the form .b
- |\d+ # integer of the form a
- )
- ([eE][+-]?\d+)? # finally, optionally match an exponent
- $/x;
-
- If whitespace is mostly irrelevant, how does one include space
- characters in an extended regexp? The answer is to backslash it
- S<C<'\ '> > or put it in a character class S<C<[ ]> >. The same thing
- goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
- a space between the sign and the mantissa/integer, and we could add
- this to our regexp as follows:
-
- /^
- [+-]?\ * # first, match an optional sign *and space*
- ( # then match integers or f.p. mantissas:
- \d+\.\d+ # mantissa of the form a.b
- |\d+\. # mantissa of the form a.
- |\.\d+ # mantissa of the form .b
- |\d+ # integer of the form a
- )
- ([eE][+-]?\d+)? # finally, optionally match an exponent
- $/x;
-
- In this form, it is easier to see a way to simplify the
- alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
- could be factored out:
-
- /^
- [+-]?\ * # first, match an optional sign
- ( # then match integers or f.p. mantissas:
- \d+ # start out with a ...
- (
- \.\d* # mantissa of the form a.b or a.
- )? # ? takes care of integers of the form a
- |\.\d+ # mantissa of the form .b
- )
- ([eE][+-]?\d+)? # finally, optionally match an exponent
- $/x;
-
- or written in the compact form,
-
- /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
-
- This is our final regexp. To recap, we built a regexp by
-
- =over 4
-
- =item *
-
- specifying the task in detail,
-
- =item *
-
- breaking down the problem into smaller parts,
-
- =item *
-
- translating the small parts into regexps,
-
- =item *
-
- combining the regexps,
-
- =item *
-
- and optimizing the final combined regexp.
-
- =back
-
- These are also the typical steps involved in writing a computer
- program. This makes perfect sense, because regular expressions are
- essentially programs written a little computer language that specifies
- patterns.
-
- =head2 Using regular expressions in Perl
-
- The last topic of Part 1 briefly covers how regexps are used in Perl
- programs. Where do they fit into Perl syntax?
-
- We have already introduced the matching operator in its default
- C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
- the binding operator C<=~> and its negation C<!~> to test for string
- matches. Associated with the matching operator, we have discussed the
- single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
- extended C<//x> modifiers.
-
- There are a few more things you might want to know about matching
- operators. First, we pointed out earlier that variables in regexps are
- substituted before the regexp is evaluated:
-
- $pattern = 'Seuss';
- while (<>) {
- print if /$pattern/;
- }
-
- This will print any lines containing the word C<Seuss>. It is not as
- efficient as it could be, however, because perl has to re-evaluate
- C<$pattern> each time through the loop. If C<$pattern> won't be
- changing over the lifetime of the script, we can add the C<//o>
- modifier, which directs perl to only perform variable substitutions
- once:
-
- #!/usr/bin/perl
- # Improved simple_grep
- $regexp = shift;
- while (<>) {
- print if /$regexp/o; # a good deal faster
- }
-
- If you change C<$pattern> after the first substitution happens, perl
- will ignore it. If you don't want any substitutions at all, use the
- special delimiter C<m''>:
-
- $pattern = 'Seuss';
- while (<>) {
- print if m'$pattern'; # matches '$pattern', not 'Seuss'
- }
-
- C<m''> acts like single quotes on a regexp; all other C<m> delimiters
- act like double quotes. If the regexp evaluates to the empty string,
- the regexp in the I<last successful match> is used instead. So we have
-
- "dog" =~ /d/; # 'd' matches
- "dogbert =~ //; # this matches the 'd' regexp used before
-
- The final two modifiers C<//g> and C<//c> concern multiple matches.
- The modifier C<//g> stands for global matching and allows the
- matching operator to match within a string as many times as possible.
- In scalar context, successive invocations against a string will have
- `C<//g> jump from match to match, keeping track of position in the
- string as it goes along. You can get or set the position with the
- C<pos()> function.
-
- The use of C<//g> is shown in the following example. Suppose we have
- a string that consists of words separated by spaces. If we know how
- many words there are in advance, we could extract the words using
- groupings:
-
- $x = "cat dog house"; # 3 words
- $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
- # $1 = 'cat'
- # $2 = 'dog'
- # $3 = 'house'
-
- But what if we had an indeterminate number of words? This is the sort
- of task C<//g> was made for. To extract all words, form the simple
- regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
-
- while ($x =~ /(\w+)/g) {
- print "Word is $1, ends at position ", pos $x, "\n";
- }
-
- prints
-
- Word is cat, ends at position 3
- Word is dog, ends at position 7
- Word is house, ends at position 13
-
- A failed match or changing the target string resets the position. If
- you don't want the position reset after failure to match, add the
- C<//c>, as in C</regexp/gc>. The current position in the string is
- associated with the string, not the regexp. This means that different
- strings have different positions and their respective positions can be
- set or read independently.
-
- In list context, C<//g> returns a list of matched groupings, or if
- there are no groupings, a list of matches to the whole regexp. So if
- we wanted just the words, we could use
-
- @words = ($x =~ /(\w+)/g); # matches,
- # $word[0] = 'cat'
- # $word[1] = 'dog'
- # $word[2] = 'house'
-
- Closely associated with the C<//g> modifier is the C<\G> anchor. The
- C<\G> anchor matches at the point where the previous C<//g> match left
- off. C<\G> allows us to easily do context-sensitive matching:
-
- $metric = 1; # use metric units
- ...
- $x = <FILE>; # read in measurement
- $x =~ /^([+-]?\d+)\s*/g; # get magnitude
- $weight = $1;
- if ($metric) { # error checking
- print "Units error!" unless $x =~ /\Gkg\./g;
- }
- else {
- print "Units error!" unless $x =~ /\Glbs\./g;
- }
- $x =~ /\G\s+(widget|sprocket)/g; # continue processing
-
- The combination of C<//g> and C<\G> allows us to process the string a
- bit at a time and use arbitrary Perl logic to decide what to do next.
