OS/2 Shareware BBS: 15 Message/15-Message.zip/UU990911.zip/Um990910.txt

Text File | 1999-09-11 | 606KB | 15,992 lines

                   comp.os.os2.misc                 (Usenet)

                 Saturday, 04-Sep-1999 to Friday, 10-Sep-1999

+----------------------------------------------------------------------------+

From: [e-mail]                             03-Sep-99 17:24:01
  To: All                                               04-Sep-99 05:58:09
Subj: Re: Clobbering an old install to get HPFS?

From: [e-mail] (Paul Neubauer)

In article <bexPS8LfLge6-pn2-ecwyoB7bc1ZH@localhost>, Annie K. wrote:
>On Fri, 3 Sep 1999 02:56:00, [e-mail] (Paul Neubauer) wrote:
>
>>[...]
> OS/2 doesn't have a malicious install as some MSFT products do. Anyway,
>how is the drive partitioned?

Just one partition, bootable & installable.  I did use the fdisk to remove
the partition (or so I thought) and then remake it.

>:How do I get this drive to be HPFS?
>
> You can delete all partitions, and create new ones. Or, Partition Magic

This is what I thought I did.  Do I need to make a few partitions,
format, delete them and make one, format and then I'll be there?

I like that OS/2 is nice about things, but I need it be a bit
less polite for a moment.  (On the other hand, the last reinstall
I tried did get it seen by the WfW machine on my little network.
I've not gotten the OS/2 box to see the WfW shared drives, but
I'm putting that down to my own ignorance.. which can be rectified.)

- Paul Neubauer

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier Globalcenter (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              03-Sep-99 17:29:25
  To: All                                               04-Sep-99 05:58:09
Subj: Re: Clobbering an old install to get HPFS?

From: [e-mail] (Jim Backus)

It may be that you've done a basic installation.  OS/2 does not give you the
option of using HPFS unless you follow the advanced install option.

Effectively OS/2 basic installation will select a drive (i.e. partition) to
install on.  It might then go ahead with the installation without a pause.  I
never use the simple / basic installation option so I'm not sure of what it
does.

If you select the advanced installation option, OS/2 pauses to confirm the
installation disk (or partition) before proceeding.  If you choose to change
at that stage you go into OS/2's fdisk utility and when you've set the
partitions the way you want them the machine reboots and wants the first
startup diskette again.

It's a while since I've done this but AFAIK that's the way it goes.  As far as
the advanced installation option goes - it is my understanding that if you
accept all the defaults, you end up wioth the same installation as if you'd
chosen the simple / basic installation route.

I've never heard of a track -1 situation.

In message <[e-mail]> -
[e-mail] (Paul Neubauer) writes:
:>
:>I've gotten things pretty much set up the way I want now
:>and the point was to learn how..  and now I know, for
:>the most part, how to get Warp Connect to do what I want.
:>
:>There's one thing that has me puzzled though...
:>
:>The hard drive I'm using had Win95 on it and I thought
:>an install of OS/2 with me using fdisk, and then
:>specifying HPFS would have eliminated that.
:>
:>Instead, and I do no pretend to understand, it seems to
:>have bailed on HPFS, went (kept?) FAT16 and preserved
:>what win95 files there were.
:>
:>How do I get this drive to be HPFS?  And I expect to
:>end up doing a full reinstall - I've backup up what
:>I think I really need to.
:>
:>Thanks,
:>
:>Paul Neubauer



Jim Backus - Electronic Systems Engineer - OS/2 user by choice
 - member of Amnesty International
 - supporter of Proportional Representation
Bona fide  replies to jimb (at) jita dot demon dot co dot uk

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Fourmyle (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             03-Sep-99 17:43:04
  To: All                                               04-Sep-99 05:58:09
Subj: Re: Clobbering an old install to get HPFS?

From: [e-mail] (Paul Neubauer)

In article <[e-mail]>,
 Jim Backus wrote:
>It may be that you've done a basic installation.  OS/2 does not give you the
>option of using HPFS unless you follow the advanced install option.

Did that last night.  Made sure to select Advanced - same result
unless I really missed something.

> [...]
>
>If you select the advanced installation option, OS/2 pauses to confirm the
>installation disk (or partition) before proceeding.  If you choose to change
>at that stage you go into OS/2's fdisk utility and when you've set the
>partitions the way you want them the machine reboots and wants the first
>startup diskette again.

This I went through - even deleted the partition, then turned around
and remade it.  Maybe I need to make a two and truly force a change?

>It's a while since I've done this but AFAIK that's the way it goes.  As far
as
>the advanced installation option goes - it is my understanding that if you
>accept all the defaults, you end up wioth the same installation as if you'd
>chosen the simple / basic installation route.
>
I've selected what I wanted, and aside from the HPFS vs. FAT issue
it did exactly what I wanted and expected.

--
Paul Neubauer

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier Globalcenter (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           03-Sep-99 17:55:24
  To: All                                               04-Sep-99 05:58:09
Subj: Re: Help with Mindspring as an ISP

From: doug.bissett"at"ibm.net (Doug Bissett)

On Thu, 2 Sep 1999 20:50:42, [e-mail] (Ron Gibson) wrote:

..snip...
>
> Feel free to pitch in with suggestions :)
>
>
>                       email: [e-mail]
>

I have had good service from the IBM Global network (now owned by
AT&T). Check out http://www.ibm.net.

Hope this helps...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           03-Sep-99 17:55:26
  To: All                                               04-Sep-99 05:58:09
Subj: Re: Should we stop the servers?

From: doug.bissett"at"ibm.net (Doug Bissett)

On Thu, 2 Sep 1999 18:40:11, "Arjan Maus" <[e-mail]>
wrote:

> Hello everybody,
>
> My company wants to shut down all OS/2 servers at new years eve!!!!
> Is this a common thing to do or is it just stupid and not necessary at
> all???
>
> Does anybody have a good suggestion?
>
> Arjan
>

Shutdown is, probably, not necessary (as long as EVERYTHING has been
checked out for Y2k compliance, including EVERYTHING that your
computers may be connected to). On the other hand, what did you miss
when the testing was done (you DID test EVERYTHING right?). If, there
is not a compelling reason to have your computer up, and running, at
the year rollover (such as emegency services), I would be tempted to
make sure everything is backed up, turn the machines OFF, and watch
carefully, as each one is turned on in the new year. It is just one
more thing you can do to help to ensure that you don't have problems.

My own machines will be OFF at midnight...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                         03-Sep-99 07:09:19
  To: All                                               04-Sep-99 05:58:09
Subj: Re: Clobbering an old install to get HPFS?

From: "Dave {Reply Address in.sig}" <[e-mail]>

On 3 Sep 1999 02:56:00 GMT, Paul Neubauer wrote:
>
>Instead, and I do no pretend to understand, it seems to
>have bailed on HPFS, went (kept?) FAT16 and preserved
>what win95 files there were.
>
>How do I get this drive to be HPFS?  And I expect to
>end up doing a full reinstall - I've backup up what
>I think I really need to.
>
Somewhere during the install you get asked if you want to format the
disk. You have to answer "yes" and select HPFS as the format you want.
This does have the effect of losing whatever was on the disk of course
:-)

I'm not sure if the "easy" install offers this because I've always used
the "advanced" option. If all else fails, run FDISK and *DELETE* the
partition, then install OS/2 after the reboot. As it won't have a
partition at all, it should should give you the option to run FDISK to
create one and then format the partition.


Dave
--
mail dav [e-mail]
http://www.llondel.demon.co.uk
Cricket: old English traditional variant of the rain dance.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: the bus stop (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               03-Sep-99 18:04:20
  To: All                                               04-Sep-99 05:58:09
Subj: IBM Works - graphics printing problem

From: [e-mail]

I finally got around to try printing a document with and imbeded
graphic and only the text was printed.  I tried the samples that come
with IBM Works and none of them printed either.

I'm using an HP Deskjet 855C printer with the driver from the OMNI
printer drivers.

Has anyone had success doing this? (Is anyone else still using IBM
Works...?)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: bright.net Ohio (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              03-Sep-99 14:41:19
  To: All                                               04-Sep-99 05:58:09
Subj: New news about Windowz

From: alex <[e-mail]>

http://www.techweb.com/wire/story/TWB19990903S0014

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IgLou Internet Services, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                     03-Sep-99 14:45:12
  To: All                                               04-Sep-99 05:58:09
Subj: Warp4 colors 16 To???

From: [e-mail] (ALDEL)

I am using Os2/v4 on a Pentium 11 with
a 4 meg video card, & 15 inch svga monitor.
The best display color setting I can get is 640-480-16.
I want to get  256 colors instead of 16.
I changed the Vga setting to svga via install.
That locks the computer!
I had os2 vers 3 for some yrs and used the svga
setting on the install util. it worked fine
I could get 256 color display or what ever I needed.
When I do this with Warp 4, the computer locks up.
I tried all I can think of but nothing works.
The comp locks and I have to Alt & F1 -F3
to get it working again.
How can I change 16 color setting to 256 and survive???.
Help much appreciated.
TIA.
It took 82 yrs to get this dumb.
Albert.



--
-----------------------------------------------------------
[e-mail] (ALDEL)
-----------------------------------------------------------

--
-----------------------------------------------------------
[e-mail] (ALDEL)
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                     03-Sep-99 19:43:24
  To: All                                               04-Sep-99 05:58:09
Subj: Re: fixpaks on CDROM

From: "Trevor Hemsley" <[e-mail]>

On 2 Sep 1999 21:51:30 GMT, Peter Stein wrote:

->A much more elegant way would be a utility that generates a
->burnable ISO image from the downloadable fixpak files, in other
->words a utility that automates the image creation so that the
->user only needs to download, run utility, and burn CD. I guess
->it shouldn't be too difficult to write something like this.
->Anyway, I've decided to punt and buy the $15 fixpak CD from
->bmtmicro.

Sounds like you want mkisofs and cdrecord/2. Search Altavista using
cdrecord/2 as a keyword and find its homepage. All software you require
will be linked from there.


Trevor Hemsley, London, UK
([e-mail] or [e-mail])



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               03-Sep-99 21:17:01
  To: All                                               04-Sep-99 05:58:10
Subj: Re: the future of os/2

From: "Cornelis Bockem?hl" <[e-mail]>

On Fri, 03 Sep 1999 01:13:05 +0200, Martin Nisshagen wrote:

[...]
>You never need to take down every application as soon as you quit for the day
>and have to restart everything the next morning (wait for OS to load, log in,
>start all 10 apps, load all the work data and other things in them, find the
>point you last worked with before you quit, etc, etc).
>
>You save time.
[...]

That's exactly what I do with APM/2: I always leave all my
applications open and go into standby mode. When I come back,
everything is like I left it within less than 5 seconds!

I must admit that I don't know how well APM works on many desktop
computers(??!)

Greetings,
Cornelis Bockemühl
--------------------------------------------
Cornelis Bockemühl, Dornach, Switzerland
e-mail: cbockem AT datacomm DOT ch
(use this instead of antispam reply address)
PGP public key available



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DataComm (Schweiz) AG (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                03-Sep-99 14:38:28
  To: All                                               04-Sep-99 05:58:10
Subj: Re: Warp4 colors 16 To???

From: Dale Erwin <[e-mail]>

ALDEL wrote:
>
> I am using Os2/v4 on a Pentium 11 with
> a 4 meg video card, & 15 inch svga monitor.
> The best display color setting I can get is 640-480-16.
> I want to get  256 colors instead of 16.
> I changed the Vga setting to svga via install.
> That locks the computer!
> I had os2 vers 3 for some yrs and used the svga
> setting on the install util. it worked fine
> I could get 256 color display or what ever I needed.
> When I do this with Warp 4, the computer locks up.
> I tried all I can think of but nothing works.
> The comp locks and I have to Alt & F1 -F3
> to get it working again.
> How can I change 16 color setting to 256 and survive???.
> Help much appreciated.
> TIA.
> It took 82 yrs to get this dumb.
> Albert.
>

What chipset does your video card use?
--
Dale Erwin
3624 Coral Gables Drive
Dallas, Texas 75229-2619
[phone]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Erwin Technology Corporation (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   03-Sep-99 15:39:10
  To: All                                               04-Sep-99 05:58:10
Subj: Re: Problem formating workstation previous installed with OS/2

From: Dave Critelli <[e-mail]>

Strange?  Did MS tell you that?  I've converted a few machines from
Warp4 to 95 and have never had any problem like the one you state.
However you may want to fdisk the drive, delete the Warp partition, exit
fdisk, reboot and recreate the partition.  This starts you with a
(really) clean slate.

Happy Hack'n
Dave

[e-mail] wrote:

> I have an IBM  workstation previous installed
> with OS/2 Warp. It has now been cleaned
> (partitioned and formatet) in order to install
> Windows98. When used with Win98 we get this error
> when we choose START/PROGRAMS that half of the
> programs has disappeared!
> I have got some information telling me that the
> problem is that the pc has previous been
> formattet to and installed with OS/2. That OS/2
> "makes" a "track -1" on the HD and that I have to
> format the HD with a special program to get rid
> of the "track -1"  before I install windows.
> Can anyone confirm thes informations and do
> anyone know what program I have to use to do a
> proper format ?
>
> Regards,
> Knud Andreassen
> Denmark, Scandinavia
>
> Sent via Deja.com http://www.deja.com/
> Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Insulated Wire Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           03-Sep-99 19:54:02
  To: All                                               04-Sep-99 05:58:10
Subj: Re: Warp4 colors 16 To???

From: [e-mail] (Lorne Sunley)

On Fri, 3 Sep 1999 18:45:25, [e-mail] (ALDEL) wrote:

> I am using Os2/v4 on a Pentium 11 with
> a 4 meg video card, & 15 inch svga monitor.
> The best display color setting I can get is 640-480-16.
> I want to get  256 colors instead of 16.
> I changed the Vga setting to svga via install.
> That locks the computer!
> I had os2 vers 3 for some yrs and used the svga
> setting on the install util. it worked fine
> I could get 256 color display or what ever I needed.
> When I do this with Warp 4, the computer locks up.
> I tried all I can think of but nothing works.
> The comp locks and I have to Alt & F1 -F3
> to get it working again.
> How can I change 16 color setting to 256 and survive???.
> Help much appreciated.
> TIA.
> It took 82 yrs to get this dumb.
> Albert.
>

What kind of 4 meg video card is it???????

Video cards need special drivers (usually provided
by the card manufacturers) to allow a display
of more than 640X480 with 16 colours.

The IBM GRADD drivers will provide higher resolution
and more colours if you use the GENGRADD driver.
However, the best performance using the card requires
a video driver specific to the card.

Lorne Sunley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             03-Sep-99 16:02:00
  To: All                                               04-Sep-99 05:58:10
Subj: Re: Problem formating workstation previous installed with OS/2

From: Alan Beagley <[e-mail]>

Sounds very strange to me.

I guess you could try booting from the OS/2 installation floppies or
utility disks, then at an OS/2 command prompt type

    FDISK /NEWMBR <enter>

or from a DOS boot disk type

    FDISK /MBR <enter>

Alan

[e-mail] wrote:

> I have an IBM  workstation previous installed
> with OS/2 Warp. It has now been cleaned
> (partitioned and formatet) in order to install
> Windows98. When used with Win98 we get this error
> when we choose START/PROGRAMS that half of the
> programs has disappeared!
> I have got some information telling me that the
> problem is that the pc has previous been
> formattet to and installed with OS/2. That OS/2
> "makes" a "track -1" on the HD and that I have to
> format the HD with a special program to get rid
> of the "track -1"  before I install windows.
> Can anyone confirm thes informations and do
> anyone know what program I have to use to do a
> proper format ?
>
> Regards,
> Knud Andreassen
> Denmark, Scandinavia
>
> Sent via Deja.com http://www.deja.com/
> Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            03-Sep-99 19:09:08
  To: All                                               04-Sep-99 05:58:10
Subj: Re: Fixpacks for Dummies (bug)

From: Irv Spalten <[e-mail]>

Note sure what is being asked, but I will ask that for any questions,
see the READ.ME file that comes with the FIXTOOL.

About the COMMIT problem, this is documented in the FT 1.40 and 1.41
READ.ME.

---------

  Changes Made in Version 1.40

   - Fixes a commit problem introduced with FixTool 1.38. If you
     committed an OS/2 base FixPak with Version 1.38 or 1.39, you
     cannot install subsequent FixPaks without reverting to a
     SYSLEVEL.OS2 file used prior to the commit (you can use the
     SYSLEVEL.OS2 that was shipped with the product from the product
     diskettes/CD).

     After you had done a commit, applied a FP to the committed base,
     and then either restored from the commit Archive or backed out an
     installed FP, the fact that the base was at a specific FixPak
     level was lost. The FixTool will now create in OS2\INSTALL a file
     named FPCOMMIT.OS2 to hold the base committed SYSLEVEL. This will
     be restored to SYSLEVEL.OS2 during either of these 2 restore
     activities. Do not erase this file.

-------

All stuff is documented in the README.INF as well, that is the older
file that tells you how to use the FixTool to do such things as backing
out and commiting as well as applying FP's. Look there too.

If that isn't usefull, try URL
http://ps.software.ibm.com/pbin-usa-ps/getobj.pl?/pdocs-usa/fp.html,
which I got originally from Frank McKinney and altered to be upto date
more (still a little backlevel). For BACKING OUT a FP, see URL
http://ps.software.ibm.com/pbin-usa-ps/getobj.pl?/pdocs-usa/fp.html#tag18
specifically. That should answer all questions.

Irv

Joe Kovacs wrote:
>
> Good post.  Thank you very much.
>
> Irv Spalten is owner of fixpacks, we welcome his
> participation here, and the bug is his now to fix.
>
> He has said 'If using SERVICE.EXE, you need to use the
> ADVANCED funtions', meaning the SERVICE.EXE and commit work.
> I wish he'd comment here.  For starters, I don't see any
> 'ADVANCED'.
>
> Joe Kovacs
> Guelph Ontario Canada
>
> In <244526693620218630867678@mwc>, Michael W. Cocke <[e-mail]> writes:
> >On Sun, 29 Aug 1999 20:43:10 GMT, Joe Kovacs wrote:
> >
> >>In <c1.2b8.2S0Tfd$[e-mail]>, [e-mail]   (Joe Kovacs)
writes:
> >>
> >>>The old fileswhich are replaced are stored in a directory with
> >>>the archive bit set so you can't delete them
> >>>straightforwardly, all 10 or 50 or so MB of them.
> >>>
> >>>When you commit, the commit process brings all the syslevel
> >>>entries up to date and takes off the archive bits on those
> >>>files, so you can DEL C:\Archive\*.*
> >>
> >>Correction.  It _doesn't take the archive bit off those files.
> >>Now I don't know what the official thing to do is, to delete
> >>those things after a successful commit.
> >>
> >>Are we supposed to run ATTRIB and DEL or what?
> >>
> >>
> >>Joe Kovacs
> >>Guelph Ontario Canada
> >>
> >>
> >cd \archive (or whatever)
> >attrib -r -s
> >del *.*
> >
> >
> >BTW, the 'commit' facility in most recent CSF sets is broken - this is
> >the only way to 'commit' to a service level since 1.38 or so.  It was
> >documented in a readme that came with a CSF set - which one, I have no
> >idea.  Note that I think it's just the commit button that's busted -
> >response file commit may still work.  If you use this method to commit
> >to a service level, the next time you install a fixpack, you'll have to
> >go thru the process documented in the fixpack readme for "No files to
> >service".  I've been doing it that way since fixpack 3 or so, no
> >problems.
> >
> >Easier than inserting a CD-ROM from MS into your Windows box and praying
> >it sees the hardware that you really have and nothing else...  (long,
> >grim, story skipped)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    03-Sep-99 20:11:19
  To: All                                               04-Sep-99 05:58:10
Subj: Re: IBM Works - graphics printing problem

From: [e-mail] (John Hong)

[e-mail] wrote:
: I finally got around to try printing a document with and imbeded
: graphic and only the text was printed.  I tried the samples that come
: with IBM Works and none of them printed either.

    The only way I was able to get the images printed out was if the
settings for the printer setup to be maxed out at printer mode.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    03-Sep-99 20:57:09
  To: All                                               04-Sep-99 05:58:10
Subj: Re: Clobbering an old install to get HPFS?

From: [e-mail] (Bob Eager)

On Fri, 3 Sep 1999 02:56:00, [e-mail] (Paul Neubauer)
wrote:

> The hard drive I'm using had Win95 on it and I thought
> an install of OS/2 with me using fdisk, and then
> specifying HPFS would have eliminated that.
> Instead, and I do no pretend to understand, it seems to
> have bailed on HPFS, went (kept?) FAT16 and preserved
> what win95 files there were.

At some point it must have failed to present you with the right
option....or you didn't take it!

My approach, IF reinstalling (see below) would be to boot the install
disks and press F3 when it says you can (at the bottom of the screen)
to get a command prompt. Then re-FDISK. Reboot the same way again and
reformat partitions as required. Reboot again to do the install.
Overkill I know...

> How do I get this drive to be HPFS?  And I expect to
> end up doing a full reinstall - I've backup up what
> I think I really need to.

Got (or can get) PartitionMagic? It'll convert the FAT to HPFS......IN
SITU!

--
Bob Eager
rde at tavi.co.uk
PC Server 325; PS/2s 8595*3, 9595*3 (2*P60 + P90), 8535, 8570, 9556*2,
8580*6,
8557*2, 8550, 9577, 8530, P70, PC/AT..

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tavi Systems (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    03-Sep-99 20:57:10
  To: All                                               04-Sep-99 05:58:10
Subj: Re: JAVA help

From: [e-mail] (Bob Eager)

On Wed, 1 Sep 1999 23:12:11, Clinton <[e-mail]> wrote:

> I know this has been asked before, probably by me as well, but again, I
> can't goto any web page with java on it.  I'm running Netscape 2.02 and
> java 1.1.8.  If I goto a page with java, Netscape freezes solid and the
> only way to recover is Ctrl,Alt,Del.  Here is a copy of my config.sys
> file, I bet the problem is in there, but I can't find it..

I found it just needed a bit of shuffling. But first....have you
selected the right Java version (via 'Java version selection....' in
the Netscape folder)?

If that (and a reboot) didn't work, go to the Netscape directory.
Type:

     JCONFIG B J:

where B is the boot drive letter and J is the letter of the drive with
Java on it. Note the colon on the second drive letter and NOT on the
first. Reboot.

--
Bob Eager
rde at tavi.co.uk
PC Server 325; PS/2s 8595*3, 9595*3 (2*P60 + P90), 8535, 8570, 9556*2,
8580*6,
8557*2, 8550, 9577, 8530, P70, PC/AT..

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Tavi Systems (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          03-Sep-99 20:01:26
  To: All                                               04-Sep-99 05:58:10
Subj: Re: fixpaks on CDROM

From: [e-mail] (Andrew Stephenson)

In article <37cf0961$1$ofgrcuna$[e-mail]>
       [e-mail]  writes:

> [...]  I believe WarpUP! from IB is more automated. It will tell
> you what on your system needs to be updated, and will install
> updates by clicking on a selection. Duane there has done quite a
> nice job of it.

Seconded.  WarpUP! is very slick, though I was disconcerted (and
somewhat inconvenienced) by it demanding the use of WebExplorer,
instead of my system's installed Netscape Navigator.
--
Andrew Stephenson

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DNS (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                        03-Sep-99 17:48:18
  To: All                                               04-Sep-99 11:08:13
Subj: Re: fixpaks on CDROM

From: [e-mail] (Richard Bumby)

[e-mail] (Peter Stein) writes:

>In article <37ceb4c5$2$ofgrcuna$[e-mail]>,
> <[e-mail]> wrote:
>>The fixpaks on CD-ROM are so inexpensive from BMT Micro and
>>Indelible Blue that it is not worth the effort to do it oneself.

>Thanks to everyone for the tips. Unfortunately neither of these
>sources has any statement indicating that the fixpak can be
>directly applied from the CD. It seems obvious that one ought
>to be able to do that, but who knows. ...

On my Warp 4 system, I applied fixpack 5 from the BMT CD and fp 10
from WarpUp.  In both cases, applying the fixpack was as simple as
saying "yes" to a screen that said something like, "Here is the
fixpack, do you want to install it now?"

WarpUp also contains an automated system for updating an array of
features.
--
R. T. Bumby **  Rutgers Math || Amer. Math. Monthly Problems Editor 1992--1996
[e-mail]       ||
Telephone:    [USA] 732-445-0277 (full-time message line) FAX [phone]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Rutgers University LCSR (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              03-Sep-99 22:07:17
  To: All                                               04-Sep-99 11:08:13
Subj: Re: fixpaks on CDROM

From: [e-mail] (Peter Stein)

In article <[e-mail]>,
Andrew Stephenson <[e-mail]> wrote:
>In article <37cf0961$1$ofgrcuna$[e-mail]>
>       [e-mail]  writes:
>
>> [...]  I believe WarpUP! from IB is more automated. It will tell
>> you what on your system needs to be updated, and will install
>> updates by clicking on a selection. Duane there has done quite a
>> nice job of it.
>
>Seconded.  WarpUP! is very slick, though I was disconcerted (and
>somewhat inconvenienced) by it demanding the use of WebExplorer,
>instead of my system's installed Netscape Navigator.

I'm missing something here. Why would you need either? Everything
should be on the CD so there's no need for dialup. I can't imagine
what the benefit would be of making the usual fixpak text available
in html. So what is the reason for needing a browser?

Peter Stein
[e-mail]

>--
>Andrew Stephenson
>


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Suburban Robots That Monitor Reality (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              03-Sep-99 22:23:02
  To: All                                               04-Sep-99 11:08:13
Subj: NS/2 4.04 is driving me crazy!

From: [e-mail] (Thomas Nagy)

This problem with NS/2 is getting worse and although I am a long time
OS/2 user, I cannot figure out what's wrong. It could be an OS/2 problem
but since it happens to NS/2 ONLY, I have my doubts. Here is the problem:

While using NS/2, every 1-2 minutes, the whole system stops for 10-15
seconds: the clock does not progress, the mouse shows 'busy' and I cannot
do anything. If I happen to click the mouse twice during this time, after the
10-15 seconds the window list comes up to make things more frustrating.
There is a heavy disk activity during this time.

I know that others have experienced the other problem I have with NS/2,
namely, the system is basically 'hung' for several seconds (or a few
minutes, if you use NS/2 for a longer period of time) after you close NS/2.
I bet that this is related to the problem above.

None of this happens with NS/2 2.02. I thought that it could be some java
problem and tried to play with the parameters -noasyncgc -noclassgc
and -nojit but this has no effect. Also tried various disk and memory cache
settings with no positive effects at all.