- Currently, the C<\G> anchor is only fully supported when used to anchor
- to the start of the pattern.
-
- C<\G> is also invaluable in processing fixed length records with
- regexps. Suppose we have a snippet of coding region DNA, encoded as
- base pair letters C<ATCGTTGAAT...> and we want to find all the stop
- codons C<TGA>. In a coding region, codons are 3-letter sequences, so
- we can think of the DNA snippet as a sequence of 3-letter records. The
- naive regexp
-
- # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
- $dna = "ATCGTTGAATGCAAATGACATGAC";
- $dna =~ /TGA/;
-
- doesn't work; it may match a C<TGA>, but there is no guarantee that
- the match is aligned with codon boundaries, e.g., the substring
- S<C<GTT GAA> > gives a match. A better solution is
-
- while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
- print "Got a TGA stop codon at position ", pos $dna, "\n";
- }
-
- which prints
-
- Got a TGA stop codon at position 18
- Got a TGA stop codon at position 23
-
- Position 18 is good, but position 23 is bogus. What happened?
-
- The answer is that our regexp works well until we get past the last
- real match. Then the regexp will fail to match a synchronized C<TGA>
- and start stepping ahead one character position at a time, not what we
- want. The solution is to use C<\G> to anchor the match to the codon
- alignment:
-
- while ($dna =~ /\G(\w\w\w)*?TGA/g) {
- print "Got a TGA stop codon at position ", pos $dna, "\n";
- }
-
- This prints
-
- Got a TGA stop codon at position 18
-
- which is the correct answer. This example illustrates that it is
- important not only to match what is desired, but to reject what is not
- desired.
-
- B<search and replace>
-
- Regular expressions also play a big role in B<search and replace>
- operations in Perl. Search and replace is accomplished with the
- C<s///> operator. The general form is
- C<s/regexp/replacement/modifiers>, with everything we know about
- regexps and modifiers applying in this case as well. The
- C<replacement> is a Perl double quoted string that replaces in the
- string whatever is matched with the C<regexp>. The operator C<=~> is
- also used here to associate a string with C<s///>. If matching
- against C<$_>, the S<C<$_ =~> > can be dropped. If there is a match,
- C<s///> returns the number of substitutions made, otherwise it returns
- false. Here are a few examples:
-
- $x = "Time to feed the cat!";
- $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
- if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
- $more_insistent = 1;
- }
- $y = "'quoted words'";
- $y =~ s/^'(.*)'$/$1/; # strip single quotes,
- # $y contains "quoted words"
-
- In the last example, the whole string was matched, but only the part
- inside the single quotes was grouped. With the C<s///> operator, the
- matched variables C<$1>, C<$2>, etc. are immediately available for use
- in the replacement expression, so we use C<$1> to replace the quoted
- string with just what was quoted. With the global modifier, C<s///g>
- will search and replace all occurrences of the regexp in the string:
-
- $x = "I batted 4 for 4";
- $x =~ s/4/four/; # doesn't do it all:
- # $x contains "I batted four for 4"
- $x = "I batted 4 for 4";
- $x =~ s/4/four/g; # does it all:
- # $x contains "I batted four for four"
-
- If you prefer 'regex' over 'regexp' in this tutorial, you could use
- the following program to replace it:
-
- % cat > simple_replace
- #!/usr/bin/perl
- $regexp = shift;
- $replacement = shift;
- while (<>) {
- s/$regexp/$replacement/go;
- print;
- }
- ^D
-
- % simple_replace regexp regex perlretut.pod
-
- In C<simple_replace> we used the C<s///g> modifier to replace all
- occurrences of the regexp on each line and the C<s///o> modifier to
- compile the regexp only once. As with C<simple_grep>, both the
- C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
-
- A modifier available specifically to search and replace is the
- C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
- the replacement string and the evaluated result is substituted for the
- matched substring. C<s///e> is useful if you need to do a bit of
- computation in the process of replacing text. This example counts
- character frequencies in a line:
-
- $x = "Bill the cat";
- $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
- print "frequency of '$_' is $chars{$_}\n"
- foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
-
- This prints
-
- frequency of ' ' is 2
- frequency of 't' is 2
- frequency of 'l' is 2
- frequency of 'B' is 1
- frequency of 'c' is 1
- frequency of 'e' is 1
- frequency of 'h' is 1
- frequency of 'i' is 1
- frequency of 'a' is 1
-
- As with the match C<m//> operator, C<s///> can use other delimiters,
- such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
- used C<s'''>, then the regexp and replacement are treated as single
- quoted strings and there are no substitutions. C<s///> in list context
- returns the same thing as in scalar context, i.e., the number of
- matches.
-
- B<The split operator>
-
- The B<C<split> > function can also optionally use a matching operator
- C<m//> to split a string. C<split /regexp/, string, limit> splits
- C<string> into a list of substrings and returns that list. The regexp
- is used to match the character sequence that the C<string> is split
- with respect to. The C<limit>, if present, constrains splitting into
- no more than C<limit> number of strings. For example, to split a
- string into words, use
-
- $x = "Calvin and Hobbes";
- @words = split /\s+/, $x; # $word[0] = 'Calvin'
- # $word[1] = 'and'
- # $word[2] = 'Hobbes'
-
- If the empty regexp C<//> is used, the regexp always matches and
- the string is split into individual characters. If the regexp has
- groupings, then list produced contains the matched substrings from the
- groupings as well. For instance,
-
- $x = "/usr/bin/perl";
- @dirs = split m!/!, $x; # $dirs[0] = ''
- # $dirs[1] = 'usr'
- # $dirs[2] = 'bin'
- # $dirs[3] = 'perl'
- @parts = split m!(/)!, $x; # $parts[0] = ''
- # $parts[1] = '/'
- # $parts[2] = 'usr'
- # $parts[3] = '/'
- # $parts[4] = 'bin'
- # $parts[5] = '/'
- # $parts[6] = 'perl'
-
- Since the first character of $x matched the regexp, C<split> prepended
- an empty initial element to the list.
-
- If you have read this far, congratulations! You now have all the basic
- tools needed to use regular expressions to solve a wide range of text
- processing problems. If this is your first time through the tutorial,
- why not stop here and play around with regexps a while... S<Part 2>
- concerns the more esoteric aspects of regular expressions and those
- concepts certainly aren't needed right at the start.
-
- =head1 Part 2: Power tools
-
- OK, you know the basics of regexps and you want to know more. If
- matching regular expressions is analogous to a walk in the woods, then
- the tools discussed in Part 1 are analogous to topo maps and a
- compass, basic tools we use all the time. Most of the tools in part 2
- are analogous to flare guns and satellite phones. They aren't used
- too often on a hike, but when we are stuck, they can be invaluable.
-
- What follows are the more advanced, less used, or sometimes esoteric
- capabilities of perl regexps. In Part 2, we will assume you are
- comfortable with the basics and concentrate on the new features.
-
- =head2 More on characters, strings, and character classes
-
- There are a number of escape sequences and character classes that we
- haven't covered yet.
-
- There are several escape sequences that convert characters or strings
- between upper and lower case. C<\l> and C<\u> convert the next
- character to lower or upper case, respectively:
-
- $x = "perl";
- $string =~ /\u$x/; # matches 'Perl' in $string
- $x = "M(rs?|s)\\."; # note the double backslash
- $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
-
- C<\L> and C<\U> converts a whole substring, delimited by C<\L> or
- C<\U> and C<\E>, to lower or upper case:
-
- $x = "This word is in lower case:\L SHOUT\E";
- $x =~ /shout/; # matches
- $x = "I STILL KEYPUNCH CARDS FOR MY 360"
- $x =~ /\Ukeypunch/; # matches punch card string
-
- If there is no C<\E>, case is converted until the end of the
- string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
- character of C<$word> to uppercase and the rest of the characters to
- lowercase.
-
- Control characters can be escaped with C<\c>, so that a control-Z
- character would be matched with C<\cZ>. The escape sequence
- C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
- instance,
-
- $x = "\QThat !^*&%~& cat!";
- $x =~ /\Q!^*&%~&\E/; # check for rough language
-
- It does not protect C<$> or C<@>, so that variables can still be
- substituted.
-
- With the advent of 5.6.0, perl regexps can handle more than just the
- standard ASCII character set. Perl now supports B<Unicode>, a standard
- for encoding the character sets from many of the world's written
- languages. Unicode does this by allowing characters to be more than
- one byte wide. Perl uses the UTF-8 encoding, in which ASCII characters
- are still encoded as one byte, but characters greater than C<chr(127)>
- may be stored as two or more bytes.
-
- What does this mean for regexps? Well, regexp users don't need to know
- much about perl's internal representation of strings. But they do need
- to know 1) how to represent Unicode characters in a regexp and 2) when
- a matching operation will treat the string to be searched as a
- sequence of bytes (the old way) or as a sequence of Unicode characters
- (the new way). The answer to 1) is that Unicode characters greater
- than C<chr(127)> may be represented using the C<\x{hex}> notation,
- with C<hex> a hexadecimal integer:
-
- /\x{263a}/; # match a Unicode smiley face :)
-
- Unicode characters in the range of 128-255 use two hexadecimal digits
- with braces: C<\x{ab}>. Note that this is different than C<\xab>,
- which is just a hexadecimal byte with no Unicode significance.
-
- B<NOTE>: in Perl 5.6.0 it used to be that one needed to say C<use
- utf8> to use any Unicode features. This is no more the case: for
- almost all Unicode processing, the explicit C<utf8> pragma is not
- needed. (The only case where it matters is if your Perl script is in
- Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
-
- Figuring out the hexadecimal sequence of a Unicode character you want
- or deciphering someone else's hexadecimal Unicode regexp is about as
- much fun as programming in machine code. So another way to specify
- Unicode characters is to use the S<B<named character> > escape
- sequence C<\N{name}>. C<name> is a name for the Unicode character, as
- specified in the Unicode standard. For instance, if we wanted to
- represent or match the astrological sign for the planet Mercury, we
- could use
-
- use charnames ":full"; # use named chars with Unicode full names
- $x = "abc\N{MERCURY}def";
- $x =~ /\N{MERCURY}/; # matches
-
- One can also use short names or restrict names to a certain alphabet:
-
- use charnames ':full';
- print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
-
- use charnames ":short";
- print "\N{greek:Sigma} is an upper-case sigma.\n";
-
- use charnames qw(greek);
- print "\N{sigma} is Greek sigma\n";
-
- A list of full names is found in the file Names.txt in the
- lib/perl5/5.X.X/unicore directory.
-
- The answer to requirement 2), as of 5.6.0, is that if a regexp
- contains Unicode characters, the string is searched as a sequence of
- Unicode characters. Otherwise, the string is searched as a sequence of
- bytes. If the string is being searched as a sequence of Unicode
- characters, but matching a single byte is required, we can use the C<\C>
- escape sequence. C<\C> is a character class akin to C<.> except that
- it matches I<any> byte 0-255. So
-
- use charnames ":full"; # use named chars with Unicode full names
- $x = "a";
- $x =~ /\C/; # matches 'a', eats one byte
- $x = "";
- $x =~ /\C/; # doesn't match, no bytes to match
- $x = "\N{MERCURY}"; # two-byte Unicode character
- $x =~ /\C/; # matches, but dangerous!