I am at the limit of my patience. WTF is wrong?
Please reply if you have a clue. Thank you.

Thomas Nagy
-----------------------------------------------------------------
Check out my cats! (http://members.home.net/2832779232/index.htm)
Free Office Suite: http://www.stardivision.com/so40/index.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Adequate (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]               03-Sep-99 22:52:21
  To: All                                               04-Sep-99 11:08:13
Subj: Re: Clobbering an old install to get HPFS?

From: "Jan Danielsson" <[e-mail]>

>> The hard drive I'm using had Win95 on it and I thought
>> an install of OS/2 with me using fdisk, and then
>> specifying HPFS would have eliminated that.
>> Instead, and I do no pretend to understand, it seems to
>> have bailed on HPFS, went (kept?) FAT16 and preserved
>> what win95 files there were.
>
>At some point it must have failed to present you with the right
>option....or you didn't take it!

Actually, he probably did it all right.

You will not belive it unless you see it. Choosing HPFS, viewing it format
HPFS, installing the system, and repeating that same procedure a couple of
times may still result in an OS/2 FAT installation.

What I thought would be a 30 minute install turned out to take over four
hours. I had to search the net for all kinds of high tech utilities for
simply deleting partitions. Someone said "delpart is designed to solve
problems just like the one you are having; when delpart failed, I almost gave
up. But I tried a couple of different fdisk's from various operatingsystems
and different high-tech gimmicks. And somewhere within that timeframe (four
hours) I managed to delete the partition.


Please note that I have fixed corrupted partitions with a sectoreditor. I had
to rebuild parts of a FAT 'by hand', a trying exersize, which I won't want to
do again. In other words - I do have some basic knowledge of how the
partitiontables and such. However, the 'HPFS formatted drives turn out FAT if
previously Microsoft system' is beyond my understanding.

>My approach, IF reinstalling (see below) would be to boot the install
>disks and press F3 when it says you can (at the bottom of the screen)
>to get a command prompt. Then re-FDISK. Reboot the same way again and
>reformat partitions as required. Reboot again to do the install.
>Overkill I know...

Actually, that didn't work. It wasn't like during the installation format
(which seemed to work ok), it did present an error message, can't recall what
though....


I have seen that problem a couple of times, but one comes to mind..

A friend of mine got bored of Windows acting up on him, so he wanted to try
OS/2. And so he did.
This was - by the way - the time I fought with the partition for hours..
During the install, the installation program presents which objects are being
created. My friend sat and read the URL object titles out loud (I guess he
though it was funny, is some manner). When I _finally_ managed to format the
partition HPFS, he said 'hey, I don't have time to read the titles this
time.. What have you done?'.

Case against FAT......


 /j



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telia Internet (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              03-Sep-99 15:54:08
  To: All                                               04-Sep-99 11:08:14
Subj: Re: JAVA help

From: Clinton <[e-mail]>

Bob Eager wrote:
> If that (and a reboot) didn't work, go to the Netscape directory.
> Type:
>
>      JCONFIG B J:

That gave me a error, can't find jconfig or whatever... So, I
uninstalled Java then reinstalled it.  So far, so good :)

--
 Kill the MAI
---
Remove _nospam_ to reply

Clinton Peebles  VE7KNL  DN19ie
Salmo, B.C. Canada
E-Mail: [e-mail]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      03-Sep-99 18:23:23
  To: All                                               04-Sep-99 11:08:14
Subj: Re: OS/2 look alike Window Managers

From: [e-mail]      (John Thompson)

In <jPQz3.1759$[e-mail]>, [e-mail]
(Alex Taylor) writes:

>> I also have a similar quest.  But I'm after WPS functionality rather
>> than looks.  No flames please, but I think the WPS *looks* rather
>> dated.  I have OD 1.5 which changes the standard buttons and adds
>> more, but comparing the appearance of OS/2 with, say Enlightenment or
>> AfterStep it looks rather old.

>Lousy fonts and an inability to antialias anything will do that...
>Fixing those would go miles to improve the WPS desktop's image.

Except X also lacks antialiasing and pretty fonts.  Using
Truetype fonts under X improves things a little, but the lack of
antialiasing still shows.

>> But what exactly do others regard as the functionality of WPS?
>
>Alas, there's not much out there.  Every WM I've seen seems to
>prefer the Windows, Macintosh, or NextStep feel.
>
>Closest I came was running DFM (desktop file manager) under icewm,
>and customizing it fairly extensively.
>
>Icewm is the only WM I know of which actually does cascading menus
>like OS/2 (actually, better), instead of like Windows.  It still
>uses Win-like mouse bindings, alas...

Hmm.  Can't you change the mouse bindings?  I haven't really
spent much time with icewm, but I'd be surprised if there wasn't
a way to do it.  That's part of the underlying X functionality.

-John ([e-mail])

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail] [Ron]                      03-Sep-99 16:15:04
  To: All                                               04-Sep-99 11:08:14
Subj: Moving OS/2

From: [e-mail] [Ron]

I would like to move my OS/2 installation from a C: Primary partition
to a D: Logical partition. Other than reinstalling or restoring from
the backup tape (which would make it non-bootable) is there any way
to do that? I can handle the boot manager setup and manual config.sys
changes. Is there any way to copy the desktop, ini files and so on, so
that everything points from D: instead of C:? Reinstalling OS/2 is
not such a big deal, it's reinstalling all the software apps (on E:)
just to get the desktop right that would take days.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Concentric Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      04-Sep-99 01:22:07
  To: All                                               04-Sep-99 11:08:14
Subj: Re: the future of os/2

From: Martin Nisshagen <[e-mail]>

Cornelis Bockemhl [DataComm (Schweiz) AG] -> comp.os.os2.misc:

» That's exactly what I do with APM/2: I always leave all my
» applications open and go into standby mode. When I come back,
» everything is like I left it within less than 5 seconds!
»
» I must admit that I don't know how well APM works on many desktop
» computers(??!)

I don't know. My notebook supports APM, but my new desktop supports ACPI.

Best regards,

m a r t i n | n

--
Martin Nisshagen                  PGP 6.0: 0x45D423AC         K R A F T W E R
K
CS/CE, Chalmers, Sweden           ICQ UIN: 689662             2x 300A @ 450
MHz
d4nisse-at-dtek-chalmers-se       http://go.to/martin_n       http://zap.to/kw

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Chalmers University of Technology, Sweden (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                     03-Sep-99 23:25:14
  To: All                                               04-Sep-99 11:08:14
Subj: Re: NS/2 4.04 is driving me crazy!

From: "David D. Huff Jr." <[e-mail]>

I have posted many times about this problem and never got the
solution. I have done everything that was ever suggested.
It has just happened again. It probably uncached for about 8-9 seconds.
Freezes my system. If you ever get the answer please write me direct.
I have taken everything out of my system that I can. But NS4.04
still causes the problem. I'd have finished this but it froze again.
I am using Aurora 196MB RAM, 10gig IBMide hard drive on
Cyrix MII 300 chip. I do have a SCSI card and SIS chipsets with
2 JFS partitions but no partitions over 4Gig. And it just gets worse
until the system is booted. Which is bad for a webhost to boot the
system because of this. Ditto this help request! Any suggestions out there?

Thomas Nagy wrote:

> This problem with NS/2 is getting worse and although I am a long time
> OS/2 user, I cannot figure out what's wrong. It could be an OS/2 problem
> but since it happens to NS/2 ONLY, I have my doubts. Here is the problem:
>
> While using NS/2, every 1-2 minutes, the whole system stops for 10-15
> seconds: the clock does not progress, the mouse shows 'busy' and I cannot
> do anything. If I happen to click the mouse twice during this time, after
the
> 10-15 seconds the window list comes up to make things more frustrating.
> There is a heavy disk activity during this time.
>
> I know that others have experienced the other problem I have with NS/2,
> namely, the system is basically 'hung' for several seconds (or a few
> minutes, if you use NS/2 for a longer period of time) after you close NS/2.
> I bet that this is related to the problem above.
>
> None of this happens with NS/2 2.02. I thought that it could be some java
> problem and tried to play with the parameters -noasyncgc -noclassgc
> and -nojit but this has no effect. Also tried various disk and memory cache
> settings with no positive effects at all.
>
> I am at the limit of my patience. WTF is wrong?
> Please reply if you have a clue. Thank you.
>
> Thomas Nagy
> -----------------------------------------------------------------
> Check out my cats! (http://members.home.net/2832779232/index.htm)
> Free Office Suite: http://www.stardivision.com/so40/index.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                03-Sep-99 19:49:21
  To: All                                               04-Sep-99 11:08:14
Subj: Re: NS/2 4.04 is driving me crazy!

From: [e-mail]

"David D. Huff Jr." <[e-mail]> said:

>And it just gets worse
>until the system is booted. Which is bad for a webhost to boot the
>system because of this. Ditto this help request! Any suggestions out
>there?

I think this is being addressed or has been.  At least on the NS4OS2
mailing list there has been similar discussions and they sounded
positive.  I didn't pay that much attention because my own bugs were
in a different area.  But it seems like it has been mentioned in
regard to the gamma release.

Jim L
Remove XX from address to Email
More gun laws will cure the nations ills - just like drug laws do.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          03-Sep-99 23:51:11
  To: All                                               04-Sep-99 11:08:14
Subj: Re: fixpaks on CDROM

From: [e-mail] (Andrew Stephenson)

In article <7qpgr6$dpt$[e-mail]>
       [e-mail] "Peter Stein" writes:

> In article <[e-mail]>,
> Andrew Stephenson <[e-mail]> wrote:
> >
> >[...]  WarpUP! is very slick, though I was disconcerted (and
> >somewhat inconvenienced) by it demanding the use of WebExplorer,
> >instead of my system's installed Netscape Navigator.
>
> I'm missing something here. Why would you need either? Everything
> should be on the CD so there's no need for dialup. I can't imagine
> what the benefit would be of making the usual fixpak text available
> in html. So what is the reason for needing a browser?

I don't know why it wanted WebEx (especially as I have just been
back to it, to research this answer, and found it seemed willing
to use Netscape) but HTML is its medium for handling (a) menus &c
and (b) message pages created on-the-fly during work.  There's no
dialup, BTW.
--
Andrew Stephenson

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DNS (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          04-Sep-99 00:03:26
  To: All                                               04-Sep-99 11:08:14
Subj: Re: IBM Works - graphics printing problem

From: [e-mail]

In <Z4Uz3.54$[e-mail]>, [e-mail] writes:
>I finally got around to try printing a document with and imbeded
>graphic and only the text was printed.  I tried the samples that come
>with IBM Works and none of them printed either.
>
>I'm using an HP Deskjet 855C printer with the driver from the OMNI
>printer drivers.
>
>Has anyone had success doing this? (Is anyone else still using IBM
>Works...?)
I routinely print graphics form IBM Works word processor portion, and have had

little trouble.  I am printing to an HP682C with the omni.drv.  I downloaded
the most
recent version when I got the printer Several years ago.

I have noticed that some times when you bring a graphic into IBM Works, it
some
times disapears and acts as you describe.   This is about a 1 in 100 occurance

from my experience.

e-mail me if you have additional questions and we can compare settings.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               04-Sep-99 02:10:19
  To: All                                               04-Sep-99 11:08:14
Subj: Re: NS/2 4.04 is driving me crazy!

From: Willy Steger <[e-mail]>

Hi Thomas,

Thomas Nagy wrote:
>
>
> I know that others have experienced the other problem I have with NS/2,
> namely, the system is basically 'hung' for several seconds (or a few
> minutes, if you use NS/2 for a longer period of time) after you close NS/2.
> I bet that this is related to the problem above.
>
> None of this happens with NS/2 2.02. I thought that it could be some java
> problem and tried to play with the parameters -noasyncgc -noclassgc
> and -nojit but this has no effect. Also tried various disk and memory cache
> settings with no positive effects at all.

I solved this problem by deinstalling both NS 2.02 and NS 4.04, cleaning
config.sys and *.ini, prior to installing NS 4.61b.

Willy

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: LF.net GmbH, Stuttgart, Germany (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                 03-Sep-99 20:27:13
  To: All                                               04-Sep-99 11:08:14
Subj: Re: Moving OS/2

From: [e-mail] (Raphael Tennenbaum)

[e-mail] [Ron] wrote:

>I would like to move my OS/2 installation from a C: Primary partition
>to a D: Logical partition. Other than reinstalling or restoring from
>the backup tape (which would make it non-bootable) is there any way
>to do that?

The short answer is, no.  The system files will transfer and
boot, but there's really no way to move your desktop over --
theoretically it's possible but it would be more trouble
than rebuilding your desktop (and in fact I've never hard of
anyone managing it successfully).

I can handle the boot manager setup and manual config.sys
>changes. Is there any way to copy the desktop, ini files and so on, so
>that everything points from D: instead of C:? Reinstalling OS/2 is
>not such a big deal, it's reinstalling all the software apps (on E:)
>just to get the desktop right that would take days.

What you might consider, if you really don't wish to rebuild
your desktop, is changing your new configuration so that
you'll in fact be moving to another C: primary.  If you're
moving stuff or putting in new drives for Windoze, you're
probably better off keeping that all on its own primary
anyway -- which, when booted, would be C:.  If OS/2 were on
its own primary, the Windoze partition would be invisible
(i.e., inaccessible) and your OS/2 boot partition would then
be C:  The disadvantage (if it is one) is that logical
partitions are blind to other logical partitions.  But you
can install a logical FAT drive should you feel the need to
share files across both OSes.

Otherwise, you're better off rebuilding your desktop from
scratch.  (Takes less time than you imagine!)  There are
tools which will help: Henk Kelder's WPTOOLs will back up
your current desktop to a textfile listing all your program
objects in a way that makes it a bit easier.

--
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             03-Sep-99 17:36:10
  To: All                                               04-Sep-99 11:08:14
Subj: Re: Warp4 colors 16 To???

From: [e-mail]

In <37d01793$2$nyqry$[e-mail]>, on 09/03/99
   at 02:45 PM, [e-mail] (ALDEL) said:

>How can I change 16 color setting to 256 and survive???.

System setup->System->Screen settings. There may be two pages that
have to be looked at.

--
-----------------------------------------------------------
Bob Stephan [e-mail] or [e-mail]
  Happily using OS/2 Warp on the Central California Coast.
   http://www.redshift.com/~bstephan
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             03-Sep-99 17:33:19
  To: All                                               04-Sep-99 11:08:14
Subj: Re: fixpaks on CDROM

From: [e-mail]

In <7qpgr6$dpt$[e-mail]>, on 09/03/99
   at 10:07 PM, [e-mail] (Peter Stein) said:

>I'm missing something here. Why would you need either? Everything
>should be on the CD so there's no need for dialup. I can't imagine
>what the benefit would be of making the usual fixpak text available
>in html. So what is the reason for needing a browser?

Peter Stein

The REXX interface for navigating the CD uses the browser.

--
-----------------------------------------------------------
Bob Stephan [e-mail] or [e-mail]
  Happily using OS/2 Warp on the Central California Coast.
   http://www.redshift.com/~bstephan
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      04-Sep-99 02:31:13
  To: All                                               04-Sep-99 11:08:14
Subj: Re: Important News From Dan Porter of Innoval

From: [e-mail] (Dr. Peter Gegenheimer)

On Mon, 30 Aug 1999 05:37:44, [e-mail] (Steven C. Den Beste) wrote:

τ How about more intelligent filtering? (Agent lets me use regular expressions
τ on the subject line, but I'd like to be able to filter on the contents of a
τ message, so that anything which contains the phrase "MLM" goes straight into
τ the trash bin.) Automated responses to messages? ("I'm on vacation right
τ now, but I'll get back to you in two weeks.")
τ

Guess What?  Post Road Mailer 3.0 lets you do both of those things. Trivially.

(It also can pull only your mail from a shared ISP account, which I need.)

o----------------------------------------------------------------------o
| Dr. Peter Gegenheimer       | Vox: 785-864-3939  FAX: [phone]   |
| Department of               |   [e-mail]              |
|   Molecular Biosciences     |   http://rnaworld.bio.ukans.edu/       |
|   & Dept. Evol Biology      |                                        |
| University of Kansas        |"When you have excluded the impossible, |
| 2045 Haworth Hall           |  whatever remains, however improbable, |
| Lawrence  KS  66045-2106    |  must be the truth."      S. Holmes    |
o_____________________________|________________________________________o

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Univ. Kansas (BCMB) (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                     04-Sep-99 04:10:21
  To: All                                               04-Sep-99 11:08:14
Subj: Re: NS/2 4.04 is driving me crazy!

From: "David D. Huff Jr." <[e-mail]>

I just found the solution to my problem. The netscape.hst file had grown over
5 Mb and that was it. I renamed the history file and set the file to 0 in the
preferences
and that was all it took. Darn I wasted several evenings trying to find
the problem. What a pisser who'd of thought that NS did forced writes
to the hard drive for the damn history file!?! Well the mystery is solved.
Hope this cures your woes as well.
Dave


Thomas Nagy wrote:

> This problem with NS/2 is getting worse and although I am a long time
> OS/2 user, I cannot figure out what's wrong. It could be an OS/2 problem
> but since it happens to NS/2 ONLY, I have my doubts. Here is the problem:
>
> While using NS/2, every 1-2 minutes, the whole system stops for 10-15
> seconds: the clock does not progress, the mouse shows 'busy' and I cannot
> do anything. If I happen to click the mouse twice during this time, after
the
> 10-15 seconds the window list comes up to make things more frustrating.
> There is a heavy disk activity during this time.
>
> I know that others have experienced the other problem I have with NS/2,
> namely, the system is basically 'hung' for several seconds (or a few
> minutes, if you use NS/2 for a longer period of time) after you close NS/2.
> I bet that this is related to the problem above.
>
> None of this happens with NS/2 2.02. I thought that it could be some java
> problem and tried to play with the parameters -noasyncgc -noclassgc
> and -nojit but this has no effect. Also tried various disk and memory cache
> settings with no positive effects at all.
>
> I am at the limit of my patience. WTF is wrong?
> Please reply if you have a clue. Thank you.
>
> Thomas Nagy
> -----------------------------------------------------------------
> Check out my cats! (http://members.home.net/2832779232/index.htm)
> Free Office Suite: http://www.stardivision.com/so40/index.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                04-Sep-99 00:37:01
  To: All                                               04-Sep-99 11:08:14
Subj: Re: NS/2 4.04 is driving me crazy!

From: [e-mail]

"David D. Huff Jr." <[e-mail]> said:
>I just found the solution to my problem. The netscape.hst file had
>grown over 5 Mb and that was it.

AHA!  I think that silly history thing has messed up a lot of folks.
You need to set a shorter deletion time in preferences.  I have mine
set at 3 days and it still gets pretty big sometimes.  Guess I'll set
it to 2 days.

Jim L
Remove XX from address to Email
More gun laws will cure the nations ills - just like drug laws do.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              04-Sep-99 04:56:03
  To: All                                               04-Sep-99 11:08:14
Subj: Re: NS/2 4.04 is driving me crazy!

From: [e-mail] (Thomas Nagy)

"David D. Huff Jr." <[e-mail]> writes:
>I just found the solution to my problem. The netscape.hst file had grown over
>5 Mb and that was it. I renamed the history file and set the file to 0 in the
>preferences
>and that was all it took. Darn I wasted several evenings trying to find
>the problem. What a pisser who'd of thought that NS did forced writes
>to the hard drive for the damn history file!?! Well the mystery is solved.
>Hope this cures your woes as well.
>Dave

Dave,

You got it! Congratulations and a big THANK YOU!
No more history file for me (at least for a while)!

Thomas Nagy
-----------------------------------------------------------------
Check out my cats! (http://members.home.net/2832779232/index.htm)
Free Office Suite: http://www.stardivision.com/so40/index.html


>Thomas Nagy wrote:
>
>> This problem with NS/2 is getting worse and although I am a long time
>> OS/2 user, I cannot figure out what's wrong. It could be an OS/2 problem
>> but since it happens to NS/2 ONLY, I have my doubts. Here is the problem:
>>
>> While using NS/2, every 1-2 minutes, the whole system stops for 10-15
>> seconds: the clock does not progress, the mouse shows 'busy' and I cannot
>> do anything. If I happen to click the mouse twice during this time, after
the
>> 10-15 seconds the window list comes up to make things more frustrating.
>> There is a heavy disk activity during this time.
>>
>> I know that others have experienced the other problem I have with NS/2,
>> namely, the system is basically 'hung' for several seconds (or a few
>> minutes, if you use NS/2 for a longer period of time) after you close NS/2.
>> I bet that this is related to the problem above.
>>
>> None of this happens with NS/2 2.02. I thought that it could be some java
>> problem and tried to play with the parameters -noasyncgc -noclassgc
>> and -nojit but this has no effect. Also tried various disk and memory cache
>> settings with no positive effects at all.
>>
>> I am at the limit of my patience. WTF is wrong?
>> Please reply if you have a clue. Thank you.
>>
>> Thomas Nagy
>> -----------------------------------------------------------------
>> Check out my cats! (http://members.home.net/2832779232/index.htm)
>> Free Office Suite: http://www.stardivision.com/so40/index.html
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Adequate (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          04-Sep-99 03:30:18
  To: All                                               04-Sep-99 11:08:14
Subj: Re: Clobbering an old install to get HPFS?

From: [e-mail] (Annie K.)

On Fri, 3 Sep 1999 17:24:03, [e-mail] (Paul Neubauer) wrote:

:Just one partition, bootable & installable.  I did use the fdisk to remove
:the partition (or so I thought) and then remake it.

 I'm trying to remember how the installation goes...at some point it asks
you which file system you want to format with, perhaps it defaults to FAT.
I don't know.

 If you want to wipe everything out and start afresh, boot from your
installation floppies, and run FORMAT C: /FS:HPFS

--
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                04-Sep-99 01:30:12
  To: All                                               04-Sep-99 11:08:14
Subj: Re: Printer RAM upgrade.

From: Mr_Zer0 <[e-mail]>

Yes, there is a difference, but no, you don't have to use the more
expensive HP RAM.  Since no one else has directly answered your
question, I suggest you do a search for my past postings on this
subject.  I suggest you purchase the Kingston equivalent for around $45
on the web.

Steve Drewell wrote:
> I have an HP Laserjet 1100 which comes with 2MB RAM as standard. I'd like
> to upgrade the RAM to 10MB or 18MB by adding an 8MB or 16MB dimm. My
> question is this:
>
> Is there any difference, apart from price, between a dimm used in a
> Laserjet 1100 (and sold as a "printer ram upgrade") and a dimm used on a
> standard PC motherboard (and sold as "normal" ram)?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Bookends R Us (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  04-Sep-99 07:55:14
  To: All                                               04-Sep-99 11:08:14
Subj: FrontDoor?!

From: "Landreth" <[e-mail]>

In the good old days of DOS there used to be software that was able to tell
if incoming calls on modems was either data (for BBS) or fax. The software
would then lock the com port to the proper apps. For example running faxworks
and some sort of BBS-software. Is there anyone that might have a slight clue
about where to find such apps for OS2? And the I ofcourse no form of extra
external hardware should be involved!


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: A Customer of Tele2 (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      04-Sep-99 17:44:26
  To: All                                               04-Sep-99 11:08:14
Subj: Post your tips/solutions at os2.org

From: [e-mail] (Khairil Yusof)

If when people solved problems, or figure out a neat trick with OS/2 to take 5

mins and post it at the forums at os2.org.

It would be great also for people to post their results for looking for
compatible hardware for os2 at that site too.

Eg. if you found a scanner/printer/soundcard/cdrw etc. that works great. Post
your results there. Then it would help others too looking for stuff.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Australian National University (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    03-Sep-99 07:30:09
  To: All                                               04-Sep-99 11:08:15
Subj: Re: the future of os/2

From: [e-mail] (James Knott)

In article <37cea44c$2$yvsrqngn$[e-mail]>,
[e-mail] wrote:
>[e-mail] (Terry Fry) said:
>
>>With the current "sleeping" of processors and drives, a machine that
>>has "powered down" can use as little as 5 watts to idle.
>
>How much does a hard drive contribute to that?

If the drive is powered down, none.

--
E-mail [e-mail]
_________________________________________________________________________
The above opinions are my own and not those of ISM Corp., a subsidiary of
IBM Canada Ltd.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           04-Sep-99 10:40:09
  To: All                                               04-Sep-99 11:08:15
Subj: HELP, Install Warp 3.0 Connect

From: "Joao Pissarro" <[e-mail]>

Hello all,

I am installing OS/2 3.0 Connect on a PC with a large disk. I have upgraded
the Disk 1 to the lage disk support driver, and the FDISK problem disapeard.

The installation process goes till the point when the PC should boot from
the hard disk (afer copying all the files from the disquettes and CD-ROM).
On this point the screen remain indefenitly with a blinking cursor on the
top left corner (it just does not boot).

Any ideia to solve this problem?

Thanks

----
Joao Pissarro
Inet.     [e-mail]
Ampr:   [e-mail]
AX25:  [e-mail]


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   04-Sep-99 00:34:28
  To: All                                               04-Sep-99 11:08:15
Subj: Re: AMD K7 Athlon

From: John Twelker <[e-mail]>


Robert Lalla wrote:
>
> On Tue, 31 Aug 1999 20:34:44 GMT, Mark Dodel wrote:
>
> >So unless you have an Intel or Via chipset you are screwed in regards
> >to USB support under OS/2.
>
> You can buy an USB addon pci card containing the VIA VT83C572 chip
> that should be OS/2 compatible (UHCI).
> But avoid addon cards having an OPTI chip (OHCI).
>
> --
> RL

One source for this card is
http://www.jameco.com/Products/USB/default.html

PCI USB Input/Output Card
2 USB Ports
Uses VIA VT83C572 controller
Dual USB port; A series
USB specification V.1.0 compatible
Plug and Play compatible
Win⌐ 95, Win⌐ 98)
USB legacy BIOS supports
icludes user manual
Size: 4.7"L x 2.0"W
Weight: 0.3 lbs.
One year warranty

Part No. 155299 PCI USB Card Ret $39.95 Sale $34.95

*You are advised to call Jameco directly at 1-800-831-4242
between 8:00am and 5:00pm PST and mention VIP#WWW
and request the Internet Special Price.

--
Aloha,

John Twelker
Naish Sails Hawaii, Maui Sales Rep
RaceManPro Windsurfing Software, Co-Developer
http://www.ultranet.com/~lefebvre/RaceManPro/

- - - - - - - - - - - - - - - - - - - - - - - - - - -

After 14 years of Microsoft, now happily running OS/2 Warp 4.0 ... while
we still have a choice.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 04-Sep-99 11:55:00
  To: All                                               04-Sep-99 11:08:15
Subj: What ver of warp for a home dual cpu machine?