-
- The last regexp matches, but is dangerous because the string
- I<character> position is no longer synchronized to the string I<byte>
- position. This generates the warning 'Malformed UTF-8
- character'. The C<\C> is best used for matching the binary data in strings
- with binary data intermixed with Unicode characters.
-
- Let us now discuss the rest of the character classes. Just as with
- Unicode characters, there are named Unicode character classes
- represented by the C<\p{name}> escape sequence. Closely associated is
- the C<\P{name}> character class, which is the negation of the
- C<\p{name}> class. For example, to match lower and uppercase
- characters,
-
- use charnames ":full"; # use named chars with Unicode full names
- $x = "BOB";
- $x =~ /^\p{IsUpper}/; # matches, uppercase char class
- $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
- $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
- $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
-
- Here is the association between some Perl named classes and the
- traditional Unicode classes:
-
- Perl class name Unicode class name or regular expression
-
- IsAlpha /^[LM]/
- IsAlnum /^[LMN]/
- IsASCII $code <= 127
- IsCntrl /^C/
- IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
- IsDigit Nd
- IsGraph /^([LMNPS]|Co)/
- IsLower Ll
- IsPrint /^([LMNPS]|Co|Zs)/
- IsPunct /^P/
- IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
- IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
- IsUpper /^L[ut]/
- IsWord /^[LMN]/ || $code eq "005F"
- IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
-
- You can also use the official Unicode class names with the C<\p> and
- C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase
- letters, or C<\P{Nd}> for non-digits. If a C<name> is just one
- letter, the braces can be dropped. For instance, C<\pM> is the
- character class of Unicode 'marks', for example accent marks.
- For the full list see L<perlunicode>.
-
- The Unicode has also been separated into various sets of charaters
- which you can test with C<\p{In...}> (in) and C<\P{In...}> (not in),
- for example C<\p{Latin}>, C<\p{Greek}>, or C<\P{Katakana}>.
- For the full list see L<perlunicode>.
-
- C<\X> is an abbreviation for a character class sequence that includes
- the Unicode 'combining character sequences'. A 'combining character
- sequence' is a base character followed by any number of combining
- characters. An example of a combining character is an accent. Using
- the Unicode full names, e.g., S<C<A + COMBINING RING> > is a combining
- character sequence with base character C<A> and combining character
- S<C<COMBINING RING> >, which translates in Danish to A with the circle
- atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
- i.e., a non-mark followed by one or more marks.
-
- For the full and latest information about Unicode see the latest
- Unicode standard, or the Unicode Consortium's website http://www.unicode.org/
-
- As if all those classes weren't enough, Perl also defines POSIX style
- character classes. These have the form C<[:name:]>, with C<name> the
- name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
- C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
- C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
- extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8>
- is being used, then these classes are defined the same as their
- corresponding perl Unicode classes: C<[:upper:]> is the same as
- C<\p{IsUpper}>, etc. The POSIX character classes, however, don't
- require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
- C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
- character classes. To negate a POSIX class, put a C<^> in front of
- the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
- C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
- be used just like C<\d>, with the exception that POSIX character
- classes can only be used inside of a character class:
-
- /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
- /^=item\s[[:digit:]]/; # match '=item',
- # followed by a space and a digit
- use charnames ":full";
- /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
- /^=item\s\p{IsDigit}/; # match '=item',
- # followed by a space and a digit
-
- Whew! That is all the rest of the characters and character classes.
-
- =head2 Compiling and saving regular expressions
-
- In Part 1 we discussed the C<//o> modifier, which compiles a regexp
- just once. This suggests that a compiled regexp is some data structure
- that can be stored once and used again and again. The regexp quote
- C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
- regexp and transforms the result into a form that can be assigned to a
- variable:
-
- $reg = qr/foo+bar?/; # reg contains a compiled regexp
-
- Then C<$reg> can be used as a regexp:
-
- $x = "fooooba";
- $x =~ $reg; # matches, just like /foo+bar?/
- $x =~ /$reg/; # same thing, alternate form
-
- C<$reg> can also be interpolated into a larger regexp:
-
- $x =~ /(abc)?$reg/; # still matches
-
- As with the matching operator, the regexp quote can use different
- delimiters, e.g., C<qr!!>, C<qr{}> and C<qr~~>. The single quote
- delimiters C<qr''> prevent any interpolation from taking place.
-
- Pre-compiled regexps are useful for creating dynamic matches that
- don't need to be recompiled each time they are encountered. Using
- pre-compiled regexps, C<simple_grep> program can be expanded into a
- program that matches multiple patterns:
-
- % cat > multi_grep
- #!/usr/bin/perl
- # multi_grep - match any of <number> regexps
- # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
-
- $number = shift;
- $regexp[$_] = shift foreach (0..$number-1);
- @compiled = map qr/$_/, @regexp;
- while ($line = <>) {
- foreach $pattern (@compiled) {
- if ($line =~ /$pattern/) {
- print $line;
- last; # we matched, so move onto the next line
- }
- }
- }
- ^D
-
- % multi_grep 2 last for multi_grep
- $regexp[$_] = shift foreach (0..$number-1);
- foreach $pattern (@compiled) {
- last;
-
- Storing pre-compiled regexps in an array C<@compiled> allows us to
- simply loop through the regexps without any recompilation, thus gaining
- flexibility without sacrificing speed.
-
- =head2 Embedding comments and modifiers in a regular expression
-
- Starting with this section, we will be discussing Perl's set of
- B<extended patterns>. These are extensions to the traditional regular
- expression syntax that provide powerful new tools for pattern
- matching. We have already seen extensions in the form of the minimal
- matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
- rest of the extensions below have the form C<(?char...)>, where the
- C<char> is a character that determines the type of extension.
-
- The first extension is an embedded comment C<(?#text)>. This embeds a
- comment into the regular expression without affecting its meaning. The
- comment should not have any closing parentheses in the text. An
- example is
-
- /(?# Match an integer:)[+-]?\d+/;
-
- This style of commenting has been largely superseded by the raw,
- freeform commenting that is allowed with the C<//x> modifier.
-
- The modifiers C<//i>, C<//m>, C<//s>, and C<//x> can also embedded in
- a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
-
- /(?i)yes/; # match 'yes' case insensitively
- /yes/i; # same thing
- /(?x)( # freeform version of an integer regexp
- [+-]? # match an optional sign
- \d+ # match a sequence of digits
- )
- /x;
-
- Embedded modifiers can have two important advantages over the usual
- modifiers. Embedded modifiers allow a custom set of modifiers to
- I<each> regexp pattern. This is great for matching an array of regexps
- that must have different modifiers:
-
- $pattern[0] = '(?i)doctor';
- $pattern[1] = 'Johnson';
- ...
- while (<>) {
- foreach $patt (@pattern) {
- print if /$patt/;
- }
- }
-
- The second advantage is that embedded modifiers only affect the regexp
- inside the group the embedded modifier is contained in. So grouping
- can be used to localize the modifier's effects:
-
- /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
-
- Embedded modifiers can also turn off any modifiers already present
- by using, e.g., C<(?-i)>. Modifiers can also be combined into
- a single expression, e.g., C<(?s-i)> turns on single line mode and
- turns off case insensitivity.
-
- =head2 Non-capturing groupings
-
- We noted in Part 1 that groupings C<()> had two distinct functions: 1)
- group regexp elements together as a single unit, and 2) extract, or
- capture, substrings that matched the regexp in the
- grouping. Non-capturing groupings, denoted by C<(?:regexp)>, allow the
- regexp to be treated as a single unit, but don't extract substrings or
- set matching variables C<$1>, etc. Both capturing and non-capturing
- groupings are allowed to co-exist in the same regexp. Because there is
- no extraction, non-capturing groupings are faster than capturing
- groupings. Non-capturing groupings are also handy for choosing exactly
- which parts of a regexp are to be extracted to matching variables:
-
- # match a number, $1-$4 are set, but we only want $1
- /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
-
- # match a number faster , only $1 is set
- /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
-
- # match a number, get $1 = whole number, $2 = exponent
- /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
-
- Non-capturing groupings are also useful for removing nuisance
- elements gathered from a split operation:
-
- $x = '12a34b5';
- @num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
- @num = split /(?:a|b)/, $x; # @num = ('12','34','5')
-
- Non-capturing groupings may also have embedded modifiers:
- C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
- case insensitively and turns off multi-line mode.
-
- =head2 Looking ahead and looking behind
-
- This section concerns the lookahead and lookbehind assertions. First,
- a little background.
-
- In Perl regular expressions, most regexp elements 'eat up' a certain
- amount of string when they match. For instance, the regexp element
- C<[abc}]> eats up one character of the string when it matches, in the
- sense that perl moves to the next character position in the string
- after the match. There are some elements, however, that don't eat up
- characters (advance the character position) if they match. The examples
- we have seen so far are the anchors. The anchor C<^> matches the
- beginning of the line, but doesn't eat any characters. Similarly, the
- word boundary anchor C<\b> matches, e.g., if the character to the left
- is a word character and the character to the right is a non-word
- character, but it doesn't eat up any characters itself. Anchors are
- examples of 'zero-width assertions'. Zero-width, because they consume
- no characters, and assertions, because they test some property of the
- string. In the context of our walk in the woods analogy to regexp
- matching, most regexp elements move us along a trail, but anchors have
- us stop a moment and check our surroundings. If the local environment
- checks out, we can proceed forward. But if the local environment
- doesn't satisfy us, we must backtrack.
-
- Checking the environment entails either looking ahead on the trail,
- looking behind, or both. C<^> looks behind, to see that there are no
- characters before. C<$> looks ahead, to see that there are no
- characters after. C<\b> looks both ahead and behind, to see if the
- characters on either side differ in their 'word'-ness.
-
- The lookahead and lookbehind assertions are generalizations of the
- anchor concept. Lookahead and lookbehind are zero-width assertions
- that let us specify which characters we want to test for. The
- lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
- assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
-
- $x = "I catch the housecat 'Tom-cat' with catnip";
- $x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
- @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
- # $catwords[0] = 'catch'
- # $catwords[1] = 'catnip'
- $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
- $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
- # middle of $x
-
- Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
- non-capturing, since these are zero-width assertions. Thus in the
- second regexp, the substrings captured are those of the whole regexp
- itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
- lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
- width, i.e., a fixed number of characters long. Thus
- C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
- negated versions of the lookahead and lookbehind assertions are
- denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
- They evaluate true if the regexps do I<not> match:
-
- $x = "foobar";
- $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
- $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
- $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
-
- The C<\C> is unsupported in lookbehind, because the already
- treacherous definition of C<\C> would become even more so
- when going backwards.
-
- =head2 Using independent subexpressions to prevent backtracking
-
- The last few extended patterns in this tutorial are experimental as of
- 5.6.0. Play with them, use them in some code, but don't rely on them
- just yet for production code.