From: [e-mail] (Devin)

Hi. I am completely new to warp and woud like to know what is the best
version of warp for a home dual cpu?

As far as networking, I would only need peer to peer networking (to
share files on another home pc) and access to my cable modem via
ethernet. It will not act as a server in any way.

Thank you.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                         04-Sep-99 13:02:03
  To: All                                               04-Sep-99 11:08:15
Subj: Re: Clobbering an old install to get HPFS?

From: [e-mail] (Thorsten H. Niebuhr)

You can change the FS by backup the whole System Partition to a second
Partition:

Create a temporary partition and copy your system partition to it
using xcopy:

xcopy [sysdrive] [temporary drive] /h /o /t /s /e /r /v

then, format your sysdrive with hpfs :

format [sysdrive] /fs:hpfs

after that, xcopy back your sysdrive with the above switches.

at the end, make sure you add the following line to your config.sys:

ifs=[sysdrive]\OS2\HPFS.IFS /CACHE:2048 /CRECL:4 /AUTOCHECK:[sysdrive]

to load the installable file system at startup.

of course, you have to boot with the floppy set and cancel the
installation to command line.
BTW, searching the net for the advancend HPFS, HPFS386, will speed up
things a little bit....

cu/2

thotti


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Citykom Muenster GmbH (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               04-Sep-99 14:19:04
  To: All                                               04-Sep-99 11:08:15
Subj: Re: What ver of warp for a home dual cpu machine?

Message sender: [e-mail]

From: Christian Hennecke <[e-mail]>

Devin schrieb:
>
> Hi. I am completely new to warp and woud like to know what is the best
> version of warp for a home dual cpu?
>
> As far as networking, I would only need peer to peer networking (to
> share files on another home pc) and access to my cable modem via
> ethernet. It will not act as a server in any way.
>
> Thank you.

None of the client versions supports SMP, only Warp Server SMP or the
new Warp Server for e-business. There are rumours that IF a Stardock
client becomes reality it will have SMP support.

Christian Hennecke
--
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                04-Sep-99 04:02:03
  To: All                                               04-Sep-99 11:08:15
Subj: Re: the future of os/2

From: [e-mail]

>> It depends on where your electricity comes from. Hydroelectric power is
>>clean.
>at the cost of flooding Glen Canyon, Three Gorges, and every other wild
>and beautiful place on Earth.

Yes, it would better to leave them pristine and just pollute the air we
might view them through. -- I'll give up hydro plants for the view, when
the rest of the world gives up high-compression automobile engines that
are responsible for most of our air pollution.


_____________
Ed Letourneau <[e-mail]>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    04-Sep-99 06:43:28
  To: All                                               04-Sep-99 11:08:15
Subj: Re: HELP, Install Warp 3.0 Connect

From: [e-mail] (Dan Casey)

In article <7qqpj8$ff2$[e-mail]>,
"Joao Pissarro" <[e-mail]> wrote:
>Hello all,
>
>I am installing OS/2 3.0 Connect on a PC with a large disk. I have upgraded
>the Disk 1 to the lage disk support driver, and the FDISK problem disapeard.
>
>The installation process goes till the point when the PC should boot from
>the hard disk (afer copying all the files from the disquettes and CD-ROM).
>On this point the screen remain indefenitly with a blinking cursor on the
>top left corner (it just does not boot).
>
>Any ideia to solve this problem?

Sounds like you forgot to add the line:
SET COPPYFROMFLOPPY=1
to the config.sys file on the installation diskette. Without this, the
install process copied the old driver from the CD.

Boot from floppies and replace the IBM1S506.ADD driver on your hard
drive (C:\OS2\BOOT) with the one on the installation floppy. Remove
the floppy and reboot. The install process should pick up where it
left off.



--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      04-Sep-99 08:37:11
  To: All                                               04-Sep-99 11:08:15
Subj: Re: Moving OS/2

From: Ray Tennenbaum <[e-mail]>

Raphael Tennenbaum wrote:

> The disadvantage (if it is one) is that logical
> partitions are blind to other logical partitions.

Whoops, I meant *primary* partitions are blind to other
primaries.

Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--
my email address is actually "at" worldnet.att.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@null                                       04-Sep-99 13:07:25
  To: All                                               04-Sep-99 11:08:15
Subj: Re: I got OS/2 2.11... for $1.50!

From: nospam@null (Richard A Crane)

On Wed, 1 Sep 1999 00:11:02, [e-mail] (Alex Taylor) wrote:
[snipped stuf re word perfect 5.2]

Would you email those as disc images to someone who gave you their Wp rego
number?

If so reply to me @ ibm.net and the front half is rcrane.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            04-Sep-99 15:03:00
  To: All                                               04-Sep-99 16:39:02
Subj: zip/gzip to stdout - can't do it?

From: Stan Towianski <[e-mail]>

Hi,

I am trying to pipe from one command to another to eventually zip
a list of files to fpart.exe who will partition the output into chunks
to save onto removable media or floppies or whatever.

The problem with zip is that it seems to only allow me to write to
stdout
if I read from stdin, and I don't want to do that.  What I want to do is
read
from a list of filenames from stdin using -@ and still write to stdout.

zip -@ f:\tmp\test.zip <worklist
This writes to test.zip, but I really need to write to stdout so I can
instead
pipe the output to another command in one command instead of having
to go to a file and then to fpart.

Anyone know how to do what I want?

I eventually want to do something like:
dir /f/s /a:-d |zip -@ -newstdout_option | fpart -s -from - -to
g:\backup.zip

or zip -r -S *  -newstdout_option | fpart -s -from - -to g:\backup.zip

I also looked a gzip but it is older and I am not sure if it is
supported?
I can't seem to get it to work either.  I tried:
gzip -r -c * > f:\tmp\test2.zip

[F:\tmp\tmp]gzip -d test2.zip
gzip: test2.zip: unknown suffix -- ignored

[F:\tmp\tmp]gzip -S zip -d test2.zip

[F:\tmp\tmp]dir

The volume label in drive F is LINUX.
The Volume Serial Number is 6730:B415.
Directory of F:\tmp\tmp

 9-04-99  10:03a     <DIR>           0  .
 9-04-99  10:03a     <DIR>           0  ..
 9-04-99  11:00a   2692568           0  test2

It only gives one file like it concatenated them all together!


Zip 2.2 (November 3rd 1997). Usage:
zip [-options] [-b path] [-t mmddyyyy] [-n suffixes] [zipfile list] [-xi
list]
  The default action is to add or replace zipfile entries from list,
which
  can include the special name - to compress standard input.
  If zipfile and list are omitted, zip compresses stdin to stdout.
  -f   freshen: only changed files  -u   update: only changed or new
files
  -d   delete entries in zipfile    -m   move into zipfile (delete
files)
  -R   recurse into directories     -j   junk (don't record) directory
names
  -0   store only                   -l   convert LF to CR LF (-ll CR LF
to LF)
  -1   compress faster              -9   compress better
  -q   quiet operation              -v   verbose operation/print version
info
  -c   add one-line comments        -z   add zipfile comment
  -@   read names from stdin        -o   make zipfile as old as latest
entry
  -x   exclude the following names  -i   include only the following
names
  -F   fix zipfile (-FF try harder) -D   do not add directory entries
  -A   adjust self-extracting exe   -J   junk zipfile prefix (unzipsfx)
  -T   test zipfile integrity       -X   eXclude eXtra file attributes
  -E   use the .LONGNAME Extended attribute (if found) as filename
  -$   include volume label         -S   include system and hidden files

  -h   show this help               -n   don't compress these suffixes


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                     04-Sep-99 16:51:19
  To: All                                               04-Sep-99 16:39:02
Subj: Re: HELP, Install Warp 3.0 Connect

From: "Trevor Hemsley" <[e-mail]>

On Sat, 4 Sep 1999 10:40:19 +0100, Joao Pissarro wrote:

->I am installing OS/2 3.0 Connect on a PC with a large disk. I have upgraded
->the Disk 1 to the lage disk support driver, and the FDISK problem disapeard.
->
->The installation process goes till the point when the PC should boot from
->the hard disk (afer copying all the files from the disquettes and CD-ROM).
->On this point the screen remain indefenitly with a blinking cursor on the
->top left corner (it just does not boot).

You're installing to a partition that's outside the first 2GB of the disk.
Either move your installation partition under the 2GB point or get
ftp://hobbes.nmsu.edu/pub/os2/system/patches/warp_3/gt2gbw3.zip and use
that. The readme with it should explain what it is and why/how to use it


Trevor Hemsley, London, UK
([e-mail] or [e-mail])



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             04-Sep-99 09:07:27
  To: All                                               04-Sep-99 16:39:02
Subj: CD Won't Access

From: Jeff Welton <[e-mail]>

I've never had problems with my Cd before but last
night I to reinstall some software and stuck a CD
in, opened the drive icon and clicked on the "H"
drive, which is where the CD is located.  I got the
following response:

"The drive or diskette is not formatted correctly."

So I tried another CD thinking maybe the CD was bad
but I got the same error.  I tried accesing the disk from
the OS/2 command line and received:

[H:\]dir

Volume in drive H has no label.
The Volume Serial Number is 534E:4A52.
Directory of H:\

SYS0026: The specified disk or diskette cannot be accessed.

[G:\]help sys0026

HELP cannot read message file OSO001H.MSG.  Another
process may be using the message file or the message file is
incorrect.  Wait for the other process to finish or reinstall
the message file.  Retry the command.

So I rebooted thinking maybe that would fix it but
still the same thing.

Then I tried putting in a music CD and using my CD
player and it worked!  Sot the CD does work but
something is wrong in Denmark.  My config.sys statement
is: DEVICE=C:\OS2\BOOT\OS2CDROM.DMD /Q

It is a Mitsubishi CD Rom and it came with my
machine.  It has always worked before.   Does
anyone have any idea why I can no longer read
a normal CD disk even though I can play CD music?
I mean the CD ROM will read/play CD music disks
but it won't read anything else.

Another clue:  I booted up using the original config.sys
(at the white OS/2 block I did an Alt F1 and had the
machine use the original config.sys).  From there I was
able to access the H drive (CDRom) and can copy the
data from the CD Disk over to hard drive directory but
that's a long way around to get at the data.  I'm stumped.

I am using Warp 4 with Fix Pack 11.  Thank you.

Jeff

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Mail City Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          04-Sep-99 15:23:01
  To: All                                               04-Sep-99 16:39:02
Subj: Re: NS/2 4.04 is driving me crazy!

From: [e-mail] (Andrew Stephenson)

Now that someone has remembered the history file's contribution
to the unhappiness of Netscape users, perhaps it's time to repost
a little REXX file some kind soul (not me) produced a while ago.

I use this after pretty well every WWW access.  My thanks to the
true author.  (NB: the first char in the file is the first '/'.)

===
/* Clear the Netscape URL history list and other junk */

"del c:\netscape\cache\*.* /N"
"del c:\netscape\netscape.hst"
"del c:\netscape\cookies.txt"

call rxfuncadd 'sysloadfuncs', 'rexxutil', 'sysloadfuncs'
call sysloadfuncs

/* parse arg netscape_ini */
netscape_ini = "c:\netscape\netscape.ini"

do i = 1 to 10
    result = SysIni(netscape_ini, 'URL History', 'URL_' || i, 'DELETE:');
end i
===
--
Andrew Stephenson

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DNS (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  04-Sep-99 17:11:09
  To: All                                               04-Sep-99 20:09:00
Subj: Please help! Major hard disk crisis!

From: [e-mail]

My computer, up until now was set up as follows:
Bootmanager on partition 1
Empty primary partition waiting for Windows
Extended HPFS partition with Warp 4.0
Other extended partitions
I got a beta version of Windows 2000 from my employer. When it was
installing, I had it format my primary partition with NTFS. Also, it
disabled Bootmanager. After all the system files were installed, it
rebooted, but when my computer tried to read the boot record of drive C:
(I'm guessing) it told me "error loading OS" and stopped. I tried
installing Win2000 2 more times, once formatting with FAT, but I got the
same problem. I booted up with my OS/2 diskettes, and FDISK said that
none of the partitions were startable, and my OS/2 partition was set to
installable. It also said that the mapping on drive 1 may be corrupted.
Within FDISK I was able to delete partitions, except for the OS/2
partition when it said that I had to reset the installable flag on it,
which it wouldn't let me do anyway. I can't create any new partitions.
Along the line something really bad happened and now when I try to
access my OS/2 partition it tells me that it can't find sector 0. Is
there anyway I can salvage the data on that partition? If I install
Linux, would I be able to read at all from it? Or is there no hope? At
this point I can run a copy of DFSee and whatever's on the OS/2 disks. I
can download from my roommate's iMac. Please reply via email to
[e-mail]. Thanks in advance.

A very d


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                     04-Sep-99 15:30:29
  To: All                                               04-Sep-99 20:09:00
Subj: Can I change the fonts in Lotus Word Pro Help?

From: Worley Barry  <[e-mail]>

Or more precisely, how can I change Word Pro Help font? I am
a brand new Word Pro wanta be user.

     From the main Word Pro Screen I select Help and then Help
Topics, the Help Text  is displayed in the 'normal' OS/2 font.

     From that point on, most if not all the help text is in a
tiny font that I can barely read, after an hour of trying to
find out how to change the help font in this tiny help font,
I've got a raging headache.

     I'm going to take a couple of aspirin, and put lotus away
and wait to see if someone can help me.

Regards, Worley


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://extra.newsguy.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                     04-Sep-99 19:13:20
  To: All                                               04-Sep-99 20:09:00
Subj: Re: CD Won't Access

From: "Trevor Hemsley" <[e-mail]>

On Sat, 04 Sep 1999 09:07:54 -0700, Jeff Welton wrote:

->Then I tried putting in a music CD and using my CD
->player and it worked!  Sot the CD does work but
->something is wrong in Denmark.  My config.sys statement
->is: DEVICE=C:\OS2\BOOT\OS2CDROM.DMD /Q

There are several drivers involved in allowing you access to a CD. If this
is an IDE attached drive then the full list is

basedev=ibm1s506.add
basedev=ibmidecd.flt
device=x:\os2\mdos\vcdrom.sys
device=x:\os2\boot\os2cdrom.dmd /q
ifs=x:\os2\boot\cdfs.ifs /q

It sounds to me like you've lost the IFS statement. This would leave the
drive visible but containing an unrecognised file system...


Trevor Hemsley, London, UK
([e-mail] or [e-mail])



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               04-Sep-99 18:25:17
  To: All                                               04-Sep-99 20:09:01
Subj: FS : Cogent EM110 Network Card

From: [e-mail] ( Marcelo  Rodrigues )

Hello,

  I have a few of these cards for sale. I am asking $100 including shipping
and
insurance to Continental USA. These support 10Mbit   TP and 100Mbit TX.
Further, they support up to 200Mbit in full duplex mode ( FDE .) The cards
are new in unopened boxes.  I use them under NeXTSTEP but I have also
used them under Linux , NT and OS/2. They work great under all of those OS's

Thanks,
Marcelo

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Boston University (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             04-Sep-99 18:33:25
  To: All                                               04-Sep-99 20:09:01
Subj: Ahhh, HPFS

From: [e-mail] (Paul Neubauer)

In article <bexPS8LfLge6-pn2-B6bunHDH8G3Y@localhost>, Annie K. wrote:
>On Fri, 3 Sep 1999 17:24:03, [e-mail] (Paul Neubauer) wrote:
>
>:Just one partition, bootable & installable.  I did use the fdisk to remove
>:the partition (or so I thought) and then remake it.
>
> If you want to wipe everything out and start afresh, boot from your
>installation floppies, and run FORMAT C: /FS:HPFS

I finally managed it.  I had trouble at the command prompt
during install so here's what I did.

The drive is 405 MB and I had one partition.
I changed it to having two, one being 40MB.
Then I started an install, selected advanced, choose HPFS
let it go..and when it came to reboot, I bailed.
Then I went back and started another install, which
caught the improper shutdown and let me re-partion back to
a single 405 MB, and I selected advanced install and
specified HPFS.

It worked.
With the last of XCV gone, the one net ap I wanted from win3.x
runs fine and sees the net from Win-OS/2.

Thanks for the help & suggestions folks!

--
Paul "Vakko" Neubauer

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier Globalcenter (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             04-Sep-99 14:59:09
  To: All                                               04-Sep-99 20:09:01
Subj: Re: Please help! Major hard disk crisis!

From: Alan Beagley <[e-mail]>

Somebody else may be able to tell you how to recover from the mess, but it
sounds as though Win2K is at least as bad as I have been reading on
CompuServe about Win98 and its propensity to wreak major havoc with an OS/2
system.

Alan


[e-mail] wrote:

> My computer, up until now was set up as follows:
> Bootmanager on partition 1
> Empty primary partition waiting for Windows
> Extended HPFS partition with Warp 4.0
> Other extended partitions
> I got a beta version of Windows 2000 from my employer. When it was
> installing, I had it format my primary partition with NTFS. Also, it
> disabled Bootmanager. After all the system files were installed, it
> rebooted, but when my computer tried to read the boot record of drive C:
> (I'm guessing) it told me "error loading OS" and stopped. I tried
> installing Win2000 2 more times, once formatting with FAT, but I got the
> same problem. I booted up with my OS/2 diskettes, and FDISK said that
> none of the partitions were startable, and my OS/2 partition was set to
> installable. It also said that the mapping on drive 1 may be corrupted.
> Within FDISK I was able to delete partitions, except for the OS/2
> partition when it said that I had to reset the installable flag on it,
> which it wouldn't let me do anyway. I can't create any new partitions.
> Along the line something really bad happened and now when I try to
> access my OS/2 partition it tells me that it can't find sector 0. Is
> there anyway I can salvage the data on that partition? If I install
> Linux, would I be able to read at all from it? Or is there no hope? At
> this point I can run a copy of DFSee and whatever's on the OS/2 disks. I
> can download from my roommate's iMac. Please reply via email to
> [e-mail]. Thanks in advance.
>
> A very d
>
> Sent via Deja.com http://www.deja.com/
> Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 04-Sep-99 19:13:10
  To: All                                               04-Sep-99 20:09:01
Subj: Re: What ver of warp for a home dual cpu machine?

From: [e-mail] (Devin)

On Sat, 04 Sep 1999 14:19:08 +0200, Christian Hennecke
<[e-mail]> wrote:

>Devin schrieb:
>>
>> Hi. I am completely new to warp and woud like to know what is the best
>> version of warp for a home dual cpu?
>>
>> As far as networking, I would only need peer to peer networking (to
>> share files on another home pc) and access to my cable modem via
>> ethernet. It will not act as a server in any way.
>>
>> Thank you.
>
>None of the client versions supports SMP, only Warp Server SMP or the
>new Warp Server for e-business. There are rumours that IF a Stardock
>client becomes reality it will have SMP support.
>
>Christian Hennecke
>--
>Keep passing the open windows! ("The Hotel New Hampshire", John Irving)


Hmmm...just for the sake of arguement (excluding issues of price)
would Warp Server SMP with two 550Mhz P3's be faster or using one 550
with warp client?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: christian.hennecke@ruhr-uni-boch...               04-Sep-99 21:11:25
  To: All                                               04-Sep-99 20:09:01
Subj: Re: What ver of warp for a home dual cpu machine?

Message sender: [e-mail]

From: Christian Hennecke <[e-mail]>

Devin wrote:

> Hmmm...just for the sake of arguement (excluding issues of price)
> would Warp Server SMP with two 550Mhz P3's be faster or using one 550
> with warp client?

Well, I don't know much about this topic. AFAIK there are only few
programs that actually use the SMP feature. I guess that the speed
improvement is not worth the price until you're operating some extremely
critical piece of software.

Christian Hennecke
--
Keep passing the open windows! ("The Hotel New Hampshire", John Irving)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: not organized (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                         04-Sep-99 19:32:06
  To: All                                               04-Sep-99 20:09:01
Subj: Re: Can I change the fonts in Lotus Word Pro Help?

From: [e-mail] (Martin Racette)

On Sat, 4 Sep 1999 09:30:59, Worley
Barry  <[e-mail]>
wrote:

> Or more precisely, how can I change Word Pro Help font? I am
> a brand new Word Pro wanta be user.
>
>      From the main Word Pro Screen I select Help and then Help
> Topics, the Help Text  is displayed in the 'normal' OS/2 font.
>
>      From that point on, most if not all the help text is in a
> tiny font that I can barely read, after an hour of trying to
> find out how to change the help font in this tiny help font,
> I've got a raging headache.
>
>      I'm going to take a couple of aspirin, and put lotus away
> and wait to see if someone can help me.
>
> Regards, Worley
>
>

Check on the install CD-ROM there is a
directory called "\EXTRA\ALT_HELP" that
contains many EXE files to make the help
with a bigger font

//-------------------------
Good Luck

Bonne Chance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: Wm D [e-mail]                      04-Sep-99 19:38:27
  To: All                                               04-Sep-99 20:09:01
Subj: Re: Clobbering an old install to get HPFS?

From: Wm D [e-mail] ()

In article <7qokt8$2ase$[e-mail]>, Jack Wise wrote:
>Partition Magic can convert a fat file system to HPFS.

Well, _maybe_.  "Been there, done that", and for my efforts, I
had to reformat the HD.  I told P'Magic to convert four partitions
from FAT16 to HPFS 'on the fly'.  The docs say this is a viable
option.  Merrily, it seemed to do that.  Then, at the very end,
it said it 'counted more sectors than were on the disk'.  After
that, the partition was unreadable.  Period.  By anything.  From
anywhere.  So be careful!  Backup, backup, backup.  (There
should be more on this on Dejanews.)

Wm D "Bill" Loughman
Berkeley, CA, USA
[e-mail]


>
>www.powerquest.com
>
>800-379-2566
>
>Jack Wise
>
>Paul Neubauer wrote:
>>
>> How do I get this drive to be HPFS?  And I expect to
>> end up doing a full reinstall - I've backup up what
>> I think I really need to.
>>
>> Thanks,
>>
>> Paul Neubauer

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]               04-Sep-99 19:10:20
  To: All                                               04-Sep-99 20:09:01
Subj: Re: FS : Cogent EM110 Network Card

From: [e-mail] ()

On 4 Sep 1999 18:25:35 GMT, Marcelo  Rodrigues <[e-mail]> wrote:
>Hello,
>
>  I have a few of these cards for sale. I am asking $100 including shipping
>and
>insurance to Continental USA. These support 10Mbit   TP and 100Mbit TX.
>Further, they support up to 200Mbit in full duplex mode ( FDE .) The cards
>are new in unopened boxes.  I use them under NeXTSTEP but I have also
>used them under Linux , NT and OS/2. They work great under all of those OS's
>
>Thanks,
>Marcelo
>


--

it isn't os/2 software so please quit spamming the os/2 software
marketplace newsgroup.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://extra.newsguy.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                       04-Sep-99 20:39:14
  To: All                                               05-Sep-99 04:16:02
Subj: Re: What ver of warp for a home dual cpu machine?

From: [e-mail] (Jeroen van den Horn)

On Sat, 4 Sep 1999 19:13:21, [e-mail] (Devin) wrote:

> On Sat, 04 Sep 1999 14:19:08 +0200, Christian Hennecke
> <[e-mail]> wrote:
>
> >Devin schrieb:
> >>
> >> Hi. I am completely new to warp and woud like to know what is the best
> >> version of warp for a home dual cpu?
> >>
> >> As far as networking, I would only need peer to peer networking (to
> >> share files on another home pc) and access to my cable modem via
> >> ethernet. It will not act as a server in any way.
> >>
> >> Thank you.
> >
> >None of the client versions supports SMP, only Warp Server SMP or the
> >new Warp Server for e-business. There are rumours that IF a Stardock
> >client becomes reality it will have SMP support.
> >
> >Christian Hennecke
> >--
> >Keep passing the open windows! ("The Hotel New Hampshire", John Irving)
>
>
> Hmmm...just for the sake of arguement (excluding issues of price)
> would Warp Server SMP with two 550Mhz P3's be faster or using one 550
> with warp client?

Eh, yes it is faster! Most (if not all) OS/2 applications have at
least two threads running. OS/2 dispatches the threads across the
available CPU's, and thus all apps will gain by having more CPU's
available. The actual performance gain of course depends upon what the
threads are doing. I see an increase in most applications (for
example, the newsreader I am using decodes incoming messages in a
separate thread -> more CPU is more decoding power!),

Jeroen (running two Celerons at 500Mhz).

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: A2000 Kabeltelevisie en Telecommunicatie (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   04-Sep-99 17:51:20
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Fixpacks for Dummies (bug)

From: [e-mail]   (Joe Kovacs)

In <[e-mail]>, Irv Spalten <[e-mail]>
writes:
>Note sure what is being asked, but I will ask that for any questions,
>see the READ.ME file that comes with the FIXTOOL.

Irv, thanks very much for your response.   :-)  I'm going to
read all the things you've suggested.

I've read the READ.ME in FIXTOOL 1.41 about eight times in the
last month, and cannot understand the SERVICE procedure for
standalone computers.

I've always assumed the contents of the ARCHIVE directory
would go away upon committing.  I want to clean up my HD and
recover that space, I've _always done that off and on since
OS/2 v2.0.  I've always understood that's the thing to do upon
committing, that the archive has no value then.

_Here, in this couple of posts, I'm trying to cope with the
concept of deletion of the contents of the ARCHIVE directory.
I'm surprised to learn that maybe they're _not for deleting.

Well, all right, I'll read all the things you've suggested
except the READ.ME.   Or maybe I'll read it too again, upside
down for a new perspective.

>Joe Kovacs wrote:

>> He has said 'If using SERVICE.EXE, you need to use the
>> ADVANCED funtions', meaning the SERVICE.EXE and commit work.
>> I wish he'd comment here.  For starters, I don't see any
>> 'ADVANCED'.

Irv, when I want to commit with FixTool 1.41 and enter
SERVICE, I don't see anything labelled 'ADVANCED functions'.

For starters, all I get is a request to put in FixPack
Diskette 1, and I can't get away from that.

Can you comment, please?  Is that how it's supposed to be?
Where's the ADVANCED?

That's why I posted the simple how-to article.


Joe Kovacs
Guelph Ontario Canada


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Water Utilities Hydraulic Analysis (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   04-Sep-99 17:59:17
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Help with Mindspring as an ISP

From: [e-mail]   (Joe Kovacs)

In <SKfw30zmCGmZ-pn2-TzCFdnqj2uv1@localhost>, doug.bissett"at"ibm.net (Doug
Bissett) writes:
>On Thu, 2 Sep 1999 20:50:42, [e-mail] (Ron Gibson) wrote:

>I have had good service from the IBM Global network (now owned by
>AT&T). Check out http://www.ibm.net.

I've liked ibm.net too, and could not have carried that
recommendation through with an association to AT&T as
simply as this.  Especially in an OS/2 newsgroup.



Joe Kovacs
Guelph Ontario Canada


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Water Utilities Hydraulic Analysis (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            04-Sep-99 21:21:23
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Daylight Savings Time and OS/2 Warp

From: [e-mail]

Hi Alex:

You might find that the new command line utility package OS2CLU2 which
is announced and described at length in comp.os.os2.utilities (and
probably elsewhere) will do exactly what you want. The package is on
Hobbes although it has been moved out of "incoming". The INF
documentation is very good as well.

This package may be of interest to those looking for extended sort
functions as well.

Regards

Ian

In article <AFQz3.1756$[e-mail]>,
  [e-mail] (Alex Taylor) wrote:
> On Wed, 01 Sep 1999 18:13:38 -0500, Dan Casey <[e-mail]> wrote:
> > >How can we force this to occur?
> > >We got a customer that wants to know how they can test
> > >this change?
> >...
> >
> > If I wanted to force it to automatically change to DST (and back
> > again) I'd set it:
> >
> > SET TZ=EST5EDT
> >
> > I use a program called Time868 to automatically sync my system
clock
> > with the the Naval Observatory. It uses an Internet connection to
do
> > it, is very easy to setup and run, and includes a text file that
goes
> > into much greater detail on the TZ variable than the online help
files
> > in OS/2 Warp do. You can find it on hobbes.
>
> I've been trying to figure out how to do this myself - we have
several
> OS/2 production servers.  We've been trying to automate as much as
> possible, unfortunately, we still have to do the DST time change
> manually.
>
> I've been looking for a program that will do this automatically,
> however, all the time-management programs seem to be based on
> connecting to a NTP server.
>
> Our systems, however, are on a closed network (non-IP, at that).
>
> --
> -----------------------------------------------------------------
>  Alex Taylor                  BA - CIS - University of Guelph
>  [e-mail]   http://eddie.cis.uoguelph.ca/~alex
> -----------------------------------------------------------------
>


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    04-Sep-99 21:46:03
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Fixpacks for Dummies (bug)

From: [e-mail] (William Sonna)

On Sat, 4 Sep 1999 17:51:41, [e-mail]   (Joe Kovacs) wrote:

> In <[e-mail]>, Irv Spalten <[e-mail]>
writes:
> >Note sure what is being asked, but I will ask that for any questions,
> >see the READ.ME file that comes with the FIXTOOL.
>
> Irv, thanks very much for your response.   :-)  I'm going to
> read all the things you've suggested.
>
> I've read the READ.ME in FIXTOOL 1.41 about eight times in the
> last month, and cannot understand the SERVICE procedure for
> standalone computers.
>
> I've always assumed the contents of the ARCHIVE directory
> would go away upon committing.  I want to clean up my HD and
> recover that space, I've _always done that off and on since
> OS/2 v2.0.  I've always understood that's the thing to do upon
> committing, that the archive has no value then.
>
> _Here, in this couple of posts, I'm trying to cope with the
> concept of deletion of the contents of the ARCHIVE directory.
> I'm surprised to learn that maybe they're _not for deleting.
>
> Well, all right, I'll read all the things you've suggested
> except the READ.ME.   Or maybe I'll read it too again, upside
> down for a new perspective.
>
> >Joe Kovacs wrote:
>
> >> He has said 'If using SERVICE.EXE, you need to use the
> >> ADVANCED funtions', meaning the SERVICE.EXE and commit work.
> >> I wish he'd comment here.  For starters, I don't see any
> >> 'ADVANCED'.
>
> Irv, when I want to commit with FixTool 1.41 and enter
> SERVICE, I don't see anything labelled 'ADVANCED functions'.
>
> For starters, all I get is a request to put in FixPack
> Diskette 1, and I can't get away from that.
>
> Can you comment, please?  Is that how it's supposed to be?
> Where's the ADVANCED?
>
> That's why I posted the simple how-to article.
>
>
> Joe Kovacs
> Guelph Ontario Canada
>
>

I think this question NEEDS to be answered and as far as I can tell it
it is answered in IBM's documentation then it is not answered in
English.  So I will attempt to ask the question in computer-ease:

Does comitting a fixpack level

  a. automatically delete
  b. permit manual deletion

of:

  a. The archive
  b. The backup
  c. None of the above?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  04-Sep-99 17:55:01
  To: All                                               05-Sep-99 04:16:02
Subj: Please help, 2400 baud sucks!  need v.90 modem

From: [e-mail]

Hi,

My ISP upgraded to V.90 and now my old Supra 14.4 faxmodem
can only connect at 2400. Ouch.

Can anyone tell me what v.90 modem will work with my system?

I have a Pentium 60 PCI system.  I have Warp 3.0 with fixpack 40.

I am looking at inexpensive ones like Diamond Supra max 56k int,
Zoom 56k V90 PCI int, and similar from Motorola, Phoebe, etc...

If anyone uses any of these with a setup similar to mine, I'd
appreciate hearing about it.  Also, any other suggestions
would be welcome.  Some day I will get a new computer, but
for now, I am stuck with this beast.

Please email responses to [e-mail].

Thanks alot.  I truly appreciate it.

Paul.
--
  .
- o -
      ^     ^                    Z
    /   \  /  \   ^            z
  /'     \/    \ /  \         z
/'       /      /     \       /\''\
                              | ||''|
  amy,  paul, & izzy
                      [e-mail]

                      http://users.firstva.com/tree


  -----------== Posted via Newsfeeds.Com, Uncensored Usenet News ==----------
   http://www.newsfeeds.com       The Largest Usenet Servers in the World!
------== Over 73,000 Newsgroups - Including  Dedicated  Binaries Servers
==-----

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Newsfeeds.com http://www.newsfeeds.com 72,000+ UN
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                04-Sep-99 16:31:11
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Installing OS/2 Warp 4 on Pentium II machine

From: [e-mail] (Will Honea)

On Thu, 2 Sep 1999 21:50:10, [e-mail] wrote:

> Dear All,
> does anyone know if there is a problem installing Warp 4 on Pentium II
> machines?  I get as far as the third installation disk, and the system hangs
> at "loading, please wait".  If there is a problem is there a work around?
> Many thanks in anticipation for your help.
> Ted

Depends on who built it, BIOS, and what components are installed.  I
run it on a bunch of different Pentium machines with all sorts of
speeds and Pentium types, so the answer is in general YES,  it will
run fine.  Now for specifics.  When you boot the first install
diskette you will see a white block in the upper left corner of the
screen.  While this is visible, press ALT-F2.  Now you will see a list
of the device drivers as they load at the bottom of the screen.  Note
which is displayed when it hangs. Post back with this and a list of
the components in the machine.  Send a FULL hardware description - you
probably have a hardware conflict somewhere (or a large drive) and
it's likely someone can help.

Will Honea <[e-mail]>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                04-Sep-99 16:31:11
  To: All                                               05-Sep-99 04:16:02
Subj: Re: the future of os/2

From: [e-mail] (Will Honea)

On Fri, 3 Sep 1999 02:24:22, [e-mail] wrote:

> Early on, in our experience, and IBM has long since fixed it, there were
> early versions of the smaller IBM drives which had this problem.  We
> were told that drives can build up ozone concentrations in the things
> during run operations.  In the IBM case, it was interacting chemically
> with the lubricant in the drives.  From that point, if you turned the
> drive off and let it cool down and sit still for a while, day, two, or
> so, the drive wouldn't start spinning again unless you gave it a sharp
> twist to free the platter!

Or, with some older Seagates, put them in the freezer and chill them
real well before you re-started them.  One such 'ice box' drive lasted
me 5 years after it started that crap.

Ever notice that no matter how big it was, your next hard drive update
always cost you about $250?

Will Honea <[e-mail]>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           04-Sep-99 22:45:25
  To: All                                               05-Sep-99 04:16:02
Subj: Re: What ver of warp for a home dual cpu machine?

From: [e-mail] (Lorne Sunley)

On Sat, 4 Sep 1999 19:13:21, [e-mail] (Devin) wrote:

> On Sat, 04 Sep 1999 14:19:08 +0200, Christian Hennecke
> <[e-mail]> wrote:
>
> >Devin schrieb:
> >>
> >> Hi. I am completely new to warp and woud like to know what is the best
> >> version of warp for a home dual cpu?
> >>
> >> As far as networking, I would only need peer to peer networking (to
> >> share files on another home pc) and access to my cable modem via
> >> ethernet. It will not act as a server in any way.
> >>
> >> Thank you.
> >
> >None of the client versions supports SMP, only Warp Server SMP or the
> >new Warp Server for e-business. There are rumours that IF a Stardock
> >client becomes reality it will have SMP support.
> >
> >Christian Hennecke
> >--
> >Keep passing the open windows! ("The Hotel New Hampshire", John Irving)
>
>
> Hmmm...just for the sake of arguement (excluding issues of price)
> would Warp Server SMP with two 550Mhz P3's be faster or using one 550
> with warp client?

Based on results from playing around on dual processor P II @400 Mhz
board (ATC6280) Warp Server SMP is faster with two processors than
it is with only one installed. When a task does proper multi-threading
and the processing of the threads don't block because they are
dependant
on the processing of other threads, the task seems to complete in
just over 1/2 the time on two processors than it takes on one.

Tasks that have only a single working thread (like the SETI@HOME
client) take just as long on two processors as they do on one. Mind
you, you can run two SETI@HOME clients and get twice the work
units completed in the same elapsed time (using two processors).

General purpose work, when you have multiple acitivities going
on, is faster with two processors. If all you are doing is a single
task, like typing a message, you would not be able tell if you
have one or two processors.

Lorne Sunley



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            04-Sep-99 20:09:24
  To: All                                               05-Sep-99 04:16:02
Subj: Re: Please help, 2400 baud sucks!  need v.90 modem

From: Bob Grimes <[e-mail]>


[e-mail] wrote:

> Hi,
>
> My ISP upgraded to V.90 and now my old Supra 14.4 faxmodem
> can only connect at 2400. Ouch.
>
> Can anyone tell me what v.90 modem will work with my system?
>
> I have a Pentium 60 PCI system.  I have Warp 3.0 with fixpack 40.
>
> I am looking at inexpensive ones like Diamond Supra max 56k int,
> Zoom 56k V90 PCI int, and similar from Motorola, Phoebe, etc...
>
> If anyone uses any of these with a setup similar to mine, I'd
> appreciate hearing about it.  Also, any other suggestions
> would be welcome.  Some day I will get a new computer, but
> for now, I am stuck with this beast.
>
> Please email responses to [e-mail].
>
> Thanks alot.  I truly appreciate it.
>

I have a Phoebe, 56K external, picked up at a local computer show for $50.
Works
great on every machine, even an old PS/ValuePoint.

>
>
>




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                05-Sep-99 01:53:27
  To: All                                               05-Sep-99 05:27:07
Subj: Re: Please help! Major hard disk crisis!

From: [e-mail]   (Baden Kudrenecky)

   I recently had a similar problem on one computer where Win98
had corrupted the partition tables on a 4 GB drive, including
Boot Manager.  The "Boot Manager" partition table said it was 7
MB, but it went up to 32 MB, overlapping the C:  Window's
partition.  What I recall doing was:

   1) Boot OS/2 from floppy
   2) With 'fdisk' make C:  Win98 partition "Startable"
   3) Boot Win98
   4) With 'fdisk', remove Boot Manager partition
   5) Boot OS/2 from floppy
   6) Use "Partition Magic" to shrink the C:  partition by 50 MB,
      so that there was 50 MB free space.
   7) Add Boot Manger

   I missed doing a "fdisk /newmbr" from OS/2, but it worked
anyway.


In <7qrjrh$for$[e-mail]>, [e-mail] writes:
>My computer, up until now was set up as follows:
>Bootmanager on partition 1
>Empty primary partition waiting for Windows
>Extended HPFS partition with Warp 4.0
>Other extended partitions
>I got a beta version of Windows 2000 from my employer. When it was
>installing, I had it format my primary partition with NTFS. Also, it
>disabled Bootmanager. After all the system files were installed, it
>rebooted, but when my computer tried to read the boot record of drive C:
>(I'm guessing) it told me "error loading OS" and stopped. I tried
>installing Win2000 2 more times, once formatting with FAT, but I got the
>same problem. I booted up with my OS/2 diskettes, and FDISK said that
>none of the partitions were startable, and my OS/2 partition was set to
>installable. It also said that the mapping on drive 1 may be corrupted.
>Within FDISK I was able to delete partitions, except for the OS/2
>partition when it said that I had to reset the installable flag on it,
>which it wouldn't let me do anyway. I can't create any new partitions.
>Along the line something really bad happened and now when I try to
>access my OS/2 partition it tells me that it can't find sector 0. Is
>there anyway I can salvage the data on that partition? If I install
>Linux, would I be able to read at all from it? Or is there no hope? At
>this point I can run a copy of DFSee and whatever's on the OS/2 disks. I
>can download from my roommate's iMac. Please reply via email to
>[e-mail]. Thanks in advance.
>
>A very d
>
>
>Sent via Deja.com http://www.deja.com/
>Share what you know. Learn what you don't.


baden

[e-mail]
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      05-Sep-99 04:23:09
  To: All                                               05-Sep-99 05:27:07
Subj: Re: Please help! Major hard disk crisis!

From: Martin Nisshagen <[e-mail]>

Alan Beagley [] -> comp.os.os2.misc:

» Somebody else may be able to tell you how to recover from the mess, but it
» sounds as though Win2K is at least as bad as I have been reading on
» CompuServe about Win98 and its propensity to wreak major havoc with an OS/2
» system.

FYI: It can wreak havoc also on NT4 partitions (converts them automatically to
new NTFS5 file system, which isn't always readable from NT4 if you don't
already have the latest SP applied to it). Cloud be good to know. The info for
the Win2K beta strongly advices against installing it on any machine who is
used in any kind of productive kind of work.

I'm a beta tester of Win 2000, but just like with all test of operating system
betas, I choose to run it only on separate machines (who I doesn't use for
very important work), or on same machine on totally separate hard disks (which
I can easily switch between with some special hard disk tray that I think most
computer shops sells rather cheap).

Best regards,

m a r t i n | n

--
Martin Nisshagen                 PGP 6.0: 0x45D423AC      K R A F T W E R K
:-)
CS/CE, Chalmers, Sweden          ICQ UIN: 689662          2 x 300A @ 450 MHz
d4nisse-at-dtek-chalmers-se      home2.sbbs2.com/mn
home2.sbbs2.com/mn/kw

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Chalmers University of Technology, Sweden (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                05-Sep-99 02:25:05
  To: All                                               05-Sep-99 05:27:07
Subj: Re: What ver of warp for a home dual cpu machine?

From: [e-mail]   (Baden Kudrenecky)

In <[e-mail]>, [e-mail] (Devin) writes:
>On Sat, 04 Sep 1999 14:19:08 +0200, Christian Hennecke
><[e-mail]> wrote:
>
>>Devin schrieb:
>>>
>>> Hi. I am completely new to warp and woud like to know what is the best
>>> version of warp for a home dual cpu?
>>>
>>> As far as networking, I would only need peer to peer networking (to
>>> share files on another home pc) and access to my cable modem via
>>> ethernet. It will not act as a server in any way.
>>>
>>> Thank you.
>>
>>None of the client versions supports SMP, only Warp Server SMP or the
>>new Warp Server for e-business. There are rumours that IF a Stardock
>>client becomes reality it will have SMP support.
>>
>>Christian Hennecke
>>--
>>Keep passing the open windows! ("The Hotel New Hampshire", John Irving)
>
>
>Hmmm...just for the sake of arguement (excluding issues of price)
>would Warp Server SMP with two 550Mhz P3's be faster or using one 550
>with warp client?

   I recall reading when SMP first came out for OS/2 2.11, that
it more or less scaled linearly up to 8 processors, with about
.9 * n the execution speed for each additional (n) processor,
which was WAY better than NT.  The OS/2 SMP kernel dispatched
waiting threads to each processor in a round robin fashion, so
that the processors were always busy.  As OS/2 was always
running multiple threads, the system would always be faster.
Some applications were written to use SMP, which of course would
extremely reduce the execution time.


baden

[e-mail]
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            05-Sep-99 02:25:15
  To: All                                               05-Sep-99 05:27:07
Subj: Re: the future of os/2

From: [e-mail]

In <[e-mail]>, [e-mail] (Will
Honea) writes:
>On Fri, 3 Sep 1999 02:24:22, [e-mail] wrote:
>

>Or, with some older Seagates, put them in the freezer and chill them
>real well before you re-started them.  One such 'ice box' drive lasted
>me 5 years after it started that crap.

Yep.

>Ever notice that no matter how big it was, your next hard drive update
>always cost you about $250?

>Will Honea <[e-mail]>

Just like every replacement computer still costs you the same 2-3 grand
and they come around about as reqularly as well?

    grin..

--> Sleep well; OS2's still awake! ;)

[e-mail]
[e-mail]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    05-Sep-99 02:34:12
  To: All                                               05-Sep-99 05:27:07
Subj: Re: Install Problem- Warp 3 and 10gig Drive

From: [e-mail]

In <7puh0v$54j$[e-mail]>, on 08/24/99
   at 12:25 PM, "M Lombana" <m_lombana<delete_me_to_reply>@yahoo.com>
said:

>If this has been covered before, I'm sorry, however this one has got me
>beat and I need a solution fast. I've been attempting to install Os2 Warp
>for 2 days now in the following configuration.

>Abit Motherboard - 128MB - Pii 400mHz - Diamond Viper 550 video IBM 10
>Gig drive and 4 partitions setup as follows:

>Primary P1- DOS 500 Meg (Intended for Dos 6 and Os2)
>Primary P2- NTFS 1g (Intended for NT)
>Primary P3- Fat32 1g (Intended for 98)
>P4 (Extended) Not formatted at this time will be for various uses.

>During install here is the situation. I load the 1st Os2 disk and the
>install begins, when asked for the 2nd disk the system gets to FDISK and
>reports that the drives are un-usable and cannot be created or installed
>to. I'm sure this is familiar to some.

>The next step was to download the IBM1s506 updates. It calls for 3 files
>to be copied to disk 1 however there is not enough room for this
>operation. In an attempt to get these files to load I was forced to
>remove the OS2LOGO file and the TEDIT Help file. This gave me the room on
>the disk and I was able to get to the FDISK program with success and
>proper drive sizes.

>Finally the system attempted to install to the 1st partition however this
>time rather than start the CD rom drive into gear, it continues to ask me
>for Floppys. I did change the Config.sys statement to set
>COPYFROMFLOPPY=1 as well as try =0 and remove it all together. In no case
>has this worked.

>Can someone please tell me what to do. I need to get this OS on the drive
>to run some software that will only run in the OS 2 environment.

>Please advise.
>Thanks, Miguel

>

=The classic pc bios limit for primary partitions if 4.
=Here extended partition is counted as one. And also OS/2
=bootmanager partition is counted for one. This partition
=plan will count for five. A working idea would be to
=install nt4 to logical drive in the extended partition
=instead of primary partition.
=
=Naturally, there are some 'advanced' bootmanagers,
=
=Osmo



Try  System Commander, It does not require a primary partition and works
well.  I've not upgraded my version sice I don't need FAT32 support.

--
-----------------------------------------------------------
Herns Modestil      HernsModestil At Technologist Dot com
-----------------------------------------------------------

To UNSUBSCRIBE from the MR/2 ICE Mailing List, simply send a message with the
subject of UNSUBSCRIBE to [e-mail].

Alternately, visit http://oracle.secant.com/maillist.htm to access
the web-based subscription manager for this list.

The searchable archive for this list seems to have been terminated :(

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    05-Sep-99 02:57:22
  To: All                                               05-Sep-99 05:27:07
Subj: UMAX + Win-OS/2

From: [e-mail] (John Hong)

    I'm running a UMAX 610S flatbed scanner here.  I was wondering is
there anyway to get by this [Divide Zero] error problem.  Previewing goes
fine, but when I try to actually scan the image, I always get this.  This
happened with VistaScan software v2.43 (which came with the scanner) and
has also happened with the latest version (3.5).
    I remember some people reporting here a while back that they had
their UMAX scsi scanners running under Win-OS/2 like this.  Any tips?


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    05-Sep-99 03:22:17
  To: All                                               05-Sep-99 05:27:08
Subj: Imation IDE Super Disks and OS/2

From: [e-mail] (William Sonna)

Has anyone gotten an Imation IDE Super Disk to work with OS/2 ver 4?

If so, what exactly were the steps you took?

As usual, I can find tons of "documentation" on the subject, but no
instructions.

Can anyone explain precisely how one gets the operating system to
recognize the presence of one of these devices? I ask the question
because my motherboard has no problem recognizing the device, but OS/2
refuses.

Lets assume my motherboard BIOS can boot off it.

Can it be assigned a floppy drive (ie A or B) letter, or a fixed drive
letter (C, D or higner)?  How and when is it assigned a drive letter
and how do I control that process?  What driver does it use and what
are the correct settings?

Thanks for any and all help.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                     04-Sep-99 20:56:11
  To: All                                               05-Sep-99 05:27:08
Subj: Re: AMD K7 Athlon

From: Joseph Loo <[e-mail]>

In Losa Angeles there is someone selling the 600 Mhz Athalon machine.
Unfortunately it is pretty hefty price $700 or $800 for motherboard and
processor.

On Thu, 02 Sep 1999 15:38:18 -0400, David T. Johnson wrote:

>Zamp wrote:
>>
>> Ciao.
>>
>> Anyone got it ?
>> Can it work with Os/2 ?
>
>AMD says OS/2 will work with Athlon which is not surprising since it is
>x86 upwardly compatible.  The real issue with Athlon is getting a
>motherboard.  There are only three models currently available (FIC
>SD-11, Gigabyte GA-71x, and MSI MS-6167).  MSI seems to be the most
>available but is in very short supply and seems to be only sold in Japan
>and Europe.  The first BIOS for the MSI had some problems with some
>video cards but MSI released a new BIOS that apparently fixes this.
>Some computer manufacturers also are selling Athlon systems (IBM,
>Compaq) but these are not yet available anywhere AFAIK.
>
>From what I can see, no one in the United States can buy an Athlon
>system of any kind right now.
>

Joseph Loo
[e-mail]


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                     04-Sep-99 21:03:00
  To: All                                               05-Sep-99 05:27:08
Subj: Palm Oilot

From: Joseph Loo <[e-mail]>

I recently acquired a palm pilot IIIx. Is ther any software out ther to
install and sync calendar, etc. for OS2?

I remember there was some activity out there and lost track of it.

Thanks for any help.

Joseph Loo
[e-mail]


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              05-Sep-99 04:14:27
  To: All                                               05-Sep-99 05:27:08
Subj: Re: HELP, Install Warp 3.0 Connect

From: [e-mail] (Joseph Pacheco)

I have had this problem before.

-Ensure that the first statement in the config.sys file on the floppy
reads: COPYFROMFLOPPY=1

-Try installing again.

-Copy the new IDEDASD driver to x:\os2\boot

Good luck.

-JP

p.s. Keep trying; OS/2 is worth it. You would do better to get Warp
4.0- it rocks!



I was offered a chance to see God;
but I declined--my faith in God,
is enough. Born twice; will die once.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                05-Sep-99 01:24:14
  To: All                                               05-Sep-99 05:27:08
Subj: Re: Imation IDE Super Disks and OS/2

From: "Billy Ko" <[e-mail]>

On 5 Sep 1999 03:22:34 GMT, William Sonna wrote:

:>Has anyone gotten an Imation IDE Super Disk to work with OS/2 ver 4?
:>
:>If so, what exactly were the steps you took?
:>
:>As usual, I can find tons of "documentation" on the subject, but no
:>instructions.
:>
:>Can anyone explain precisely how one gets the operating system to
:>recognize the presence of one of these devices? I ask the question
:>because my motherboard has no problem recognizing the device, but OS/2
:>refuses.
:>
:>Lets assume my motherboard BIOS can boot off it.
:>
:>Can it be assigned a floppy drive (ie A or B) letter, or a fixed drive
:>letter (C, D or higner)?  How and when is it assigned a drive letter
:>and how do I control that process?  What driver does it use and what
:>are the correct settings?
:>
:>Thanks for any and all help.
:>
:>
I believe the latest IDE drivers see it, as well as fixpak 6 or later.  It
should see it as a floppy ("A" or "B," depending on if you have a "real"
floppy also, or not).  It will be able to read LS-120 disks, but it's kind of
slow, as it isn't being cached.

Bill

Bill
Team OS/2

-----

OS/2 - If you want "productivity" to be more than a few
four-letter words.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      05-Sep-99 15:35:22
  To: All                                               05-Sep-99 10:23:20
Subj: Rexx/exe cgi-bin to show system uptime

From: [e-mail] (Khairil Yusof)

Has anybody here written a cgi rexx script or executable that shows the system

uptime? Or know of a site from which I could get one?

I'd like a nice little section on my intranet site to show how stable OS/2 is.

Thanks,
Khairil

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Australian National University (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  05-Sep-99 06:02:21
  To: All                                               05-Sep-99 10:23:20
Subj: Re: UMAX + Win-OS/2

From: [e-mail] (Stan Goodman)

You probably have an excellent reason for not getting e.g. the CFM driver,
so that you could use the scanner under a native OS/2 application. That's
how I am using my UMAX SCSI scanner.

On Sun, 5 Sep 1999 02:57:45, [e-mail] (John Hong)
wrote:

>     I'm running a UMAX 610S flatbed scanner here.  I was wondering is
> there anyway to get by this [Divide Zero] error problem.  Previewing goes
> fine, but when I try to actually scan the image, I always get this.  This
> happened with VistaScan software v2.43 (which came with the scanner) and
> has also happened with the latest version (3.5).
>     I remember some people reporting here a while back that they had
> their UMAX scsi scanners running under Win-OS/2 like this.  Any tips?
>
>

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to [e-mail] will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            05-Sep-99 02:35:06
  To: All                                               05-Sep-99 10:23:20
Subj: [OT] Did I kill my laptop?

From: [e-mail]

Greetings!

I undertook today what I _thought_ would be a harmless manoeuvre. I have
an old Sager Notebook (Model 6200rt) parts of which I've decided to
upgrade. The new cpu came today so I decided to install it.

After some futzing, I was finally able to lift the old one out and put in
the new one. It's a move from 166MMX to 233MMX.

But now the laptop doesn't boot. It starts, I can see the HDD gets touched
for a brief moment and then nothing. The fan is whirring but nothing else
is in operation and I'm facing a black screen. I put the old cpu back in
and the same.