-
- S<B<Independent subexpressions> > are regular expressions, in the
- context of a larger regular expression, that function independently of
- the larger regular expression. That is, they consume as much or as
- little of the string as they wish without regard for the ability of
- the larger regexp to match. Independent subexpressions are represented
- by C<< (?>regexp) >>. We can illustrate their behavior by first
- considering an ordinary regexp:
-
- $x = "ab";
- $x =~ /a*ab/; # matches
-
- This obviously matches, but in the process of matching, the
- subexpression C<a*> first grabbed the C<a>. Doing so, however,
- wouldn't allow the whole regexp to match, so after backtracking, C<a*>
- eventually gave back the C<a> and matched the empty string. Here, what
- C<a*> matched was I<dependent> on what the rest of the regexp matched.
-
- Contrast that with an independent subexpression:
-
- $x =~ /(?>a*)ab/; # doesn't match!
-
- The independent subexpression C<< (?>a*) >> doesn't care about the rest
- of the regexp, so it sees an C<a> and grabs it. Then the rest of the
- regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
- is no backtracking and the independent subexpression does not give
- up its C<a>. Thus the match of the regexp as a whole fails. A similar
- behavior occurs with completely independent regexps:
-
- $x = "ab";
- $x =~ /a*/g; # matches, eats an 'a'
- $x =~ /\Gab/g; # doesn't match, no 'a' available
-
- Here C<//g> and C<\G> create a 'tag team' handoff of the string from
- one regexp to the other. Regexps with an independent subexpression are
- much like this, with a handoff of the string to the independent
- subexpression, and a handoff of the string back to the enclosing
- regexp.
-
- The ability of an independent subexpression to prevent backtracking
- can be quite useful. Suppose we want to match a non-empty string
- enclosed in parentheses up to two levels deep. Then the following
- regexp matches:
-
- $x = "abc(de(fg)h"; # unbalanced parentheses
- $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
-
- The regexp matches an open parenthesis, one or more copies of an
- alternation, and a close parenthesis. The alternation is two-way, with
- the first alternative C<[^()]+> matching a substring with no
- parentheses and the second alternative C<\([^()]*\)> matching a
- substring delimited by parentheses. The problem with this regexp is
- that it is pathological: it has nested indeterminate quantifiers
- of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
- like this could take an exponentially long time to execute if there
- was no match possible. To prevent the exponential blowup, we need to
- prevent useless backtracking at some point. This can be done by
- enclosing the inner quantifier as an independent subexpression:
-
- $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
-
- Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
- by gobbling up as much of the string as possible and keeping it. Then
- match failures fail much more quickly.
-
- =head2 Conditional expressions
-
- A S<B<conditional expression> > is a form of if-then-else statement
- that allows one to choose which patterns are to be matched, based on
- some condition. There are two types of conditional expression:
- C<(?(condition)yes-regexp)> and
- C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
- like an S<C<'if () {}'> > statement in Perl. If the C<condition> is true,
- the C<yes-regexp> will be matched. If the C<condition> is false, the
- C<yes-regexp> will be skipped and perl will move onto the next regexp
- element. The second form is like an S<C<'if () {} else {}'> > statement
- in Perl. If the C<condition> is true, the C<yes-regexp> will be
- matched, otherwise the C<no-regexp> will be matched.
-
- The C<condition> can have two forms. The first form is simply an
- integer in parentheses C<(integer)>. It is true if the corresponding
- backreference C<\integer> matched earlier in the regexp. The second
- form is a bare zero width assertion C<(?...)>, either a
- lookahead, a lookbehind, or a code assertion (discussed in the next
- section).
-
- The integer form of the C<condition> allows us to choose, with more
- flexibility, what to match based on what matched earlier in the
- regexp. This searches for words of the form C<"$x$x"> or
- C<"$x$y$y$x">:
-
- % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
- beriberi
- coco
- couscous
- deed
- ...
- toot
- toto
- tutu
-
- The lookbehind C<condition> allows, along with backreferences,
- an earlier part of the match to influence a later part of the
- match. For instance,
-
- /[ATGC]+(?(?<=AA)G|C)$/;
-
- matches a DNA sequence such that it either ends in C<AAG>, or some
- other base pair combination and C<C>. Note that the form is
- C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
- lookahead, lookbehind or code assertions, the parentheses around the
- conditional are not needed.
-
- =head2 A bit of magic: executing Perl code in a regular expression
-
- Normally, regexps are a part of Perl expressions.
- S<B<Code evaluation> > expressions turn that around by allowing
- arbitrary Perl code to be a part of a regexp. A code evaluation
- expression is denoted C<(?{code})>, with C<code> a string of Perl
- statements.
-
- Code expressions are zero-width assertions, and the value they return
- depends on their environment. There are two possibilities: either the
- code expression is used as a conditional in a conditional expression
- C<(?(condition)...)>, or it is not. If the code expression is a
- conditional, the code is evaluated and the result (i.e., the result of
- the last statement) is used to determine truth or falsehood. If the
- code expression is not used as a conditional, the assertion always
- evaluates true and the result is put into the special variable
- C<$^R>. The variable C<$^R> can then be used in code expressions later
- in the regexp. Here are some silly examples:
-
- $x = "abcdef";
- $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
- # prints 'Hi Mom!'
- $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
- # no 'Hi Mom!'
-
- Pay careful attention to the next example:
-
- $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
- # no 'Hi Mom!'
- # but why not?
-
- At first glance, you'd think that it shouldn't print, because obviously
- the C<ddd> isn't going to match the target string. But look at this
- example:
-
- $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
- # but _does_ print
-
- Hmm. What happened here? If you've been following along, you know that
- the above pattern should be effectively the same as the last one --
- enclosing the d in a character class isn't going to change what it
- matches. So why does the first not print while the second one does?