I guess my question is, Could the new cpu have somehow blown a circuit,
have done real damage?

It's a disappointment; I finally had it running almost everything I
wanted: a solid install of W95, OS/2 and RH Linux.

Both cpu's are the same voltage (2.8V) and I didn't change any voltage
settings (can't - don't know how on this MB). I've tried firming up any
loose connections. I pulled and reseated the HD.

The notebook is legacy but I'd looked forward to getting more years of
productivity with a ram, cpu and HD upgrade. I fear I'm now in the market
for another laptop. Requirements? Must be fully functional in W95, OS/2
and Linux.

F.



-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                     05-Sep-99 01:03:14
  To: All                                               05-Sep-99 10:23:20
Subj: CD Front-end

From: [e-mail] (J.P. Pasnak)

I'm looking for an OS/2 PM program that will act as a 'front-end' to a
burned CD, but have had no luck.  What I was looking for was something
that could read a text file, display info about the program and launch
it.  I've seen several for Win and DOS, but none for OS/2.

Is there anything like this out there, or tips on how to go about
making one?


J.P. Pasnak
Warped Systems
******************
http://members.xoom.com/Warped/every/everything.html
http://members.xoom.com/Warped/every/dirmap.html
http://clubs.yahoo.com/clubs/warpedusers
*******************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warped Systems (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           05-Sep-99 03:08:26
  To: All                                               05-Sep-99 10:23:20
Subj: Re: Please help! Major hard disk crisis!

From: Bob Germer <[e-mail]>

On <[e-mail]>, on 09/04/99 at 02:59 PM,
   Alan Beagley <[e-mail]> said:

> Somebody else may be able to tell you how to recover from the mess, but
> it sounds as though Win2K is at least as bad as I have been reading on
> CompuServe about Win98 and its propensity to wreak major havoc with an
> OS/2 system.

> Alan

Sorry I missed the message to which you replied. I am sending a copy of
this reply to Ron Blatt who asked the question.

The poor soul whose drive is messed up should boot from OS/2 floppies and
run FDISK /NewMBR.

Also look at many of the other FDISK options available. Type Help FDISK at
an OS/2 prompt (assuming help is installed). FDISK is a very powerful
program. It can cure most problems caused by rogue operating systems.

> [e-mail] wrote:

> > My computer, up until now was set up as follows:
> > Bootmanager on partition 1
> > Empty primary partition waiting for Windows
> > Extended HPFS partition with Warp 4.0
> > Other extended partitions
> > I got a beta version of Windows 2000 from my employer. When it was
> > installing, I had it format my primary partition with NTFS. Also, it
> > disabled Bootmanager. After all the system files were installed, it
> > rebooted, but when my computer tried to read the boot record of drive C:
> > (I'm guessing) it told me "error loading OS" and stopped. I tried
> > installing Win2000 2 more times, once formatting with FAT, but I got the
> > same problem. I booted up with my OS/2 diskettes, and FDISK said that
> > none of the partitions were startable, and my OS/2 partition was set to
> > installable. It also said that the mapping on drive 1 may be corrupted.
> > Within FDISK I was able to delete partitions, except for the OS/2
> > partition when it said that I had to reset the installable flag on it,
> > which it wouldn't let me do anyway. I can't create any new partitions.
> > Along the line something really bad happened and now when I try to
> > access my OS/2 partition it tells me that it can't find sector 0. Is
> > there anyway I can salvage the data on that partition? If I install
> > Linux, would I be able to read at all from it? Or is there no hope? At
> > this point I can run a copy of DFSee and whatever's on the OS/2 disks. I
> > can download from my roommate's iMac. Please reply via email to
> > [e-mail]. Thanks in advance.
> >
> > A very d
> >
> > Sent via Deja.com http://www.deja.com/
> > Share what you know. Learn what you don't.



--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: [e-mail]
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  05-Sep-99 08:42:18
  To: All                                               05-Sep-99 10:23:20
Subj: problem printing on 2 sides

From: Roy Vargas <[e-mail]>

Does anyone know how to enable the 2-sided printing radio buttons in the
Job Properties dialog box for the HP 690C series of printers?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             05-Sep-99 08:53:14
  To: All                                               05-Sep-99 10:23:21
Subj: Re: Rexx/exe cgi-bin to show system uptime

From: [e-mail] (Dominique Pivard)

On Sun, 5 Sep 1999 05:35:45, [e-mail] (Khairil
Yusof) wrote:

> Has anybody here written a cgi rexx script or executable that shows the
system
> uptime? Or know of a site from which I could get one?

I'd think this one could do the job:
ftp://hobbes.nmsu.edu/pub/os2/apps/internet/misc/updsig16.zip

updsig16.zip      40100 1999/09/02  Add the systems uptime to your
signature file



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: None!! (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           05-Sep-99 10:02:26
  To: All                                               05-Sep-99 10:23:21
Subj: Re: HELP, Install Warp 3.0 Connect

From: "Joao Pissarro" <[e-mail]>

Hello Dan,

Thnaks for the reply,

I have done it (SET COPPYFROMFLOPPY=1) and verifyied that on os2/boot the
file was the new one. It does not seems to solve the problem....

Any ideas still?

Thanks

Joao Pissarro
[e-mail]


>
> Sounds like you forgot to add the line:
> SET COPPYFROMFLOPPY=1
> to the config.sys file on the installation diskette. Without this, the
> install process copied the old driver from the CD.
>
> Boot from floppies and replace the IBM1S506.ADD driver on your hard
> drive (C:\OS2\BOOT) with the one on the installation floppy. Remove
> the floppy and reboot. The install process should pick up where it
> left off.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                     05-Sep-99 09:44:01
  To: All                                               05-Sep-99 10:23:21
Subj: QuickCam VC USB

From: [e-mail] (Zamp)

Hi

Did you know any app. support for subj ?

Conoscete se qualche applicazione supporta la Quickcam USB ?

Thanks.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Centro Servizi Interbusiness (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                        05-Sep-99 09:54:26
  To: All                                               05-Sep-99 10:23:21
Subj: Re: Palm Pilot

From: [e-mail] (Jan Eri)

On Sun, 5 Sep 1999 05:03:00, Joseph Loo <[e-mail]> wrote:
> I recently acquired a palm pilot IIIx. Is ther any software out ther to
> install and sync calendar, etc. for OS2?
> I remember there was some activity out there and lost track of it.


I am using it with great success to sync with Lotus Notes with the Java
applications" jSyncManager for Palm" and  "jConduit for Lotus Notes", see
http://yaztromo.idirect.com/java-pilot.html and
http://yaztromo.idirect.com/ferenc/

regards,
Jan

 -------------------------------------------------
| Jan Eri         | Surfing with OS/2 Warp 4      |
| Protector AS    | http://www.protector-group.no |
| NORWAY          | http://home.eunet.no/~jeri    |
 -------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Protector AS (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    05-Sep-99 09:57:06
  To: All                                               05-Sep-99 10:23:21
Subj: Re: UMAX + Win-OS/2

From: [e-mail] (John Hong)

Stan Goodman ([e-mail]) wrote:
: You probably have an excellent reason for not getting e.g. the CFM driver,
: so that you could use the scanner under a native OS/2 application. That's
: how I am using my UMAX SCSI scanner.

    Yes.  CFM Support gave it to me, it went along the lines of the
UMAX 610S is not supported due to UMAX not give them any documentation on
the spec's.  I had already checked with CFM and STi about this and
neither will support it.
    So...any other helpful advice?  Anyone?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    05-Sep-99 11:50:13
  To: All                                               05-Sep-99 12:16:11
Subj: Re: Imation IDE Super Disks and OS/2

From: [e-mail] (William Sonna)

On Sun, 5 Sep 1999 05:24:28, "Billy Ko"
<[e-mail]> wrote:

> On 5 Sep 1999 03:22:34 GMT, William Sonna wrote:
>
> :>Has anyone gotten an Imation IDE Super Disk to work with OS/2 ver 4?
> :>
> :>If so, what exactly were the steps you took?
> :>
> :>As usual, I can find tons of "documentation" on the subject, but no
> :>instructions.
> :>
> :>Can anyone explain precisely how one gets the operating system to
> :>recognize the presence of one of these devices? I ask the question
> :>because my motherboard has no problem recognizing the device, but OS/2
> :>refuses.
> :>
> :>Lets assume my motherboard BIOS can boot off it.
> :>
> :>Can it be assigned a floppy drive (ie A or B) letter, or a fixed drive
> :>letter (C, D or higner)?  How and when is it assigned a drive letter
> :>and how do I control that process?  What driver does it use and what
> :>are the correct settings?
> :>
> :>Thanks for any and all help.
> :>
> :>
> I believe the latest IDE drivers see it, as well as fixpak 6 or later.  It
> should see it as a floppy ("A" or "B," depending on if you have a "real"
> floppy also, or not).  It will be able to read LS-120 disks, but it's kind
of
> slow, as it isn't being cached.
>
> Bill
>
> Bill
> Team OS/2
>
> -----
>
> OS/2 - If you want "productivity" to be more than a few
> four-letter words.
>
>
>

I thought so too. That's what IBM has been claiming.  That's why I
bought the drive.

Unfortunately, it doesn't work that way.

IBM1S506.ADD sees the device as "PIO3 ATAPI" but no drive letter gets
assigned.

Thanks anyway.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                05-Sep-99 08:04:02
  To: All                                               05-Sep-99 12:16:11
Subj: UMAX + Win-OS/2

From: fledermaus <[e-mail]>

Ref:     Append at 02:57:45 on 99/09/05 GMT (by [e-mail]
(John Hong)
I have a umax astra 1220s with scsi card which runs well with os/2 and
software from cfm (cfmsane) and pmview. No problems except that occasionally
it does not like the bit sizes and the program just goes away (abends).

"A leader who is above the law is a tyrant (e.g. Gates, Clinton)"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      05-Sep-99 14:37:24
  To: All                                               05-Sep-99 14:48:26
Subj: Re: CD Front-end

From: Martin Nisshagen <[e-mail]>

J.P. Pasnak [Warped Systems] -> comp.os.os2.misc:

» I'm looking for an OS/2 PM program that will act as a 'front-end' to a
» burned CD, but have had no luck.  What I was looking for was something
» that could read a text file, display info about the program and launch
» it.  I've seen several for Win and DOS, but none for OS/2.
»
» Is there anything like this out there, or tips on how to go about
» making one?

What about using a custom .html file you launch in Netscape as a front end?

Best regards,

m a r t i n | n

--
Martin Nisshagen                 PGP 6.0: 0x45D423AC      K R A F T W E R K
:-)
CS/CE, Chalmers, Sweden          ICQ UIN: 689662          2 x 300A @ 450 MHz
d4nisse-at-dtek-chalmers-se      home2.sbbs2.com/mn
home2.sbbs2.com/mn/kw

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Chalmers University of Technology, Sweden (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            05-Sep-99 13:04:21
  To: All                                               05-Sep-99 14:48:26
Subj: Re: Please help! Major hard disk crisis!

From: [e-mail]

In <37d2174b$1$obot$[e-mail]>, Bob Germer
<[e-mail]> writes:
>On <[e-mail]>, on 09/04/99 at 02:59 PM,
>   Alan Beagley <[e-mail]> said:

>The poor soul whose drive is messed up should boot from OS/2 floppies and
>run FDISK /NewMBR.

>------------------------------------------------------------------------------
----------------
>Bob Germer from Mount Holly, NJ - E-mail: [e-mail]

It may be worth adding the comment that the option means 'make a new
master boot record.'

At one time, long ago and years far away, the help available for FDISK
failed to list this option, even though it worked!  I guess, more to the
point, the DOS FDISK varient was a little bit different in just the
"/MBR" was what you typed, if my foggy memory is right.

Someone whom has used this is DOS, like I have, and tried just the /MBR
in the OS/2 version of all this, like I did, couldn't get it to work,
of course!  Years ago, it took the kind suggestion of the variation in
the command wording to get me going again.

I haven't thought about this for years now with OS/2 and by now, the
help file may well have the needed text... I don't know.  Haven't had to
do this for years.


--> Sleep well; OS2's still awake! ;)

[e-mail]
[e-mail]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    05-Sep-99 08:09:17
  To: All                                               05-Sep-99 14:48:26
Subj: Re: HELP, Install Warp 3.0 Connect

From: [e-mail] (Dan Casey)

In article <7qtc5o$rju$[e-mail]>,
"Joao Pissarro" <[e-mail]> wrote:
>Hello Dan,
>
>Thnaks for the reply,
>
>I have done it (SET COPPYFROMFLOPPY=1) and verifyied that on os2/boot the
>file was the new one. It does not seems to solve the problem....
>
>Any ideas still?

Have you checked the information that Trevor posted in this thread?

--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    04-Sep-99 07:21:05
  To: All                                               05-Sep-99 14:48:26
Subj: Re: the future of os/2

From: [e-mail] (James Knott)

In article <[e-mail]>,
Martin Nisshagen <[e-mail]> wrote:
>James Knott [Global Network Services - Remote Access Mail & News Services] ->
>comp.os.os2.misc:
>
>╗ I have seen some applications (Personal Communications comes to mind)
>╗ that would die, but some part of the program was still "running" and
>╗ even the task manager couldn't kill it.  You then have to reboot,
>
>It has happened in some very rare case that, even if NT hasn't stopped
working
>in itself, that Task Manager hasn't been able to kill it. In some case I have
>killed the process with the command prompt kill command (NT resource kit) or
>simply logged of the computer and logged on again (that has always killed any
>such process for me).

Would you consider 4 or 5 occasions inside half an hour rare?  I can
recreate that situation at will.

>╗ Furthermore, performance sucks on NT.  When I do my testing NT, takes
>╗ me far longer than OS/2 (fastest) or W95.
>
>You haven't done your testing very deep me think. OS/2 is a bit difficult to
>directly compare as it doesn't run the exactly the same applications (which I
>regret as it would have been very interesting to be able to directly combat
>such statements like yours), but NT4 running the same application as on Win95
>is *much* faster (15-35% faster). This has been shown in several independent
>tests by both magazines and NSTL. You can also easily do a real test your
self
>by running some of the several available application bench marks (they
measure
>real world performance by scripting typical usage of standard applications).

Some of the applications I test with are available on all three
platforms. i.e. Personal Communications.  Personal Communications
works far better on OS/2 than on either Windows version.


>NT also easily beats Linux as a web server OS in raw performance of serving
>pure HTML pages on the exact same hardware. Unfortunately I haven't seen any
>such comparison and test between OS/2 and other operating systems (but I
doubt
>very strongly if it would come close to either NT or Linux on same hardware).

I can't comment Web Servers, but a couple of years ago, one of the
magazines did a test on file & print servers.  A single CPU Warp
Server was considerably faster than a single CPU NT server and almost
as fast as a 4 CPU NT server.

--
E-mail [e-mail]
_________________________________________________________________________
The above opinions are my own and not those of ISM Corp., a subsidiary of
IBM Canada Ltd.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                05-Sep-99 13:37:28
  To: All                                               05-Sep-99 14:48:26
Subj: Re: fixpaks on CDROM

From: [e-mail] (rj friedman)

On Thu, 2 Sep 1999 21:23:41, [e-mail] (Peter
Stein) wrote:

εHmmm. I previously got to the fixpak page at bmtmicro from another OS2
εsite and didn't see any answers to my questions. I now double checked
εby going directly to the bmtmicro home page and sure enough if you go
εto the fixpak page from there you get a different page (one that has
εall the answers).
»
εYou are correct that it includes other updates and can be directly
εinstalled from CD (via a graphical install utility). Maybe $15 isn't
εso bad after all. :-)

It's only US$15 the first time. All times after that it is
only US$8. Well worth it, IMO.





________________________________________________________

[RJ]                 OS/2 - Live it, or live with it.
rj friedman          Team ABW
Taipei, Taiwan       [e-mail]

To send email - remove the `yyy'
________________________________________________________

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SEEDNet News Service (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    05-Sep-99 13:35:16
  To: All                                               05-Sep-99 14:48:26
Subj: Re: Imation IDE Super Disks and OS/2

From: [e-mail] (John Hong)

William Sonna ([e-mail]) wrote:

: I thought so too. That's what IBM has been claiming.  That's why I
: bought the drive.

: Unfortunately, it doesn't work that way.

: IBM1S506.ADD sees the device as "PIO3 ATAPI" but no drive letter gets
: assigned.

    You also need IBMATAPI.FLT installed as a BASEDEV, too.  It's an
ATAPI drive.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    05-Sep-99 13:59:01
  To: All                                               05-Sep-99 14:48:26
Subj: Re: Imation IDE Super Disks and OS/2

From: [e-mail] (William Sonna)

On Sun, 5 Sep 1999 13:35:32, [e-mail] (John
Hong) wrote:

> William Sonna ([e-mail]) wrote:
>
> : I thought so too. That's what IBM has been claiming.  That's why I
> : bought the drive.
>
> : Unfortunately, it doesn't work that way.
>
> : IBM1S506.ADD sees the device as "PIO3 ATAPI" but no drive letter gets
> : assigned.
>
>     You also need IBMATAPI.FLT installed as a BASEDEV, too.  It's an
> ATAPI drive.
>
>

Thanks, that did the trick!!!!  Now I have a drive B (in addition to
my floppy drive A).

Now, one final question (opinion) - is it worth the trouble to set the
super drive up as A:?

For example - have you had any experience/difficulties
reinstalling/installing OS/2 on one of these devices configured as A:?

Again, Thanks

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                       04-Sep-99 13:06:03
  To: All                                               05-Sep-99 14:48:26
Subj: Re: Shutting WARP 3 VIO-Windows without interaction?

From: [e-mail] (Chris H Lindley)

On Fri, 03 Sep 1999 07:06:30 GMT, [e-mail] wrote:
>Am 02.09.99, 22:55:14, schrieb [e-mail] (Chris H
>Lindley) zum Thema Re: Shutting WARP 3 VIO-Windows without
>interaction?:
>
>[...]
>> >2. OS/2 WARP 4 can close VIO-Windows without user interaction ('Do
>you
>> >want to close...?', though being able to shutdown a system without
>any
>> >user interaction i.e. remotely. Any idea how to achive this under
>OS/2
>> >WARP 3 (FP40)?
>> >BTW: I don't just want to flush the cache and shut the system down, I
>> >really want to Shutdown the system!
>
>> I thought that setboot /b would perform a correct shutdown
>> and then reboot the machine!
>
>> Could be wrong!!
>
>Hi Chris,
>nope! It only flushes the cache but doesn't perform a proper shutdown.
>That's the problem!
>BTW: I don't want the system to reboot, only going down!

OK I stand corrected!!!!  Thanks.

In that case I don;t know! Perhaps some kind soul has written
a utility for this??


Cheers
Chris

--
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
▌  Chris H. Lindley                                  Yorkshire, UK  ª
▌  [e-mail]     Ferg on #os/2 and #os2uk, EFnet  ª
▌  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  ª
▌  Molecular Biology & OS/2               www.scotgate.demon.co.uk  ª
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            05-Sep-99 15:10:28
  To: All                                               05-Sep-99 14:48:27
Subj: Re: the future of os/2

From: [e-mail]

In <[e-mail]>, [e-mail] (James Knott) writes:


>>╗ I have seen some applications (Personal Communications comes to mind)
>>╗ that would die, but some part of the program was still "running" and
>>╗ even the task manager couldn't kill it.  You then have to reboot,

>Would you consider 4 or 5 occasions inside half an hour rare?  I can
>recreate that situation at will.

>E-mail [e-mail]

Would you agree with me that it is still possible to lock OS/2 Warp 4,
even as late as FP8, with telecommunications programs and serial port use
when the serial port connections go berserk?  It produces situations where
the thread reports "unknown" to Mole, for example and the only way to
kill the thread is to completely reboot.

Perhaps I should clarify that DOS-VDM's are involved.  I have no idea if
the same problem(s) would apply to a totally native OS/2 communications
system setup as a number of apps needed are just not available in native
OS/2 at all.

Left alone, with the 'ownerless' thread, and the same communications
program port use continued on that port, even OS/2, to my experience,
can still hard lock, even with task busters to make sure that any
pollers aren't totally maxing out the CPU and opening up the f0 Bug
question.


--> Sleep well; OS2's still awake! ;)

[e-mail]
[e-mail]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      06-Sep-99 01:41:22
  To: All                                               05-Sep-99 14:48:27
Subj: Re: Rexx/exe cgi-bin to show system uptime

From: [e-mail] (Khairil Yusof)

On Sun, 5 Sep 1999 08:53:29, [e-mail] (Dominique Pivard) wrote:

> On Sun, 5 Sep 1999 05:35:45, [e-mail] (Khairil
> Yusof) wrote:
>
> > Has anybody here written a cgi rexx script or executable that shows the
system
> > uptime? Or know of a site from which I could get one?
>
> I'd think this one could do the job:
> ftp://hobbes.nmsu.edu/pub/os2/apps/internet/misc/updsig16.zip
>
> updsig16.zip      40100 1999/09/02  Add the systems uptime to your
> signature file

Thanks that did the trick.. Quite a flexible program, you can edit it to
change
any text files. Only gripe is the time output format which is fixed. Hopefully

it can be modified in a later version.





--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Australian National University (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                     05-Sep-99 10:45:08
  To: All                                               05-Sep-99 21:13:20
Subj: Re: CD Front-end

From: [e-mail] (J.P. Pasnak)

On Sun, 5 Sep 1999 12:37:48, Martin Nisshagen
<[e-mail]> woke up with a head full of whiskey and
wrote:

> J.P. Pasnak [Warped Systems] -> comp.os.os2.misc:
>
> ε I'm looking for an OS/2 PM program that will act as a 'front-end' to a
> ε burned CD, but have had no luck.  What I was looking for was something
> ε that could read a text file, display info about the program and launch
> ε it.  I've seen several for Win and DOS, but none for OS/2.
> ε
> ε Is there anything like this out there, or tips on how to go about
> ε making one?
>
> What about using a custom .html file you launch in Netscape as a front end?
>
> Best regards,
>
> m a r t i n | n
>

I would want the ability to launch the install program, and unless
there is something I've missed (and there very well could be),
Netscape can't do this.


J.P. Pasnak
Warped Systems
******************
http://members.xoom.com/Warped/every/everything.html
http://members.xoom.com/Warped/every/dirmap.html
http://clubs.yahoo.com/clubs/warpedusers
*******************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warped Systems (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    05-Sep-99 16:48:14
  To: All                                               05-Sep-99 21:13:20
Subj: Re: Imation IDE Super Disks and OS/2

From: [e-mail] (John Hong)

William Sonna ([e-mail]) wrote:

: Thanks, that did the trick!!!!  Now I have a drive B (in addition to
: my floppy drive A).

: Now, one final question (opinion) - is it worth the trouble to set the
: super drive up as A:?

: For example - have you had any experience/difficulties
: reinstalling/installing OS/2 on one of these devices configured as A:?

    Personally, I'd keep it as is (A: - 3.5" floppy, B: LS-120).  I
have noticed that the LS-120 sort of eats my older 3.5" diskettes.  I
suppose one's made in 1989 had no idea that a laser servo would someday
read them. :-)
    One thing that I have noticed is that the heads on the LS-120
seem to get dirtier more quickly when always under constent use.  No
problem if you have a LS-120 head cleaner kit, otherwise...  You will
often at times get a lot of instances where you stick in a diskette, then
it goes and makes that whirling noise, clicks, then the whirling noise
again, repeat this a couple of times and then you get a blue screen
saying that there is no diskette inserted, eject the disk, re-insert the
disk, and everything is fine again.  Get's to be a pain at times.
However, that is with my clunker 1x model.  I assume you have the 2x
since I don't think any store carries the old 1x models nowadays.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                     05-Sep-99 10:57:08
  To: All                                               05-Sep-99 21:13:20
Subj: Re: [OT] Did I kill my laptop?

From: [e-mail] (J.P. Pasnak)

On Sun, 5 Sep 1999 06:35:12, [e-mail] woke up with a
head full of whiskey and wrote:

> Greetings!
>
> I undertook today what I _thought_ would be a harmless manoeuvre. I have
> an old Sager Notebook (Model 6200rt) parts of which I've decided to
> upgrade. The new cpu came today so I decided to install it.
>
> After some futzing, I was finally able to lift the old one out and put in
> the new one. It's a move from 166MMX to 233MMX.
>
> But now the laptop doesn't boot. It starts, I can see the HDD gets touched
> for a brief moment and then nothing. The fan is whirring but nothing else
> is in operation and I'm facing a black screen. I put the old cpu back in
> and the same.
>
> I guess my question is, Could the new cpu have somehow blown a circuit,
> have done real damage?
>
> It's a disappointment; I finally had it running almost everything I
> wanted: a solid install of W95, OS/2 and RH Linux.
>
> Both cpu's are the same voltage (2.8V) and I didn't change any voltage
> settings (can't - don't know how on this MB). I've tried firming up any
> loose connections. I pulled and reseated the HD.
>
> The notebook is legacy but I'd looked forward to getting more years of
> productivity with a ram, cpu and HD upgrade. I fear I'm now in the market
> for another laptop. Requirements? Must be fully functional in W95, OS/2
> and Linux.
>

More than likely it was not the CPU, but 'outside human interferance'
(static electricity) than hosed your system.

If your looking for a new laptop try The Notebook/2 site
(http://www.os2ss.com/users/DrMartinus/notebook.htm)

J.P. Pasnak
Warped Systems
******************
http://members.xoom.com/Warped/every/everything.html
http://members.xoom.com/Warped/every/dirmap.html
http://clubs.yahoo.com/clubs/warpedusers
*******************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warped Systems (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           05-Sep-99 09:54:21
  To: All                                               05-Sep-99 21:13:20
Subj: Re: UMAX + Win-OS/2

From: [e-mail]

In <yHQxxE9f8dqd-pn2-fh58575kDUet@POBLANO>, on 09/05/99
   at 06:02 AM, [e-mail] (Stan Goodman) said:

>You probably have an excellent reason for not getting e.g. the CFM
>driver,  so that you could use the scanner under a native OS/2
>application. That's  how I am using my UMAX SCSI scanner.

Anyone with a 610S has an excellent reason. CFM does not make a TWAIN
driver for the 610S, although they make one for the 1220S. When I asked
CFM, they said they had no plans to produce a 610S Twain driver.

The only way I've been able to get my scanner to function under OS/2 at
all is to change to an Adaptec SCSI card, and then install the software
that came with the scanner under WINOS2.

Bob.