-
- The answer lies in the optimizations the REx engine makes. In the first
- case, all the engine sees are plain old characters (aside from the
- C<?{}> construct). It's smart enough to realize that the string 'ddd'
- doesn't occur in our target string before actually running the pattern
- through. But in the second case, we've tricked it into thinking that our
- pattern is more complicated than it is. It takes a look, sees our
- character class, and decides that it will have to actually run the
- pattern to determine whether or not it matches, and in the process of
- running it hits the print statement before it discovers that we don't
- have a match.
-
- To take a closer look at how the engine does optimizations, see the
- section L<"Pragmas and debugging"> below.
-
- More fun with C<?{}>:
-
- $x =~ /(?{print "Hi Mom!";})/; # matches,
- # prints 'Hi Mom!'
- $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
- # prints '1'
- $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
- # prints '1'
-
- The bit of magic mentioned in the section title occurs when the regexp
- backtracks in the process of searching for a match. If the regexp
- backtracks over a code expression and if the variables used within are
- localized using C<local>, the changes in the variables produced by the
- code expression are undone! Thus, if we wanted to count how many times
- a character got matched inside a group, we could use, e.g.,
-
- $x = "aaaa";
- $count = 0; # initialize 'a' count
- $c = "bob"; # test if $c gets clobbered
- $x =~ /(?{local $c = 0;}) # initialize count
- ( a # match 'a'
- (?{local $c = $c + 1;}) # increment count
- )* # do this any number of times,
- aa # but match 'aa' at the end
- (?{$count = $c;}) # copy local $c var into $count
- /x;
- print "'a' count is $count, \$c variable is '$c'\n";
-
- This prints
-
- 'a' count is 2, $c variable is 'bob'
-
- If we replace the S<C< (?{local $c = $c + 1;})> > with
- S<C< (?{$c = $c + 1;})> >, the variable changes are I<not> undone
- during backtracking, and we get
-
- 'a' count is 4, $c variable is 'bob'
-
- Note that only localized variable changes are undone. Other side
- effects of code expression execution are permanent. Thus
-
- $x = "aaaa";
- $x =~ /(a(?{print "Yow\n";}))*aa/;
-
- produces
-
- Yow
- Yow
- Yow
- Yow
-
- The result C<$^R> is automatically localized, so that it will behave
- properly in the presence of backtracking.
-
- This example uses a code expression in a conditional to match the
- article 'the' in either English or German:
-
- $lang = 'DE'; # use German
- ...
- $text = "das";
- print "matched\n"
- if $text =~ /(?(?{
- $lang eq 'EN'; # is the language English?
- })
- the | # if so, then match 'the'
- (die|das|der) # else, match 'die|das|der'
- )
- /xi;
-
- Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
- C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
- code expression, we don't need the extra parentheses around the
- conditional.
-
- If you try to use code expressions with interpolating variables, perl
- may surprise you:
-
- $bar = 5;
- $pat = '(?{ 1 })';
- /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
- /foo(?{ 1 })$bar/; # compile error!
- /foo${pat}bar/; # compile error!
-
- $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
- /foo${pat}bar/; # compiles ok
-
- If a regexp has (1) code expressions and interpolating variables,or
- (2) a variable that interpolates a code expression, perl treats the
- regexp as an error. If the code expression is precompiled into a
- variable, however, interpolating is ok. The question is, why is this
- an error?
-
- The reason is that variable interpolation and code expressions
- together pose a security risk. The combination is dangerous because
- many programmers who write search engines often take user input and
- plug it directly into a regexp:
-
- $regexp = <>; # read user-supplied regexp
- $chomp $regexp; # get rid of possible newline
- $text =~ /$regexp/; # search $text for the $regexp
-
- If the C<$regexp> variable contains a code expression, the user could
- then execute arbitrary Perl code. For instance, some joker could
- search for S<C<system('rm -rf *');> > to erase your files. In this
- sense, the combination of interpolation and code expressions B<taints>
- your regexp. So by default, using both interpolation and code
- expressions in the same regexp is not allowed. If you're not
- concerned about malicious users, it is possible to bypass this
- security check by invoking S<C<use re 'eval'> >:
-
- use re 'eval'; # throw caution out the door
- $bar = 5;
- $pat = '(?{ 1 })';
- /foo(?{ 1 })$bar/; # compiles ok
- /foo${pat}bar/; # compiles ok
-
- Another form of code expression is the S<B<pattern code expression> >.
- The pattern code expression is like a regular code expression, except
- that the result of the code evaluation is treated as a regular
- expression and matched immediately. A simple example is
-
- $length = 5;
- $char = 'a';
- $x = 'aaaaabb';
- $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
-
-
- This final example contains both ordinary and pattern code
- expressions. It detects if a binary string C<1101010010001...> has a
- Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
-
- $s0 = 0; $s1 = 1; # initial conditions
- $x = "1101010010001000001";
- print "It is a Fibonacci sequence\n"
- if $x =~ /^1 # match an initial '1'
- (
- (??{'0' x $s0}) # match $s0 of '0'
- 1 # and then a '1'
- (?{
- $largest = $s0; # largest seq so far
- $s2 = $s1 + $s0; # compute next term
- $s0 = $s1; # in Fibonacci sequence
- $s1 = $s2;
- })
- )+ # repeat as needed
- $ # that is all there is
- /x;
- print "Largest sequence matched was $largest\n";
-
- This prints
-
- It is a Fibonacci sequence
- Largest sequence matched was 5
-
- Ha! Try that with your garden variety regexp package...
-
- Note that the variables C<$s0> and C<$s1> are not substituted when the
- regexp is compiled, as happens for ordinary variables outside a code
- expression. Rather, the code expressions are evaluated when perl
- encounters them during the search for a match.
-
- The regexp without the C<//x> modifier is
-
- /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
-
- and is a great start on an Obfuscated Perl entry :-) When working with
- code and conditional expressions, the extended form of regexps is
- almost necessary in creating and debugging regexps.