--
-----------------------------------------------------------
[e-mail]
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Islandnet.com in B.C. Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail] [Ron]                      05-Sep-99 10:05:11
  To: All                                               05-Sep-99 21:13:20
Subj: Re: Moving OS/2

From: [e-mail] [Ron]

>> The disadvantage (if it is one) is that logical
>> partitions are blind to other logical partitions.
>
>Whoops, I meant *primary* partitions are blind to other
>primaries.
>

Yes I figured that's what you meant. Thank you for the helpful
information. You are right in that I need to make room for a Winblows
98 partition; I need it for something for work. But I'm really doing
this because I wish to keep my good 'ol DOS partition in addition to
'98 plus OS/2 and hopefully sometime a bit later, Linux.  I already
have boot manager up and running. But here's a question. I've got two
separate physical drives. Can I allocate a primary partition on the
second drive, have it seen as C:, and just restore OS/2 there? Or do I
need to do something funky first to make the two primaries on drive 1
invisible to OS/2, such as 1 hidden by BM and make W98 FAT32, before
that would work? Or maybe is there an alternative to BM, such as
System Commander where you can just tell it what drive letter you want
each partition to be for each OS? That would be ideal.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Concentric Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           05-Sep-99 10:00:14
  To: All                                               05-Sep-99 21:13:20
Subj: Re: UMAX + Win-OS/2

From: [e-mail]

In <7qtepp$lee$[e-mail]>, on 09/05/99
   at 09:57 AM, [e-mail] (John Hong) said:

>Stan Goodman ([e-mail]) wrote:
>: You probably have an excellent reason for not getting e.g. the CFM driver,
>: so that you could use the scanner under a native OS/2 application. That's
>: how I am using my UMAX SCSI scanner.

>    Yes.  CFM Support gave it to me, it went along the lines of the  UMAX
>610S is not supported due to UMAX not give them any documentation on  the
>spec's.  I had already checked with CFM and STi about this and  neither
>will support it.
>    So...any other helpful advice?  Anyone?


You are using the OS2ASPI.dmd file, right? Not Adaptecs ASPI4OS2.sys?

( I had to add the following two lines in my config.sys file before I
could get Vistascan to work

BASEDEV=OS2ASPI.DMD /SHARE
DEVICE=C:\OS2\MDOS\VASPI.SYS

And that's with an Adaptec 2906 in my case.)

Bob.



--
-----------------------------------------------------------
[e-mail]
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Islandnet.com in B.C. Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                        05-Sep-99 18:13:03
  To: All                                               06-Sep-99 04:16:14
Subj: Re: Moving OS/2

From: Daniel Say <[e-mail]>

[e-mail] wrote:
:>> The disadvantage (if it is one) is that logical
:>> partitions are blind to other logical partitions.
:>Whoops, I meant *primary* partitions are blind to other :>primaries.

: Yes I figured that's what you meant. Thank you for the helpful
: information. You are right in that I need to make room for a Winblows
: 98 partition; I need it for something for work. But I'm really doing
: this because I wish to keep my good 'ol DOS partition in addition to
: '98 plus OS/2 and hopefully sometime a bit later, Linux.  I already
: have boot manager up and running. But here's a question. I've got two
: separate physical drives. Can I allocate a primary partition on the
: second drive, have it seen as C:, and just restore OS/2 there? Or do I
    No.  One primary, the second physical will be
    D:, r: s: etc. depending on what your Physical One is
    divided into.

    C: for DOS and win9X is a must,
    but with the small kernel for the above
    and a boot manager, you can put much
    of Win9X, DOS, and "all of OS/2" on
    another logical/physical.

    Get Partition Magic for its notes and
    tools including remapping drives
: need to do something funky first to make the two primaries on drive 1
: invisible to OS/2, such as 1 hidden by BM and make W98 FAT32, before
: that would work? Or maybe is there an alternative to BM, such as
: System Commander where you can just tell it what drive letter you want
: each partition to be for each OS? That would be ideal.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Simon Fraser University (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            05-Sep-99 14:31:16
  To: All                                               06-Sep-99 04:16:14
Subj: Re: [OT] Did I kill my laptop?

From: [e-mail]

In <[e-mail]>, on 09/05/99
   at 10:57 AM, [e-mail] (J.P. Pasnak) said:


>More than likely it was not the CPU, but 'outside human interferance'
>(static electricity) than hosed your system.

Sigh.

>If your looking for a new laptop try The Notebook/2 site
>(http://www.os2ss.com/users/DrMartinus/notebook.htm)

Yep, I've looked there. I'm about to do a typical American thing and go
shopping on Labor Day Sunday.

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             05-Sep-99 18:29:23
  To: All                                               06-Sep-99 04:16:14
Subj: Re: Rexx/exe cgi-bin to show system uptime

From: [e-mail] (Dominique Pivard)

On Sun, 5 Sep 1999 15:41:45, [e-mail] (Khairil
Yusof) wrote:
>
> Thanks that did the trick.. Quite a flexible program, you can edit it to
change
> any text files. Only gripe is the time output format which is fixed.
Hopefully
> it can be modified in a later version.

V. 1.6 was released on Sep-2 and v. 1.5 on Aug-10, which seems to
indicate the author is actively working on it. Maybe you should
contact him directly in order to influence the time format.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: None!! (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    05-Sep-99 18:54:18
  To: All                                               06-Sep-99 04:16:14
Subj: Re: UMAX + Win-OS/2

From: [e-mail] (John Hong)

[e-mail] wrote:

: You are using the OS2ASPI.dmd file, right? Not Adaptecs ASPI4OS2.sys?

    Yep.

: ( I had to add the following two lines in my config.sys file before I
: could get Vistascan to work

: BASEDEV=OS2ASPI.DMD /SHARE
              ^^^^^^

    I've been emailing someone else about this, too.  His OS2ASPI.DMD
is set to /SHARE.  Mine is currently /ALL because of the CDRecord/2
software.  Hmmm, I wonder if adding both /SHARE & /ALL would be ok.  I'd
hate to have to switch back and forth.  I'll see what happens after I try
it out.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  04-Sep-99 10:49:25
  To: All                                               06-Sep-99 04:16:14
Subj: Re: Daylight Savings Time and OS/2 Warp

From: Tony Wright <[e-mail]>

Alex Taylor wrote:

> On Wed, 01 Sep 1999 18:13:38 -0500, Dan Casey <[e-mail]> wrote:
> > >How can we force this to occur?
> > >We got a customer that wants to know how they can test
> > >this change?
> >...
> >
> > If I wanted to force it to automatically change to DST (and back
> > again) I'd set it:
> >
> > SET TZ=EST5EDT
> >
> > I use a program called Time868 to automatically sync my system clock
> > with the the Naval Observatory. It uses an Internet connection to do
> > it, is very easy to setup and run, and includes a text file that goes
> > into much greater detail on the TZ variable than the online help files
> > in OS/2 Warp do. You can find it on hobbes.
>
> I've been trying to figure out how to do this myself - we have several
> OS/2 production servers.  We've been trying to automate as much as
> possible, unfortunately, we still have to do the DST time change
> manually.
>
> I've been looking for a program that will do this automatically,
> however, all the time-management programs seem to be based on
> connecting to a NTP server.

I thought you had the possibility of using an accurate RTC adapter
card(if you won't/can't have one dialout modem) in one server and then
use TIMESOURCE option in IBMLAN.ini for other servers/clients to synch
to that?
Worst case (albeit an overkill for just this time source) wouldn't you
only need an additional TCP stack on the one server and say an admins
client workstation only?
You could then say dial in and get an accurate time check during working
hours and let Time868 or similiar on server then access your workstation
to adjust for DST out of hours? Time is subsequently propogated to other
servers/clients via TIMESOURCE variable?

Depending on the "effort" quantified for doing the change "manually"
then even a little creative REXX could analyse the TZ variable and
(re)set DST automatically for you on your master  Time server?
By judicious branching to various SLEEP variables(or in combination with
AT scheduler) you could minimise the overhead or having something
"polling" continually.....?
Additionally if was placed on say a print server that is less likely to
be loaded during the early hours of the am when most DST adjustments
occur?
(you might even find that your print servers are still running TCP
stacks by default via MarkNet/JetAdmin even though it's not used on
remainder of network? - but if you havn't got a firewall then it
probably buys you little unless provision  of modem/dialout is assessed
as minimal risk on these servers?)

> Our systems, however, are on a closed network (non-IP, at that).
>
> --
> -----------------------------------------------------------------
>  Alex Taylor                  BA - CIS - University of Guelph
>  [e-mail]   http://eddie.cis.uoguelph.ca/~alex
> -----------------------------------------------------------------



--
Rgds Tony W   Email: [e-mail]

"humanum est errare: To err is human
.... and to fail is to be a Project Manager...
...but to foul things up completely needs a computer!"


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Equi-Tek CompCon (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  05-Sep-99 11:24:13
  To: All                                               06-Sep-99 04:16:14
Subj: Re: Moving OS/2

From: Tony Wright <[e-mail]>

Raphael Tennenbaum wrote:

> [e-mail] [Ron] wrote:
>
> >I would like to move my OS/2 installation from a C: Primary partition
> >to a D: Logical partition. Other than reinstalling or restoring from
> >the backup tape (which would make it non-bootable) is there any way
> >to do that?
>
> The short answer is, no.  The system files will transfer and
> boot, but there's really no way to move your desktop over --
> theoretically it's possible but it would be more trouble
> than rebuilding your desktop (and in fact I've never hard of
> anyone managing it successfully).

Tis indeed the short answer<g>....

I'm not totally disagreeing with your statements(except possibly the
last part in parenthesis which you may now wish to revise in future<g>)
as I guess the effort is dependent on the amount of desktop
customisation and ones knowledge?.
But doesn't using "portable desktop" backup option in say Unimaint
provide some versatility to do just this almost "out-of-the-box"?
Or are we limiting the answer(s) to free/shareware and non-programmatic
solutions?

> I can handle the boot manager setup and manual config.sys
> >changes. Is there any way to copy the desktop, ini files and so on, so
> >that everything points from D: instead of C:? Reinstalling OS/2 is
> >not such a big deal, it's reinstalling all the software apps (on E:)
> >just to get the desktop right that would take days.
Re-installing software apps(if they're are already on a seperate
partition) seems like a distinct overkill?
Another thought perhaps is updating the migration database so that it
includes any of your apps not allready listed?

>
> What you might consider, if you really don't wish to rebuild
> your desktop, is changing your new configuration so that
> you'll in fact be moving to another C: primary.  If you're
> moving stuff or putting in new drives for Windoze, you're
> probably better off keeping that all on its own primary
> anyway -- which, when booted, would be C:.  If OS/2 were on
> its own primary, the Windoze partition would be invisible
> (i.e., inaccessible) and your OS/2 boot partition would then
> be C:  The disadvantage (if it is one) is that logical
> partitions are blind to other logical partitions.

Errr - I'm sure you really meant "primaries" (on same spindle)?
If not perhaps you would kindly elaborate please as to the respective
FS's installed on these "blind" logicals so we get a clearer
picture(and/or before some naive user jumps to wrong conclusion<g>).
> But you
> can install a logical FAT drive should you feel the need to
> share files across both OSes.
>
> Otherwise, you're better off rebuilding your desktop from
> scratch.  (Takes less time than you imagine!)

Not on mine it wouldn't! - unless I used my modified RC files<g>

> There are
> tools which will help: Henk Kelder's WPTOOLs will back up
> your current desktop to a textfile listing all your program
> objects in a way that makes it a bit easier.

Again, depending on the "amount" of customisation on the original
desktop, Henks utilities or other REXX based alternatives that provide
an ASCII listing of desktop objects could easily  be "globally changed"
via any editor to point to new location and then the "new" desktop
subsequently updated using std WPS REXX API calls?
Numerous other utilities(Robosave,SaveFolder etc) or combinations save
even colours and positions..... if necessary.
Even RYO Rexx using Sysini(etc) WPS extensions is relatively
trivial<g>....

But I guess even you could demonstrate some scenarios where it wouldn't
be quite so straightforward without more "creative" thinking and/or
programming?<vbg>
> --
> Ray Tennenbaum        '99 YZF-R6
> readme@ http://www.ray-field.com



--
Rgds Tony W   Email: [e-mail]

"humanum est errare: To err is human
.... and to fail is to be a Project Manager...
...but to foul things up completely needs a computer!"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Equi-Tek CompCon (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      05-Sep-99 21:58:22
  To: All                                               06-Sep-99 05:58:21
Subj: Re: the future of os/2

From: Martin Nisshagen <[e-mail]>

James Knott [Global Network Services - Remote Access Mail & News Services] ->
comp.os.os2.misc:

» Would you consider 4 or 5 occasions inside half an hour rare?  I can
» recreate that situation at will.

I'm sure you can if done intentionally (that they you can crash even a Solaris
server). Have you tried any of the kill utilities in the resource kit?

» >» Furthermore, performance sucks on NT.  When I do my testing NT, takes
» >» me far longer than OS/2 (fastest) or W95.
» >
» >You haven't done your testing very deep me think. OS/2 is a bit difficult
to
» >directly compare as it doesn't run the exactly the same applications (which
I
» >regret as it would have been very interesting to be able to directly combat
» >such statements like yours), but NT4 running the same application as on
Win95
» >is *much* faster (15-35% faster). This has been shown in several
independent
» >tests by both magazines and NSTL. You can also easily do a real test your
self
» >by running some of the several available application bench marks (they
measure
» >real world performance by scripting typical usage of standard
applications).
»
» Some of the applications I test with are available on all three
» platforms. i.e. Personal Communications.  Personal Communications
» works far better on OS/2 than on either Windows version.

This is IMO really pathetic.

1.

IE 5.0 on NT runs better than on Solaris, and no, I don't think it's the fault
of Solaris. You can't compare same application, but different ports as equal.

2.

And in the case that you *can* compare equally, as in the example above
between NT4 and Win95/98, you totally seems to ignore that (even if you a post
earlier stated that Win9x was more efficient than NT4).

» >NT also easily beats Linux as a web server OS in raw performance of serving
» >pure HTML pages on the exact same hardware. Unfortunately I haven't seen
any
» >such comparison and test between OS/2 and other operating systems (but I
doubt
» >very strongly if it would come close to either NT or Linux on same
hardware).
»
» I can't comment Web Servers, but a couple of years ago, one of the
» magazines did a test on file & print servers.  A single CPU Warp
» Server was considerably faster than a single CPU NT server and almost
» as fast as a 4 CPU NT server.

Haven't seen that test, but the last one NT4 Server beat Linux with SAMBA as
file server (and both on same hardware, and single processor machine).

Best regards,

m a r t i n | n

--
Martin Nisshagen                 PGP 6.0: 0x45D423AC      K R A F T W E R K
:-)
CS/CE, Chalmers, Sweden          ICQ UIN: 689662          2 x 300A @ 450 MHz
d4nisse-at-dtek-chalmers-se      home2.sbbs2.com/mn
home2.sbbs2.com/mn/kw

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Chalmers University of Technology, Sweden (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              05-Sep-99 19:58:11
  To: All                                               06-Sep-99 05:58:21
Subj: Trouble installing Warp 4.0, please help

From: [e-mail]

I'm trying to install Warp 4 off of a CD onto drive D:, an HPFS
extended partition, with Windows 2000 installed on C: (it's already
there... I'm using it.) The initial install goes well until the part
with the two moving slashes, when it says something like "Installing
the install program." There's some CD and disk activity for a while,
but then it just stops... the slashes keep going. If I press ctrl-
break, it'll go to the next screen when it tells me to reboot. When I
reboot, everything goes fine (it even bypasses Bootmanager like it
should), but as soom as PM loads up I get a dialog that says "Cannot
start program pointed to by RUNWORKPLACESHELL= in CONFIG.SYS. Error
returned by WinStartApp is %1." (Don't quote me on that). If I try
rebooting, it'll go to Bootmanager, and if I boot into OS/2, I'll get
the same error. I booted to the command line, and in config.sys,
RUNWORKPLACESHELL is PMSHELL.EXE, which does exist in my OS/2
directory. What can I do?

Thanks in advance,
Ron Blatt


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              05-Sep-99 20:03:02
  To: All                                               06-Sep-99 05:58:21
Subj: Re: Please help! Major hard disk crisis!

From: [e-mail]

OK, everything's fine now. I actually got it fixed before I had a
chance to check back here. Could you believe a simple CHKDSK D: /F
worked? I was then able to access the partition, but FDISK still said
that the partition mapping was corrupted. So, I moved everything I have
onto E:, and with DFSee, deleted Bootmanager, C:, and D:. Then with
FDISK, I put them back in, and everything works OK. I even have Win2K
installed... but I can't get OS/2 to install correctly (see new post).
Thanks for the suggestions though.

Ron Blatt


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                     05-Sep-99 18:37:09
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Can I change the fonts in Lotus Word Pro Help?

From: Worley Barry  <[e-mail]>

On Sat, 04 Sep 1999 19:32:12 GMT, Martin Racette wrote:

>On Sat, 4 Sep 1999 09:30:59, Worley
>Barry  <[e-mail]>
>wrote:
>
>> Or more precisely, how can I change Word Pro Help font? I am
>> a brand new Word Pro wanta be user.
>>
    [Snip]
>
>Check on the install CD-ROM there is a
>directory called "\EXTRA\ALT_HELP" that
>contains many EXE files to make the help
>with a bigger font
>
Thanks Martin,

    I'd have looked a long time before I found those Zip Files.

Worley

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://extra.newsguy.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    05-Sep-99 20:26:16
  To: All                                               06-Sep-99 05:58:22
Subj: Microsoft Word 5.5b Download

From: [e-mail] (John Hong)

http://officeupdate.microsoft.com/downloadDetails/Wd55eng.htm

Microsoft is giving Word 5.5b away as a complimentary upgrade for Word 5.0
for DOS users.  Some will find out however that this was one of the few
Microsoft titles that worked natively for OS/2.  The executable (word.exe)
can be run from either DOS or OS/2.  Microsoft recommends that you upgrade
before December 31, 1999.  (I take it something bad happens :-).

This is a 16-bit OS/2 text application, made during the OS/2 1.x days.  I
checked to see if they did the same with the older version of Microsoft
Excel, but so far, no go.


http://officeupdate.microsoft.com/downloadDetails/Wd55ben.htm

This is for the international english.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            05-Sep-99 21:37:13
  To: All                                               06-Sep-99 05:58:22
Subj: Re: [OT] Did I kill my laptop?

From: Tim Timmins <[e-mail]>

Did you try putting the old CPU back?

What jumpers/BIOS settings DID you change?

[e-mail] wrote:

> In <[e-mail]>, on 09/05/99
>    at 10:57 AM, [e-mail] (J.P. Pasnak) said:
>
> >More than likely it was not the CPU, but 'outside human interferance'
> >(static electricity) than hosed your system.
>
> Sigh.
>
> >If your looking for a new laptop try The Notebook/2 site
> >(http://www.os2ss.com/users/DrMartinus/notebook.htm)
>
> Yep, I've looked there. I'm about to do a typical American thing and go
> shopping on Labor Day Sunday.
>
> F.
>
> -----------------------------------------------------------
>       Felmon John Davis
>      [e-mail]   |  [e-mail]
>      Union College /  Schenectady, NY
>      - insert standard doxastic disclaimers -
>      OS/2 - ma kauft koi katz em sack
> -----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            05-Sep-99 21:39:10
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Trouble installing Warp 4.0, please help

From: Tim Timmins <[e-mail]>

Is you disk > 8.4 gigs?
If so, you need the IDEDASD.EXE fix to support large disks.

[e-mail] wrote:

> I'm trying to install Warp 4 off of a CD onto drive D:, an HPFS
> extended partition, with Windows 2000 installed on C: (it's already
> there... I'm using it.) The initial install goes well until the part
> with the two moving slashes, when it says something like "Installing
> the install program." There's some CD and disk activity for a while,
> but then it just stops... the slashes keep going. If I press ctrl-
> break, it'll go to the next screen when it tells me to reboot. When I
> reboot, everything goes fine (it even bypasses Bootmanager like it
> should), but as soom as PM loads up I get a dialog that says "Cannot
> start program pointed to by RUNWORKPLACESHELL= in CONFIG.SYS. Error
> returned by WinStartApp is %1." (Don't quote me on that). If I try
> rebooting, it'll go to Bootmanager, and if I boot into OS/2, I'll get
> the same error. I booted to the command line, and in config.sys,
> RUNWORKPLACESHELL is PMSHELL.EXE, which does exist in my OS/2
> directory. What can I do?
>
> Thanks in advance,
> Ron Blatt
>
> Sent via Deja.com http://www.deja.com/
> Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 05-Sep-99 15:47:15
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Post your tips/solutions at os2.org

From: [e-mail] (Richard Steiner)

Here in comp.os.os2.misc, [e-mail] (Khairil Yusof)
spake unto us, saying:

>If when people solved problems, or figure out a neat trick with OS/2 to
>take 5 mins and post it at the forums at os2.org.

No offense intended, but isn't that terribly redundant when all the
postings to Usenet are already archived in multiple places?

Or are you talking about things which we wouldn't normally post in
response to a question on Usenet?

--
   -Rich Steiner  >>>--->  [e-mail]  >>>---> Bloomington, MN
     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
    Profanity: the single language in which all programmers are expert.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 05-Sep-99 15:51:03
  To: All                                               06-Sep-99 05:58:22
Subj: Re: the future of os/2

From: [e-mail] (Richard Steiner)

Here in comp.os.os2.misc, Martin Nisshagen <[e-mail]>
spake unto us, saying:

>NT also easily beats Linux as a web server OS in raw performance of
>serving pure HTML pages on the exact same hardware.

Are you referring to the Mindcraft tests, or some other source of data?

There have been a number of questions about the Mindcraft tests (such
as the low probability of a real-world web server having the same type
of hardware configuration as the test machine).

--
   -Rich Steiner  >>>--->  [e-mail]  >>>---> Bloomington, MN
     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
     I almost had a psychic girlfriend but she left me before we met.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            05-Sep-99 17:20:09
  To: All                                               06-Sep-99 05:58:22
Subj: Re: [OT] Did I kill my laptop?

From: [e-mail]

In <[e-mail]>, on 09/05/99
   at 09:37 PM, Tim Timmins <[e-mail]> said:


>Did you try putting the old CPU back?

>What jumpers/BIOS settings DID you change?

It's the darnedest but _neither_ CPU works. I didn't change any jumpers or
BIOS settings. Just pulled the old out and put in the new.

I can't really believe I shorted anything but I can't see any other
explanation.

I just get a brief touch of the HD and a running fan when I boot. No BIOS
screen or anything else. I've booted without the HD and the FD, makes no
difference.

Nothing more unnerving than a completely black screen on boot-up!

F.


-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 05-Sep-99 16:08:29
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Warp4 colors 16 To???

From: [e-mail] (Richard Steiner)

Here in comp.os.os2.misc, [e-mail] (ALDEL) spake unto us, saying:

>I am using Os2/v4 on a Pentium 11 with

What is a Pentium 11?  You mean Pentium II?

>a 4 meg video card, & 15 inch svga monitor.
>The best display color setting I can get is 640-480-16.
>I want to get  256 colors instead of 16.

In order for us to really help you, we'll need to know more information
about your video card.  The specific chipset used on the card would be
helpful, and even knowing the manufacturer and the model of the card
would give us useful information about the card's driver requirements.

The supported resolutions for a given card are usually determined by
the specific video drivers (usually written by the maker of the video
card) you are using, and most video drivers allow you to change the
resolution (and the monitor type) in the System object in your System
Setup folder.

>I changed the Vga setting to svga via install.
>That locks the computer!
>I had os2 vers 3 for some yrs and used the svga
>setting on the install util. it worked fine
>I could get 256 color display or what ever I needed.
>When I do this with Warp 4, the computer locks up.
>I tried all I can think of but nothing works.
>The comp locks and I have to Alt & F1 -F3
>to get it working again.

Sounds like your card might not be supported any more, or else you're
encountering some typoe of hardware conflict.  Without knowing more
about your card, all we can do is make wild guesses.

Question: Is this EXACTLY the same computer hardware that you were
using with Warp 3?  Nothing at all has changed except the version of
OS/2 you are using?

Have you thought about picking up a newer card?  I've seen older Matrox
Milleniums on sites like uBid and eBay for under US$30.

--
   -Rich Steiner  >>>--->  [e-mail]  >>>---> Bloomington, MN
     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
                      Imagine a witty phrase here.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    05-Sep-99 22:15:18
  To: All                                               06-Sep-99 05:58:22
Subj: Re: the future of os/2

From: [e-mail]

In <[e-mail]>, on 09/02/99
   at 01:17 AM, Martin Nisshagen <[e-mail]> said:

>J. R. Fox [EarthLink Network, Inc.] -> comp.os.os2.misc:

>» in the park by comparison.  Just about anything I install into » NT has
>the potential to so badly destabilize the whole damn » mess -- beyond the
>capability of util.s like CONFIGSAFE and » CLEANSWEEP to reverse -- that
>I have to seriously reconsider

>Which application was that (I'm very curious)?

>Have never had *any* application hang any of my NT systems (has happened
>under OS/2 for me), and no, I have never used or needed any such utility.

>» whether it's worth the risk.  You definitely don't ever want » to have
>to rebuild a whole NT partitition from scratch, or pay » to have it done
>for you !  Warp just runs and runs and runs.

>I know have some new machines (less than 2 years old), but also my older
>486 machine I had for over 4 years without a single reinstall needed
>(only upgraded, started out with NT 3.5 and continued with 3.51 up to NT
>4.0).

>» I've had it going for a couple months between reboots.  Just try that ╗
>with NT sometime !

>Years with my machines if you talk _unplanned_ reboot (unfortunately
>changing hardware, device drivers, some network settings and even some
>applications needs to reboot my machine as I work as an consultant and
>tries a lot of things on them).

>Best regards,

>m a r t i n | n


Now that's really interesting.  Funny, I can not keep my *NT FP4, Dell
GX?* workstation up past seven days after which it starts acting-up.  The
only way to correct that is by a complete power down and  reboot .
Naturally I take it down completely on Fridays to avoid this sort of
problem.

We all (most) have to use a Mickisoft OS, and it's not always by choice.


--
-----------------------------------------------------------
Herns Modestil      HernsModestil At Technologist Dot com
-----------------------------------------------------------

To UNSUBSCRIBE from the MR/2 ICE Mailing List, simply send a message with the
subject of UNSUBSCRIBE to [e-mail].

Alternately, visit http://oracle.secant.com/maillist.htm to access
the web-based subscription manager for this list.

The searchable archive for this list seems to have been terminated :(

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            05-Sep-99 18:27:12
  To: All                                               06-Sep-99 05:58:22
Subj: toshiba vs. thinkpad

From: [e-mail]

Greetings!

My trusty Sager has crashed - probably my fault, don't know, feel bad,
gotta move on....

Anyway, I was with the pre-Labor Day crowd down at CompUSA looking at some
lappers, and felt drawn to: [A] Toshiba Celeron 400mhz: 64 DRAM, 6.4G HD,
24X CDROM, 12.1" TFT screen vs. [B] IBM Thinkpad - by memory and notes:
366mhz, 32MB, 4.8G, 12.1" TFT.

The systems are roughly comparable with the Thinkpad costing a bit less
($100).

The salesperson seemed generally well-informed although I found some of
his statements a bit peculiar, so credibility was an issue. I need some
feedback (or even a source where I can look up specs and reviews):

[A} He _strongly_ recommended the Toshiba on its overall quality,
durability and support. What do you think?

[b] He agreed with me that the Thinkpad is liable to support OS/2 a bit
better but I don't anticipate any real problems running OS/2 and Linux on
either machine. I intend to run Windows9x, OS/2 and Linux. What do you
think?

[c] I couldn't really view the Toshiba screen (they didn't have a working
set-up running, just the Toshiba information screen) but the Thinkpad
looked damned sharp and crisp. I guess this is a variant of question #1:
what do you think of screen quality?

Last thing, a general question: CompUSA always wants to sell 'insurance'.
I am a bit tempted to buy the repair policy for the screen which adds an
additional $200 for about 3 yrs coverage. What do you think?

I am eager to get up and running again since I've grown used to having the
laptop run side-by-side with my Desktop and feel denuded without it. I am
eager for any good insights.

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  05-Sep-99 22:40:00
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Imation IDE Super Disks and OS/2

From: Serge Desaulniers <[e-mail]>

John Hong wrote :
>
> William Sonna ([e-mail]) wrote:
>
> : Thanks, that did the trick!!!!  Now I have a drive B (in addition to
> : my floppy drive A).
>
> : Now, one final question (opinion) - is it worth the trouble to set the
> : super drive up as A:?
>
> : For example - have you had any experience/difficulties
> : reinstalling/installing OS/2 on one of these devices configured as A:?
>
>         Personally, I'd keep it as is (A: - 3.5" floppy, B: LS-120)...

(some good advice snipped)

I agree. The LS-120 is great for backing up data. As a replacement
floppy, it's not all that it's cracked up to be... (I think it's kinda
slow) Also, I guess the less you use it, the longer it will last. If I
have to replace a drive, i'd rather replace a regular floppy than a
LS-120!!!

--
Serge Desaulniers
sd AT vif DOT com
-----------------
To E-mail directly, please remove NOSPAM...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: VIF Internet (vif.com) (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                 05-Sep-99 15:50:23
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Moving OS/2

From: [e-mail] (Raphael Tennenbaum)

[e-mail] [Ron] wrote:

>shnip>
>
>Yes I figured that's what you meant. Thank you for the helpful
>information. You are right in that I need to make room for a Winblows
>98 partition; I need it for something for work. But I'm really doing
>this because I wish to keep my good 'ol DOS partition in addition to
>'98 plus OS/2 and hopefully sometime a bit later, Linux.  I already
>have boot manager up and running. But here's a question. I've got two
>separate physical drives. Can I allocate a primary partition on the
>second drive, have it seen as C:, and just restore OS/2 there? Or do I
>need to do something funky first to make the two primaries on drive 1
>invisible to OS/2, such as 1 hidden by BM and make W98 FAT32, before
>that would work? Or maybe is there an alternative to BM, such as
>System Commander where you can just tell it what drive letter you want
>each partition to be for each OS? That would be ideal.

There's actually a pretty decent discussion of primary
versus logical partitions in the documents that come with
OS2 as I remember.  Then again, I've probably read it four
times and still can't remember all the rules.

As my comrade Daniel Say also points out, you can put part
of your W9x or NT stuff on the C: partition and then have
the rest of it reside elsewhere, though I've never done
this.  Haven't used System Commander, either, but I'm pretty
sure it can do what you say.  And, as long as I'm wasting
bandwidth with my ignorance -- I'd go for the former
solution (don't have to lay out for SC).

--
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                 05-Sep-99 15:59:27
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Moving OS/2

From: [e-mail] (Raphael Tennenbaum)

Tony Wright <[e-mail]> wrote:

>Raphael Tennenbaum wrote:
>
>> [e-mail] [Ron] wrote:
>>
>> >I would like to move my OS/2 installation from a C: Primary partition
>> >to a D: Logical partition. Other than reinstalling or restoring from
>> >the backup tape (which would make it non-bootable) is there any way
>> >to do that?
>>
>> The short answer is, no.  The system files will transfer and
>> boot, but there's really no way to move your desktop over --
>> theoretically it's possible but it would be more trouble
>> than rebuilding your desktop (and in fact I've never hard of
>> anyone managing it successfully).
>
>Tis indeed the short answer<g>....
>
>I'm not totally disagreeing with your statements(except possibly the
>last part in parenthesis which you may now wish to revise in future<g>)

Dunned.  I mean, done.  :)

>>as I guess the effort is dependent on the amount of desktop
>customisation and ones knowledge?.
>But doesn't using "portable desktop" backup option in say Unimaint
>provide some versatility to do just this almost "out-of-the-box"?
>Or are we limiting the answer(s) to free/shareware and non-programmatic
>solutions?
>
>big snip>

Consider the gauntlet cast down.  When the time comes for
you to move or even copy an OS/2 installation to a different
drive letter, let us know how you do it.

I admit that Henk's tools make a great case for trying.
OTOH, when taking everything into consideration: the
possibility for undetected error, all the garbage that
accumulates over the years, and stuff that not even checkini
can get to, not to mention programs you installed once,
hated, and never had the energy to delete & uninstall -- I
think it makes more sense.

But my main point was I've never heard of anyone doing it
successfully.  I'm more than happy to be shown otherwise,
because by the time the Warp 5 client shows up, I'll want to
keep Warp4 on its own partition, and it would be great to
just move at least a sizeable percentage of this desktop
over!

Whaddaya say, Cityboy?  Wanna be our guinea pig?

>>
>> Otherwise, you're better off rebuilding your desktop from
>> scratch.  (Takes less time than you imagine!)
>
>Not on mine it wouldn't! - unless I used my modified RC files<g>
>
>> There are
>> tools which will help: Henk Kelder's WPTOOLs will back up
>> your current desktop to a textfile listing all your program
>> objects in a way that makes it a bit easier.
>
>Again, depending on the "amount" of customisation on the original
>desktop, Henks utilities or other REXX based alternatives that provide
>an ASCII listing of desktop objects could easily  be "globally changed"
>via any editor to point to new location and then the "new" desktop
>subsequently updated using std WPS REXX API calls?
>Numerous other utilities(Robosave,SaveFolder etc) or combinations save
>even colours and positions..... if necessary.
>Even RYO Rexx using Sysini(etc) WPS extensions is relatively
>trivial<g>....
,,,


--
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                       05-Sep-99 23:13:18
  To: All                                               06-Sep-99 05:58:22
Subj: Re: toshiba vs. thinkpad

From: "Marek Kupsta" <[e-mail]>

<[e-mail]> wrote in message
news:37d2f117$3$qnivfs$[e-mail]...
> Greetings!
>
> My trusty Sager has crashed - probably my fault, don't know, feel bad,
> gotta move on....
>
> Anyway, I was with the pre-Labor Day crowd down at CompUSA looking at some
> lappers, and felt drawn to: [A] Toshiba Celeron 400mhz: 64 DRAM, 6.4G HD,
> 24X CDROM, 12.1" TFT screen vs. [B] IBM Thinkpad - by memory and notes:
> 366mhz, 32MB, 4.8G, 12.1" TFT.

Celerons are poor and unstable processors to begin with and I don't
recommend this CPU on Desktop or Notebooks.

> The systems are roughly comparable with the Thinkpad costing a bit less
> ($100).
>
> The salesperson seemed generally well-informed although I found some of
> his statements a bit peculiar, so credibility was an issue. I need some
> feedback (or even a source where I can look up specs and reviews):
>
> [A} He _strongly_ recommended the Toshiba on its overall quality,
> durability and support. What do you think?

Toshiba sucks at notebooks. Their poor, unstable (even in NT). IBM Thinkpads
are the best from my point of view. I have a thinkpad running @ 266MHz, it
flys! I worked with both notebooks and I recommend ThinkPads (with Pentium
MMX, 2, or 3 processors)

> [b] He agreed with me that the Thinkpad is liable to support OS/2 a bit
> better but I don't anticipate any real problems running OS/2 and Linux on
> either machine. I intend to run Windows9x, OS/2 and Linux. What do you
> think?
>
> [c] I couldn't really view the Toshiba screen (they didn't have a working
> set-up running, just the Toshiba information screen) but the Thinkpad
> looked damned sharp and crisp. I guess this is a variant of question #1:
> what do you think of screen quality?
>
> Last thing, a general question: CompUSA always wants to sell 'insurance'.
> I am a bit tempted to buy the repair policy for the screen which adds an
> additional $200 for about 3 yrs coverage. What do you think?
>
> I am eager to get up and running again since I've grown used to having the
> laptop run side-by-side with my Desktop and feel denuded without it. I am
> eager for any good insights.
>
> F.
>
> -----------------------------------------------------------
>       Felmon John Davis
>      [e-mail] |  [e-mail]
>      Union College /  Schenectady, NY
>      - insert standard doxastic disclaimers -
>      OS/2 - ma kauft koi katz em sack
> -----------------------------------------------------------
>


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 05-Sep-99 23:09:11
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Post your tips/solutions at os2.org

From: [e-mail]

In <[e-mail]>, [e-mail] (Richard Steiner) writes:
>Here in comp.os.os2.misc, [e-mail] (Khairil Yusof)
>spake unto us, saying:
>
>>If when people solved problems, or figure out a neat trick with OS/2 to
>>take 5 mins and post it at the forums at os2.org.
>
>No offense intended, but isn't that terribly redundant when all the
>postings to Usenet are already archived in multiple places?
>

Don't know about others, but recently for me dejanews has become
totally useless.  Two thousand three hundred advertisements per
search result, layered fifteen deep. A well-organized site of archived
answers to OS/2 problems would be very appreciated here. Hobbes
would be an ideal place, but they probably have plenty to do already.

>--
>   -Rich Steiner  >>>--->  [e-mail]  >>>---> Bloomington, MN
>     OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS
>      + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-)
>    Profanity: the single language in which all programmers are expert.


skål !

----------------------------------------------------------
Härad Ængravvård
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                         05-Sep-99 18:33:09
  To: All                                               06-Sep-99 05:58:22
Subj: ditto easy800 tape back up

From: John Griffin <[e-mail]>

anyone konw where i can get the drivers for this?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                 05-Sep-99 19:06:12
  To: All                                               06-Sep-99 05:58:22
Subj: Re: toshiba vs. thinkpad

From: [e-mail] (Raphael Tennenbaum)

[e-mail] wrote:

>Greetings!

Hiya Felmon!  HC, '79 here.

>My trusty Sager has crashed - probably my fault, don't know, feel bad,
>gotta move on....
>
>Anyway, I was with the pre-Labor Day crowd down at CompUSA looking at some
>lappers, and felt drawn to: [A] Toshiba Celeron 400mhz: 64 DRAM, 6.4G HD,
>24X CDROM, 12.1" TFT screen vs. [B] IBM Thinkpad - by memory and notes:
>366mhz, 32MB, 4.8G, 12.1" TFT.
>
>The systems are roughly comparable with the Thinkpad costing a bit less
>($100).
>
>The salesperson seemed generally well-informed although I found some of
>his statements a bit peculiar, so credibility was an issue. I need some
>feedback (or even a source where I can look up specs and reviews):
>
>[A} He _strongly_ recommended the Toshiba on its overall quality,
>durability and support. What do you think?

The Toshiba keyboards sure feel good, and I think they're
sturdy machines.  I think some have even been able to load
OS/2 on them.  But my Thinkpad has been bulletproof for
going on three years now, and my confidence installing OS/2
on it was justified.

>[b] He agreed with me that the Thinkpad is liable to support OS/2 a bit
>better but I don't anticipate any real problems running OS/2 and Linux on
>either machine. I intend to run Windows9x, OS/2 and Linux. What do you
>think?

You need to identify precisely which model TP it is, and
then hasten to Dr. Martinus's (somewhat gaudy) notebooks-
for-OS/2 site.  The link I have is:

    http://www.os2ss.com/users/DrMartinus/Notebook.htm

but it doesn't seem to be alive right now, could be a
traffic jam.

I seem to remember that not all (if any) of the i-series
Thinkpads will run Warp, but I'm not real sure.

>
>[c] I couldn't really view the Toshiba screen (they didn't have a working
>set-up running, just the Toshiba information screen) but the Thinkpad
>looked damned sharp and crisp. I guess this is a variant of question #1:
>what do you think of screen quality?

I don't put much of a premium on screen so if I say my low-
end 560's TFT screen is perfectly adequate it won't help much.

>Last thing, a general question: CompUSA always wants to sell 'insurance'.
>I am a bit tempted to buy the repair policy for the screen which adds an
>additional $200 for about 3 yrs coverage. What do you think?

The Thinkpads used to come with a very good warrantee -- at
least a year.  My feeling is, if the thing is going to break
from anything but brazen neglect, it'll break in the first
year, and if I'm not sufficiently confident it won't last
longer than that, I ought to get something else.

Then again, when it comes to laptops, my philosophy is
strictly low-end (and probably would be even if my budget
weren't so tight).  I figure lugging the thing around is apt
to shorten its life anyway.

Likewise, I buy a generation behind, mostly to save money.
But in this case, if you get an IBM, you've got a better
chance it'll run OS/2.  I'd get an older model (through
mail-order -- check pricewatch.com for the cheapest models)
I was sure could run OS/2, and stuff it full of memory.

>
>I am eager to get up and running again since I've grown used to having the
>laptop run side-by-side with my Desktop and feel denuded without it. I am
>eager for any good insights.

Put your clothes back on and get a Thinkpad.

-Ray (a/k/a Rafe)



>
>F.
>
>-----------------------------------------------------------
>      Felmon John Davis
>     [e-mail]    |  [e-mail]
>     Union College /  Schenectady, NY
>     - insert standard doxastic disclaimers -
>     OS/2 - ma kauft koi katz em sack
>-----------------------------------------------------------
>

--
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            05-Sep-99 20:17:18
  To: All                                               06-Sep-99 05:58:22
Subj: Re: toshiba vs. thinkpad

From: [e-mail]

In <[e-mail]>, on 09/05/99
   at 07:06 PM, [e-mail] (Raphael Tennenbaum)
said:

>[e-mail] wrote:

>>Greetings!

>Hiya Felmon!  HC, '79 here.

Jeez, what a small world! And a Warp-er too!

Hello!

>>>[A} He _strongly_ recommended the Toshiba on its overall quality,
>>durability and support. What do you think?

>The Toshiba keyboards sure feel good, and I think they're
>sturdy machines.  I think some have even been able to load
>OS/2 on them.  But my Thinkpad has been bulletproof for
>going on three years now, and my confidence installing OS/2
>on it was justified.

Sounds good. I've generally heard good things about them, and the
salesperson's opposition to them seemed a bit unjustified.

>>[b] He agreed with me that the Thinkpad is liable to support OS/2 a bit
>>better but I don't anticipate any real problems running OS/2 and Linux on
>>either machine. I intend to run Windows9x, OS/2 and Linux. What do you
>>think?

>You need to identify precisely which model TP it is, and
>then hasten to Dr. Martinus's (somewhat gaudy) notebooks-
>for-OS/2 site.  The link I have is:

>    http://www.os2ss.com/users/DrMartinus/Notebook.htm

Ok, I looked there last night but right, I'll visit it again later
tonight. As I recall, all the IBM's were marked as at least ok for OS/2. I
guess I'm a little bit more concerned about Linux.

It _is_ gaudy almost to the point of illegibility.

>but it doesn't seem to be alive right now, could be a
>traffic jam.

As I said, I was there last night. Worked fine.

>>Last thing, a general question: CompUSA always wants to sell 'insurance'.
>>I am a bit tempted to buy the repair policy for the screen which adds an
>>additional $200 for about 3 yrs coverage. What do you think?

>The Thinkpads used to come with a very good warrantee -- at
>least a year.  My feeling is, if the thing is going to break from
>anything but brazen neglect, it'll break in the first year, and if I'm
>not sufficiently confident it won't last longer than that, I ought to get
>something else.

The main issue here is insurance for the screen. I do think CompUSA makes
some of its prime money from selling these warranties. Still, I'm puzzling
whether it's a good investment.

I'm being extra cautious. I've bought several laptops and never have had
screen insurance. I've been ok.

>Likewise, I buy a generation behind, mostly to save money.
>But in this case, if you get an IBM, you've got a better
>chance it'll run OS/2.  I'd get an older model (through
>mail-order -- check pricewatch.com for the cheapest models)
>I was sure could run OS/2, and stuff it full of memory.

I know I _should_ do this but I'm too impatient right now, but I'll take a
look at pricewatch. I'd like to be up and running _yesterday_ (about when
my old laptop collapsed).

>>
>>I am eager to get up and running again since I've grown used to having the
>>laptop run side-by-side with my Desktop and feel denuded without it. I am
>>eager for any good insights.

>Put your clothes back on and get a Thinkpad.

>-Ray (a/k/a Rafe)

I sometimes feel _most_ denuded when I'm dressed.

I see another post with some good advice but I have to run.

Felmon


-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  05-Sep-99 18:47:18
  To: All                                               06-Sep-99 05:58:22
Subj: Re: toshiba vs. thinkpad

From: Chuck McKinnis <[e-mail]>

I have an IBM Thinkpad 385ED, 166Mhz, 80Mb, 2.1Gb.  I have installed
everything from OS/2 1.2 to Warp Server for e-Business on it.  I hauled
it to Honduras for 3 months following in the wake of hurricane "Mitch".
A half of the time, it was the only system we had working in the mission
house.  Many time the power would drop below 90 volts (if it stayed on
at all) and every other system would bite the dust (including a Compaq
laptop).  With OS/2 I could do things that no else seemed to able to
handle.  Like another missionary who called one day with a sad tale of
woe about the 4Mb piece of e-mail that he could not get to download.
Logged on to his account in preview mode and blew it away (thing someone
had sent him a picture of his entire congregation).  Used it to access
everything through the local ISP (you haven't had fun with an ISP until
you have tried the Honduran government telephone company).  My only
mishap was when someone danced on the end of the power adapter.  Was
fairly easy to get someone coming in with a relief party to bring me
another (ordered online and has it shipped to them).

[e-mail] wrote:
>
> Greetings!
>
> My trusty Sager has crashed - probably my fault, don't know, feel bad,
> gotta move on....
>
> Anyway, I was with the pre-Labor Day crowd down at CompUSA looking at some
> lappers, and felt drawn to: [A] Toshiba Celeron 400mhz: 64 DRAM, 6.4G HD,
> 24X CDROM, 12.1" TFT screen vs. [B] IBM Thinkpad - by memory and notes:
> 366mhz, 32MB, 4.8G, 12.1" TFT.
>
> The systems are roughly comparable with the Thinkpad costing a bit less
> ($100).
>
> The salesperson seemed generally well-informed although I found some of
> his statements a bit peculiar, so credibility was an issue. I need some
> feedback (or even a source where I can look up specs and reviews):
>
> [A} He _strongly_ recommended the Toshiba on its overall quality,
> durability and support. What do you think?
>
> [b] He agreed with me that the Thinkpad is liable to support OS/2 a bit
> better but I don't anticipate any real problems running OS/2 and Linux on
> either machine. I intend to run Windows9x, OS/2 and Linux. What do you
> think?
>
> [c] I couldn't really view the Toshiba screen (they didn't have a working
> set-up running, just the Toshiba information screen) but the Thinkpad
> looked damned sharp and crisp. I guess this is a variant of question #1:
> what do you think of screen quality?
>
> Last thing, a general question: CompUSA always wants to sell 'insurance'.
> I am a bit tempted to buy the repair policy for the screen which adds an
> additional $200 for about 3 yrs coverage. What do you think?
>
> I am eager to get up and running again since I've grown used to having the
> laptop run side-by-side with my Desktop and feel denuded without it. I am
> eager for any good insights.
>
> F.
>
> -----------------------------------------------------------
>       Felmon John Davis
>      [e-mail]   |  [e-mail]
>      Union College /  Schenectady, NY
>      - insert standard doxastic disclaimers -
>      OS/2 - ma kauft koi katz em sack
> -----------------------------------------------------------

--
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    06-Sep-99 01:10:01
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Imation IDE Super Disks and OS/2

From: [e-mail] (William Sonna)

On Sun, 5 Sep 1999 16:48:29, [e-mail] (John
Hong) wrote:

> William Sonna ([e-mail]) wrote:
>
> : Thanks, that did the trick!!!!  Now I have a drive B (in addition to
> : my floppy drive A).
>
> : Now, one final question (opinion) - is it worth the trouble to set the
> : super drive up as A:?
>
> : For example - have you had any experience/difficulties
> : reinstalling/installing OS/2 on one of these devices configured as A:?
>
>     Personally, I'd keep it as is (A: - 3.5" floppy, B: LS-120).  I
> have noticed that the LS-120 sort of eats my older 3.5" diskettes.  I
> suppose one's made in 1989 had no idea that a laser servo would someday
> read them. :-)
>     One thing that I have noticed is that the heads on the LS-120
> seem to get dirtier more quickly when always under constent use.  No
> problem if you have a LS-120 head cleaner kit, otherwise...  You will
> often at times get a lot of instances where you stick in a diskette, then
> it goes and makes that whirling noise, clicks, then the whirling noise
> again, repeat this a couple of times and then you get a blue screen
> saying that there is no diskette inserted, eject the disk, re-insert the
> disk, and everything is fine again.  Get's to be a pain at times.
> However, that is with my clunker 1x model.  I assume you have the 2x
> since I don't think any store carries the old 1x models nowadays.
>

Thanks for the advice, and after one or two attempted read/writes to
floppy, I have to agree - the "compatability" with 3.5" floppies is
more theoretical than practical.

One interesting sidenote - the drive boots OS/2 off of my BootOs2
floppy just fine.  This means the drive has the potential to be pretty
much the ideal "hard drive" for my comm server (a dedicated comm
port/internet server running InJoy, TCP/IP,and NETBIOS and nothing
else), or any other such dedicated machine.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    06-Sep-99 01:10:15
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Imation IDE Super Disks and OS/2

From: [e-mail] (William Sonna)

On Sun, 5 Sep 1999 22:40:01, Serge Desaulniers <[e-mail]>
wrote:

> John Hong wrote :
> >
> > William Sonna ([e-mail]) wrote:
> >
> > : Thanks, that did the trick!!!!  Now I have a drive B (in addition to
> > : my floppy drive A).
> >
> > : Now, one final question (opinion) - is it worth the trouble to set the
> > : super drive up as A:?
> >
> > : For example - have you had any experience/difficulties
> > : reinstalling/installing OS/2 on one of these devices configured as A:?
> >
> >         Personally, I'd keep it as is (A: - 3.5" floppy, B: LS-120)...
>
> (some good advice snipped)
>
> I agree. The LS-120 is great for backing up data. As a replacement
> floppy, it's not all that it's cracked up to be... (I think it's kinda
> slow) Also, I guess the less you use it, the longer it will last. If I
> have to replace a drive, i'd rather replace a regular floppy than a
> LS-120!!!
>

Makes sense - thanks for the tip.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              06-Sep-99 01:39:15
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Daylight Savings Time and OS/2 Warp

From: James Moe <[e-mail]>


Alex Taylor wrote:
>
> I've been trying to figure out how to do this myself - we have several
> OS/2 production servers.  We've been trying to automate as much as
> possible, unfortunately, we still have to do the DST time change
> manually.
>
> I've been looking for a program that will do this automatically,
> however, all the time-management programs seem to be based on
> connecting to a NTP server.
>
> Our systems, however, are on a closed network (non-IP, at that).
>

    Can you set up one system to dial out peridocally? Or have one that
someone connects to the outside world on a regular basis? We also have a
closed system but one person uses the dialup Internet connection
frequently and I put a NTP client and a DAYTIME server on that machine.
This way the other machines can update their time to that one machine. I
have no stringent time requirements so having all that machines at mist
one second in error is no problem. Using cron or some similar scheduler
automates the time service updates for the local machines.
    NTP is especially attractive since it maintains information about
the clock's drift and corrects for it based on that drift value when the
Internet is not available.


--

sma at rtd dot com
Remove ".spam-not" for email

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sohnen-Moe Associates, Inc (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 06-Sep-99 01:24:18
  To: All                                               06-Sep-99 05:58:22
Subj: Re: [OT] Did I kill my laptop?

From: [e-mail]

In <37d2de93$2$qnivfs$[e-mail]>, [e-mail] writes:
>In <[e-mail]>, on 09/05/99
>   at 09:37 PM, Tim Timmins <[e-mail]> said:
>
>
>>Did you try putting the old CPU back?
>
>>What jumpers/BIOS settings DID you change?
>
>It's the darnedest but _neither_ CPU works. I didn't change any jumpers or
>BIOS settings. Just pulled the old out and put in the new.
>
>I can't really believe I shorted anything but I can't see any other
>explanation.
>
>I just get a brief touch of the HD and a running fan when I boot. No BIOS
>screen or anything else. I've booted without the HD and the FD, makes no
>difference.
>
>Nothing more unnerving than a completely black screen on boot-up!
>
>F.


Look carefully for bent pins, broken connections and such before you
give up. It's really easy to bend a pin inserting a cpu without a zif socket
and not even know it. It's possible *with* a zif socket (hearsay, of course)


>
>-----------------------------------------------------------
>      Felmon John Davis
>     [e-mail]    |  [e-mail]
>     Union College /  Schenectady, NY
>     - insert standard doxastic disclaimers -
>     OS/2 - ma kauft koi katz em sack
>-----------------------------------------------------------
>


skål !

----------------------------------------------------------
Härad Ængravvård
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              06-Sep-99 01:55:17
  To: All                                               06-Sep-99 05:58:22
Subj: Re: problem printing on 2 sides

From: James Moe <[e-mail]>


Roy Vargas wrote:
>
> Does anyone know how to enable the 2-sided printing radio buttons in the
> Job Properties dialog box for the HP 690C series of printers?

    Does the 690 do duplexing?
    If it does, go into the printer driver properties notebook and find
the page that lists the printer options. Enable the duplex option.



--

sma at rtd dot com
Remove ".spam-not" for email

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sohnen-Moe Associates, Inc (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              06-Sep-99 01:58:15
  To: All                                               06-Sep-99 05:58:22
Subj: Re: ditto easy800 tape back up

From: James Moe <[e-mail]>


John Griffin wrote:
>
> anyone konw where i can get the drivers for this?