-
- =head2 Pragmas and debugging
-
- Speaking of debugging, there are several pragmas available to control
- and debug regexps in Perl. We have already encountered one pragma in
- the previous section, S<C<use re 'eval';> >, that allows variable
- interpolation and code expressions to coexist in a regexp. The other
- pragmas are
-
- use re 'taint';
- $tainted = <>;
- @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
-
- The C<taint> pragma causes any substrings from a match with a tainted
- variable to be tainted as well. This is not normally the case, as
- regexps are often used to extract the safe bits from a tainted
- variable. Use C<taint> when you are not extracting safe bits, but are
- performing some other processing. Both C<taint> and C<eval> pragmas
- are lexically scoped, which means they are in effect only until
- the end of the block enclosing the pragmas.
-
- use re 'debug';
- /^(.*)$/s; # output debugging info
-
- use re 'debugcolor';
- /^(.*)$/s; # output debugging info in living color
-
- The global C<debug> and C<debugcolor> pragmas allow one to get
- detailed debugging info about regexp compilation and
- execution. C<debugcolor> is the same as debug, except the debugging
- information is displayed in color on terminals that can display
- termcap color sequences. Here is example output:
-
- % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
- Compiling REx `a*b+c'
- size 9 first at 1
- 1: STAR(4)
- 2: EXACT <a>(0)
- 4: PLUS(7)
- 5: EXACT <b>(0)
- 7: EXACT <c>(9)
- 9: END(0)
- floating `bc' at 0..2147483647 (checking floating) minlen 2
- Guessing start of match, REx `a*b+c' against `abc'...
- Found floating substr `bc' at offset 1...
- Guessed: match at offset 0
- Matching REx `a*b+c' against `abc'
- Setting an EVAL scope, savestack=3
- 0 <> <abc> | 1: STAR
- EXACT <a> can match 1 times out of 32767...
- Setting an EVAL scope, savestack=3
- 1 <a> <bc> | 4: PLUS
- EXACT <b> can match 1 times out of 32767...
- Setting an EVAL scope, savestack=3
- 2 <ab> <c> | 7: EXACT <c>
- 3 <abc> <> | 9: END
- Match successful!
- Freeing REx: `a*b+c'
-
- If you have gotten this far into the tutorial, you can probably guess
- what the different parts of the debugging output tell you. The first
- part
-
- Compiling REx `a*b+c'
- size 9 first at 1
- 1: STAR(4)
- 2: EXACT <a>(0)
- 4: PLUS(7)
- 5: EXACT <b>(0)
- 7: EXACT <c>(9)
- 9: END(0)
-
- describes the compilation stage. C<STAR(4)> means that there is a
- starred object, in this case C<'a'>, and if it matches, goto line 4,
- i.e., C<PLUS(7)>. The middle lines describe some heuristics and
- optimizations performed before a match:
-
- floating `bc' at 0..2147483647 (checking floating) minlen 2
- Guessing start of match, REx `a*b+c' against `abc'...
- Found floating substr `bc' at offset 1...
- Guessed: match at offset 0
-
- Then the match is executed and the remaining lines describe the
- process:
-
- Matching REx `a*b+c' against `abc'
- Setting an EVAL scope, savestack=3
- 0 <> <abc> | 1: STAR
- EXACT <a> can match 1 times out of 32767...
- Setting an EVAL scope, savestack=3
- 1 <a> <bc> | 4: PLUS
- EXACT <b> can match 1 times out of 32767...
- Setting an EVAL scope, savestack=3
- 2 <ab> <c> | 7: EXACT <c>
- 3 <abc> <> | 9: END
- Match successful!
- Freeing REx: `a*b+c'
-
- Each step is of the form S<C<< n <x> <y> >> >, with C<< <x> >> the
- part of the string matched and C<< <y> >> the part not yet
- matched. The S<C<< | 1: STAR >> > says that perl is at line number 1
- n the compilation list above. See
- L<perldebguts/"Debugging regular expressions"> for much more detail.
-
- An alternative method of debugging regexps is to embed C<print>
- statements within the regexp. This provides a blow-by-blow account of
- the backtracking in an alternation:
-
- "that this" =~ m@(?{print "Start at position ", pos, "\n";})
- t(?{print "t1\n";})
- h(?{print "h1\n";})
- i(?{print "i1\n";})
- s(?{print "s1\n";})
- |
- t(?{print "t2\n";})
- h(?{print "h2\n";})
- a(?{print "a2\n";})
- t(?{print "t2\n";})
- (?{print "Done at position ", pos, "\n";})
- @x;
-
- prints
-
- Start at position 0
- t1
- h1
- t2
- h2
- a2
- t2
- Done at position 4
-
- =head1 BUGS
-
- Code expressions, conditional expressions, and independent expressions
- are B<experimental>. Don't use them in production code. Yet.
-
- =head1 SEE ALSO
-
- This is just a tutorial. For the full story on perl regular
- expressions, see the L<perlre> regular expressions reference page.
-
- For more information on the matching C<m//> and substitution C<s///>
- operators, see L<perlop/"Regexp Quote-Like Operators">. For
- information on the C<split> operation, see L<perlfunc/split>.
-
- For an excellent all-around resource on the care and feeding of
- regular expressions, see the book I<Mastering Regular Expressions> by
- Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
-
- =head1 AUTHOR AND COPYRIGHT
-
- Copyright (c) 2000 Mark Kvale
- All rights reserved.
-
- This document may be distributed under the same terms as Perl itself.
-
- =head2 Acknowledgments
-
- The inspiration for the stop codon DNA example came from the ZIP
- code example in chapter 7 of I<Mastering Regular Expressions>.
-
- The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
- Haworth, Ronald J Kimball, and Joe Smith for all their helpful
- comments.
-
- =cut
-
-