    It is parallel port, SCSI, IDE, ATAPI?
    There are no drivers, per se, for tape drives. There are onoy the
tape handlers in various backup programs that support the tape drive.



--

sma at rtd dot com
Remove ".spam-not" for email

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sohnen-Moe Associates, Inc (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             06-Sep-99 02:04:12
  To: All                                               06-Sep-99 05:58:22
Subj: Re: toshiba vs. thinkpad

From: [e-mail] (Mark Dodel)

On Sun, 5 Sep 1999 22:27:25, [e-mail] wrote:

-)Greetings!
-)
-)My trusty Sager has crashed - probably my fault, don't know, feel bad,
-)gotta move on....
-)
-)Anyway, I was with the pre-Labor Day crowd down at CompUSA looking at some
-)lappers, and felt drawn to: [A] Toshiba Celeron 400mhz: 64 DRAM, 6.4G HD,
-)24X CDROM, 12.1" TFT screen vs. [B] IBM Thinkpad - by memory and notes:
-)366mhz, 32MB, 4.8G, 12.1" TFT.
-)

I recently bought a Toshiba 2545XCDT.  It' a K6-2
333/64Meg/4.1GigHD/14.1TFT.   I checked the Notebook/2 site and this
one seemed to support OS/2 well.  I even have the LT winmodem working.
 Took a while to figure out PCMCIA support under WSeb, but that is
working now also (PCMCIA support worked on install in Warp4).  No USB
support, since it's an Ali chipset.

-)The systems are roughly comparable with the Thinkpad costing a bit less
-)($100).
-)

I have no experience with the Celeron, but both systems sound pretty
close except for the bigger HD and 64RAM in the Toshiba.  That would
be worth more then $100 in my book, assuming you can get OS/2 and
Linux running on both.

-)The salesperson seemed generally well-informed although I found some of
-)his statements a bit peculiar, so credibility was an issue. I need some
-)feedback (or even a source where I can look up specs and reviews):
-)
-)[A} He _strongly_ recommended the Toshiba on its overall quality,
-)durability and support. What do you think?
-)

I'm very satisfied with the quality and this is a refurbed unit.  I
have had 2 Toshiba Desktops in the past, and service on them was
excellent.  I bought the laptop based on the excellent quality of the
desktops.   I was surprised that the laptop was labelled as Assembled
in the USA.  The small keyboard has a big keyboard feel to it.

-)[b] He agreed with me that the Thinkpad is liable to support OS/2 a bit
-)better but I don't anticipate any real problems running OS/2 and Linux on
-)either machine. I intend to run Windows9x, OS/2 and Linux. What do you
-)think?
-)

Depends on the TP model.  IBM is dropping OS/2 testing on some of the
newer low end models.


-)[c] I couldn't really view the Toshiba screen (they didn't have a working
-)set-up running, just the Toshiba information screen) but the Thinkpad
-)looked damned sharp and crisp. I guess this is a variant of question #1:
-)what do you think of screen quality?
-)

Can't compare since I've never had a TP.  The 14.1" screen on my
Toshiba is great at 1024x768
x64k.  I'm using the Scitech Display Doctor driver, but prior to that
the Sager S3 Virge driver I got off of the Notebook/2 site also worked
well.

-)Last thing, a general question: CompUSA always wants to sell 'insurance'.
-)I am a bit tempted to buy the repair policy for the screen which adds an
-)additional $200 for about 3 yrs coverage. What do you think?
-)

You can buy extended coverage (another 2 years on basic warranty
and/or a warranty on the screen) direct from Toshiba also, but looking
at the costs, I don't see it as being cost effective, but then this
was a refurbed unit that I bought at SurplusAuction for $1400.   If I
get a couple of years out of it I will be happy, and I don't remember
the exact cost, but it was a couple hundred for the length extension
and I think $300 for the screen insurance (it was more for the larger
screen I think)  If you have kids that may screw around with it it
might be worth getting the screen protection, since the base warranty
doesn't cover damage, just defect.

-)I am eager to get up and running again since I've grown used to having the
-)laptop run side-by-side with my Desktop and feel denuded without it. I am
-)eager for any good insights.
-)
-)F.
-)
-)-----------------------------------------------------------
-)      Felmon John Davis
-)     [e-mail]    |  [e-mail]
-)     Union College /  Schenectady, NY
-)     - insert standard doxastic disclaimers -
-)     OS/2 - ma kauft koi katz em sack
-)-----------------------------------------------------------
-)


//---------------------------------------------------------
// From the Desk of: Mark Dodel, RN, BSN, MBA
//             Healthcare Computer Consultant
//                   [e-mail]
//    http://home.ptd.net/~madodel
//
//  For a VOICE in the future of OS/2
//             http://www.os2voice.org/index.html
//---------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PenTeleData http://www.ptd.net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                     05-Sep-99 20:22:21
  To: All                                               06-Sep-99 05:58:22
Subj: Re: [OT] Did I kill my laptop?

From: [e-mail] (J.P. Pasnak)

On Sun, 5 Sep 1999 18:31:33, [e-mail] woke up with a
head full of whiskey and wrote:

> In <[e-mail]>, on 09/05/99
>    at 10:57 AM, [e-mail] (J.P. Pasnak) said:
>
>
> >More than likely it was not the CPU, but 'outside human interferance'
> >(static electricity) than hosed your system.
>
> Sigh.
>
> >If your looking for a new laptop try The Notebook/2 site
> >(http://www.os2ss.com/users/DrMartinus/notebook.htm)
>
> Yep, I've looked there. I'm about to do a typical American thing and go
> shopping on Labor Day Sunday.
>
> F.

Before you give up, check the two most common boot-stoppers, your
memory and your video card.  I should have said this in my first post,
but once again, I jumped the gun.

J.P. Pasnak
Warped Systems
******************
http://members.xoom.com/Warped/every/everything.html
http://members.xoom.com/Warped/every/dirmap.html
http://clubs.yahoo.com/clubs/warpedusers
*******************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warped Systems (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                     05-Sep-99 21:00:07
  To: All                                               06-Sep-99 05:58:22
Subj: Re: Post your tips/solutions at os2.org

From: [e-mail] (J.P. Pasnak)

On Sun, 5 Sep 1999 20:47:30, [e-mail] (Richard Steiner) woke
up with a head full of whiskey and wrote:

> Here in comp.os.os2.misc, [e-mail] (Khairil Yusof)
> spake unto us, saying:
>
> >If when people solved problems, or figure out a neat trick with OS/2 to
> >take 5 mins and post it at the forums at os2.org.
>
> No offense intended, but isn't that terribly redundant when all the
> postings to Usenet are already archived in multiple places?
>
> Or are you talking about things which we wouldn't normally post in
> response to a question on Usenet?
>

I think a good example of what he is talking about is the recent
Imation IDE SuperDisk discussion.  It came down to having both
IBM1S506.ADD and IBMATAPI.FLT installed as BASEDEV, along with the
latest IDEDASD.

This would be a good tip to send their way.


J.P. Pasnak
Warped Systems
******************
http://members.xoom.com/Warped/every/everything.html
http://members.xoom.com/Warped/every/dirmap.html
http://clubs.yahoo.com/clubs/warpedusers
*******************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warped Systems (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              06-Sep-99 03:53:25
  To: All                                               06-Sep-99 10:36:18
Subj: Re: Trouble installing Warp 4.0, please help

From: [e-mail]

I tried the fix. I got the same results

In article <[e-mail]>,
  Tim Timmins <[e-mail]> wrote:
> Is you disk > 8.4 gigs?
> If so, you need the IDEDASD.EXE fix to support large disks.
>
> [e-mail] wrote:
>
> > I'm trying to install Warp 4 off of a CD onto drive D:, an HPFS
> > extended partition, with Windows 2000 installed on C: (it's already
> > there... I'm using it.) The initial install goes well until the part
> > with the two moving slashes, when it says something like "Installing
> > the install program." There's some CD and disk activity for a while,
> > but then it just stops... the slashes keep going. If I press ctrl-
> > break, it'll go to the next screen when it tells me to reboot. When
I
> > reboot, everything goes fine (it even bypasses Bootmanager like it
> > should), but as soom as PM loads up I get a dialog that says "Cannot
> > start program pointed to by RUNWORKPLACESHELL= in CONFIG.SYS. Error
> > returned by WinStartApp is %1." (Don't quote me on that). If I try
> > rebooting, it'll go to Bootmanager, and if I boot into OS/2, I'll
get
> > the same error. I booted to the command line, and in config.sys,
> > RUNWORKPLACESHELL is PMSHELL.EXE, which does exist in my OS/2
> > directory. What can I do?
> >
> > Thanks in advance,
> > Ron Blatt
> >
> > Sent via Deja.com http://www.deja.com/
> > Share what you know. Learn what you don't.
>
>


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           06-Sep-99 04:12:18
  To: All                                               06-Sep-99 10:36:18
Subj: Re: Trouble installing Warp 4.0, please help

From: [e-mail] (Lorne Sunley)

On Mon, 6 Sep 1999 03:53:51, [e-mail] wrote:

> I tried the fix. I got the same results
>
> In article <[e-mail]>,
>   Tim Timmins <[e-mail]> wrote:
> > Is you disk > 8.4 gigs?
> > If so, you need the IDEDASD.EXE fix to support large disks.
> >
> > [e-mail] wrote:
> >
> > > I'm trying to install Warp 4 off of a CD onto drive D:, an HPFS
> > > extended partition, with Windows 2000 installed on C: (it's already
> > > there... I'm using it.) The initial install goes well until the part
> > > with the two moving slashes, when it says something like "Installing
> > > the install program." There's some CD and disk activity for a while,
> > > but then it just stops... the slashes keep going. If I press ctrl-
> > > break, it'll go to the next screen when it tells me to reboot. When
> I
> > > reboot, everything goes fine (it even bypasses Bootmanager like it
> > > should), but as soom as PM loads up I get a dialog that says "Cannot
> > > start program pointed to by RUNWORKPLACESHELL= in CONFIG.SYS. Error
> > > returned by WinStartApp is %1." (Don't quote me on that). If I try
> > > rebooting, it'll go to Bootmanager, and if I boot into OS/2, I'll
> get
> > > the same error. I booted to the command line, and in config.sys,
> > > RUNWORKPLACESHELL is PMSHELL.EXE, which does exist in my OS/2
> > > directory. What can I do?
> > >
> > > Thanks in advance,
> > > Ron Blatt
> > >

It sounds like the installation procedure is hanging up while
it tests out the hardware that is present on the system. The
"Installation Program" requires a set of response files and
configuration info that is generated during this phase. The
ctrl-break kills this process leaving it unfinished.

I've known this process to hang up on some network cards
(such as the SMC Ultra series). What kind of hardware
(network cards, sound cards etc) is present in the machine.

You might try removing some of the add-on cards, network
sound etc and see if it will get by this phase of the install.

The install may also be hanging up on the Windows 2000
C: partition. Is this FAT or is it NTFS (or some variant). You
could try installing OS/2 to a second primary partition. This
would allow the Windows 2000 partition to be hidden during
the installation and anything there would not be able to
interfere with the OS/2 install.

Lorne Sunley


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   06-Sep-99 00:50:29
  To: All                                               06-Sep-99 10:36:18
Subj: Re: Fixpacks for Dummies (bug)

From: [e-mail]   (Joe Kovacs)

In <05C6FUhLDNUU-pn2-z1IGinRLgOkf@localhost>, [e-mail] (William Sonna)
writes:
>On Sat, 4 Sep 1999 17:51:41, [e-mail]   (Joe Kovacs) wrote:
>
>> In <[e-mail]>, Irv Spalten <[e-mail]>
writes:

>I think this question NEEDS to be answered and as far as I can tell it
>it is answered in IBM's documentation then it is not answered in
>English.  So I will attempt to ask the question in computer-ease:
>
>Does comitting a fixpack level
>
>  a. automatically delete
>  b. permit manual deletion
>
>of:
>
>  a. The archive
>  b. The backup
>  c. None of the above?

Committing a fixpack level automatically deletes the backup.

At the same time, committing a fixpack level permits manual
deletion of the archive.

----------------

Did you read the FixTools 1.41 readme.inf?
http://ps.software.ibm.com/pbin-usa-ps/getobj.pl?/pdocs-usa/fp
html?

Let's go tell Irv Spalten what he needs to know.


Joe Kovacs
Guelph Ontario Canada


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Water Utilities Hydraulic Analysis (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 06-Sep-99 04:16:15
  To: All                                               06-Sep-99 10:36:18
Subj: Re: WSeB don't do no DBCS

From: [e-mail]

In <c1.01.2RqQKm$04f@[e-mail]>, [e-mail] writes:
>In <[e-mail]>,
[e-mail] (Buddy Donnelly) writes:

>
>>This issue was discussed a long time ago, and I understand IBM had been
>>promising DBCS countries substantial improvements and extensions. To a
>>non-DBCS user, WSeB *appears* to devote a lot of HD space to DBCS language
>>elements, but you're saying they don't work? Or they're merely there to
>>*display* DBCS, not input it? Are there other language versions of WSeB, or
>>just the one?
>
>
>Short answer : WSeB is useless for DBCS and will remain that way, no
>matter what the claims, until IBM changes its approach.
>
>
>>I was going to check what you're saying with several DBCS users I've
>>corresponded with in the past, but none of them respond to my email. I
>>guess they've left OS/2, but that's idle conjecture.
>
>
>>Good luck,
>
>>Buddy
>
>>Buddy Donnelly
>>[e-mail]
>

okay, so I'm answering myself, guess getting a shill would be more polite, but
just saw this in a pdp8 group talking about parallel keyboards and USB :


From: Dan Strychalski <[e-mail]>
Newsgroups: alt.sys.pdp8,alt.sys.pdp11,alt.sys.pdp10
Subject: Re: Speaking of USB ( was Re: ASR 33 Typing Element)
Date: 5 Sep 1999 18:34:52 GMT
Message-ID: <7qud4c$n72$[e-mail]>
References: <[e-mail]>
<3oEy3.1080$[e-mail]>
<[e-mail]>
<[e-mail]>
<[e-mail]> <7qhlb7$ogv$[e-mail]>

Tarl Neustaedter wrote --

> I personally like the idea of them being connected "in parallel";
> moving either mouse would move the cursor, typing at either keyboard
> would result in keystrokes. That would let me have a trackball and
> mouse which I could use interchangeably, and a english and russian
> keyboard, which I could type in on the appropriate keyboard for
> the appropriate language.

It seems more sensible to get appropriate software so the same keyboard
can be used for both languages. That's been the usual practice for
typing in English and Chinese here in Taiwan since Apple II days or
earlier. (And just ONE of today's keyboards wastes enough de--- no, I'd
better not.)

Dan Strychalski               dski at cameonet, cameo, com, tw (no _x_)


IBM, oh *International* business machines, are you there ? The Apple II,
yes APPLE II for god's sakes could communicate with Hong Kong banks.
Hong Kong, you know that place where all the money for 1.6 *billion*
people flows through ? And do you read "codepage" anywhere in that
message ? <sigh>

skål !

----------------------------------------------------------
Härad Ængravvård
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                05-Sep-99 23:32:10
  To: All                                               06-Sep-99 10:36:18
Subj: Re: [OT] Did I kill my laptop?

From: Dale Erwin <[e-mail]>

[e-mail] wrote:
>
>  snip
>

I have seen this so much and thought if I kept on reading,
I would be able to figure it out; but I guess I'm gonna
have to break down and ask:

In the subject of this post, what is the significance
of the "[OT]" ????
--
Dale Erwin
3624 Coral Gables Drive
Dallas, Texas 75229-2619
[phone]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Erwin Technology Corporation (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail] [Ron]                      05-Sep-99 21:40:24
  To: All                                               06-Sep-99 10:36:18
Subj: Re: Moving OS/2

From: [e-mail] [Ron]

>Whaddaya say, Cityboy?  Wanna be our guinea pig?

Sure. I've been a guinea pig before. I was even a beta tester for
Intuit once. Then they dropped me because of using OS/2.  But
anyway...  I've never heard of Henk's tools or Unimaint or the other
utilities mentioned in the earlier post so I'll have to hunt them
down. But when I get it copied I'll post and let you know how I did
it.  Have a happy Labor Day.

Ron.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Concentric Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 00:49:19
  To: All                                               06-Sep-99 10:36:18
Subj: Re: toshiba vs. thinkpad

From: [e-mail]

What an amazing recommendation! Thanks.

The laptop I'm considering is the ThinkPad iSeries (Celeron).

F.

In <[e-mail]>, on 09/05/99
   at 06:47 PM, Chuck McKinnis <[e-mail]> said:

>I have an IBM Thinkpad 385ED, 166Mhz, 80Mb, 2.1Gb.  I have installed
>everything from OS/2 1.2 to Warp Server for e-Business on it.  I hauled
>it to Honduras for 3 months following in the wake of hurricane "Mitch". A
>half of the time, it was the only system we had working in the mission
>house.  Many time the power would drop below 90 volts (if it stayed on at
>all) and every other system would bite the dust (including a Compaq
>laptop).  With OS/2 I could do things that no else seemed to able to
>handle.  Like another missionary who called one day with a sad tale of
>woe about the 4Mb piece of e-mail that he could not get to download.
>Logged on to his account in preview mode and blew it away (thing someone
>had sent him a picture of his entire congregation).  Used it to access
>everything through the local ISP (you haven't had fun with an ISP until
>you have tried the Honduran government telephone company).  My only
>mishap was when someone danced on the end of the power adapter.  Was
>fairly easy to get someone coming in with a relief party to bring me
>another (ordered online and has it shipped to them).



-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 00:53:06
  To: All                                               06-Sep-99 10:36:18
Subj: Re: toshiba vs. thinkpad

From: [e-mail]

In <yRNWO1cJ1gUw-pn2-i3pfypNbwOh1@toshiba>, on 09/06/99
   at 02:04 AM, [e-mail] (Mark Dodel) said:

>I recently bought a Toshiba 2545XCDT.  It' a K6-2
>333/64Meg/4.1GigHD/14.1TFT.   I checked the Notebook/2 site and this  one
>seemed to support OS/2 well.  I even have the LT winmodem working.
> Took a while to figure out PCMCIA support under WSeb, but that is
>working now also (PCMCIA support worked on install in Warp4).  No USB
>support, since it's an Ali chipset.

>-)The systems are roughly comparable with the Thinkpad costing a bit less
>-)($100).
>-)

>I have no experience with the Celeron, but both systems sound pretty
>close except for the bigger HD and 64RAM in the Toshiba.  That would  be
>worth more then $100 in my book, assuming you can get OS/2 and  Linux
>running on both.

I think I'm going with the ThinkPad - that's partly for some logistical
reasons not having to do with technical quality but it looks like both
laptops are pretty even.

You remind me that IBM is dropping testing of OS/2 on some laptops,
disturbing. I'll see what I can find out about this one; it's an TP
iSeries (Celeron).

I also think I'll stick with my pattern and forgo the screen insurance;
I've been ok and no, I don't have kids to flummox with the computer. (I've
proven I'm perfectly capable of doing that myself!)

I think I'll purchase tomorrow (I'm a bit rushed for time). If I can, I'll
wait. They didn't have active matrix Toshiba's in stock until Tuesday. But
I think I'll just go the TP route.

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 01:00:20
  To: All                                               06-Sep-99 10:36:18
Subj: Re: toshiba vs. thinkpad

From: [e-mail]

In <BOCA3.8486$[e-mail]>, on 09/05/99
   at 11:13 PM, "Marek Kupsta" <[e-mail]> said:

> My trusty Sager has crashed - probably my fault, don't know, feel bad, >
>gotta move on....
>>
>> Anyway, I was with the pre-Labor Day crowd down at CompUSA looking at some
>> lappers, and felt drawn to: [A] Toshiba Celeron 400mhz: 64 DRAM, 6.4G HD,
>> 24X CDROM, 12.1" TFT screen vs. [B] IBM Thinkpad - by memory and notes:
>> 366mhz, 32MB, 4.8G, 12.1" TFT.

>Celerons are poor and unstable processors to begin with and I don't
>recommend this CPU on Desktop or Notebooks.

>> The systems are roughly comparable with the Thinkpad costing a bit less
>> ($100).

Actually, both systems are Celeron. I'll do some quick research tonight on
this issue.

You are very unhappy with the Toshiba but as far as I can tell, others
have had better mileage with them. Right now I'm inclined for partly
non-technical reasons to go with the ThinkPad anyway.

Thanks for the warnings! Now to check about the Celeron.

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 01:05:10
  To: All                                               06-Sep-99 10:36:18
Subj: Re: [OT] Did I kill my laptop?

From: [e-mail]

In <[e-mail]>, on
09/05/99
   at 11:32 PM, Dale Erwin <[e-mail]> said:

>I have seen this so much and thought if I kept on reading,
>I would be able to figure it out; but I guess I'm gonna
>have to break down and ask:

>In the subject of this post, what is the significance
>of the "[OT]" ????

'Off Topic'. I posted to a hardware group and to this OS/2 group. It's not
strictly relevant to OS/2 although I do ask about operating system
compatibility. [OT] warns that the post is not, strictly speaking, on
topic.

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 01:07:20
  To: All                                               06-Sep-99 10:36:18
Subj: Re: [OT] Did I kill my laptop?

From: [e-mail]

Thanks J P.

I've been over the computer pretty closely making sure things are tight.

I can't test memory right now but maybe on Tuesday. I have no idea
actually where the video card is (I didn't touch it). Essentially, I'd
have to take it in to a dealer who used to handle Sagers (don't know if he
still does) and have him look at it.

I used to be friends with the owner but I think he's sold it. I'll end up
paying for technical help, in one case more; in the other, less. They'll
also probably sit on it for a week, want to buy parts and charge me labor.


Thus, all kinds of figures ($$$) dance through my head and incline me to
simply buying a new system, and have done with it. I reckon I can get the
Sager looked at later and if it doesn't cost too much, I'll have it
repaired and use/donate/sell it somehow.

F.

In <c1.01.2S4wkY$[e-mail]>, on 09/06/99
   at 01:24 AM, [e-mail] said:

>Look carefully for bent pins, broken connections and such before you
>give up. It's really easy to bend a pin inserting a cpu without a zif
>socket and not even know it. It's possible *with* a zif socket (hearsay,
>of course)

>In <[e-mail]>, on 09/05/99
>   at 08:22 PM, [e-mail] (J.P. Pasnak) said:

>Before you give up, check the two most common boot-stoppers, your
>memory and your video card.  I should have said this in my first post,
>but once again, I jumped the gun.
>J.P. Pasnak
>Warped Systems
>******************



-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      06-Sep-99 15:39:16
  To: All                                               06-Sep-99 10:36:18
Subj: Re: Post your tips/solutions at os2.org

From: [e-mail] (Khairil Yusof)

On Mon, 6 Sep 1999 05:00:14, [e-mail] (J.P. Pasnak)
wrote:

> I think a good example of what he is talking about is the recent
> Imation IDE SuperDisk discussion.  It came down to having both
> IBM1S506.ADD and IBMATAPI.FLT installed as BASEDEV, along with the
> latest IDEDASD.
>
> This would be a good tip to send their way.

Another point would be with regards to problems, you've solved on your own
without the need to use the newsgroup. Eg. workarounds to known bugs etc. If
I'm
not wrong, most people here have used OS/2 for a long time. So a lot of little

quirks are usually solved by users themselves. It could save time though for
others to post them.

Also a tip site is a lot easier to search/follow then a long discussion like
the
one above.

Here's another example:

Lotus 123 has a tendency to stuff up with certain display drivers when
loading.
If you move a Window, the desktop doesn't get refreshed and the input queue
seems almost frozen. Closing it still leaves a ghost version still showing. A
desktop reset for example with resetwps does not fix the problem as the
desktop
doesn't reload.

Howerver a process killer like Top will cleanly kill it. This saves the
trouble
of a reboot.




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Australian National University (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                06-Sep-99 09:18:02
  To: All                                               06-Sep-99 10:36:18
Subj: Re: Rexx/exe cgi-bin to show system uptime

From: [e-mail]   (Baden Kudrenecky)

In <[e-mail]>,
[e-mail] (Khairil Yusof) writes:

>Has anybody here written a cgi rexx script or executable that shows the
system
>uptime? Or know of a site from which I could get one?
>
>I'd like a nice little section on my intranet site to show how stable OS/2
is.

   It's easy with Rexx:  Just put the following in your
'Startup' folder:
=================================================
/**/
call RxFuncAdd 'SysLoadFuncs', 'RexxUtil', 'SysLoadFuncs'
call SysLoadFuncs

File = 'whateveryouwant.html'
start = time('R')
do forever
    rc = lineout(File,'Ran for' trunc((time('E') - start) / 3600, 2)  'hours',
1)
    rc = stream(File, 'c', 'close')
    rc = SysSleep(100)  /* refresh time */
end /* do */
return
=================================================

baden

[e-mail]
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: askbill*AT*ibm.net                                06-Sep-99 17:28:22
  To: All                                               06-Sep-99 10:36:18
Subj: Re: WSeB don't do no DBCS

From: askbill*AT*ibm.net

In <c1.01.2S50Xt$[e-mail]>, on 09/06/99
   at 04:16 AM, [e-mail] said:

>In <c1.01.2RqQKm$04f@[e-mail]>, [e-mail] writes: >In
><[e-mail]>,
>[e-mail] (Buddy Donnelly) writes:

>>
>>>This issue was discussed a long time ago, and I understand IBM had been
>>>promising DBCS countries substantial improvements and extensions. To a
>>>non-DBCS user, WSeB *appears* to devote a lot of HD space to DBCS language
>>>elements, but you're saying they don't work? Or they're merely there to
>>>*display* DBCS, not input it? Are there other language versions of WSeB, or
>>>just the one?
>>
>>
>>Short answer : WSeB is useless for DBCS and will remain that way, no
>>matter what the claims, until IBM changes its approach.
>>
>>
>>>I was going to check what you're saying with several DBCS users I've
>>>corresponded with in the past, but none of them respond to my email. I
>>>guess they've left OS/2, but that's idle conjecture.
>>
>>
>>>Good luck,
>>
>>>Buddy
>>
>>>Buddy Donnelly
>>>[e-mail]
>>

>okay, so I'm answering myself, guess getting a shill would be more
>polite, but just saw this in a pdp8 group talking about parallel
>keyboards and USB :


>From: Dan Strychalski <[e-mail]>
>Newsgroups: alt.sys.pdp8,alt.sys.pdp11,alt.sys.pdp10
>Subject: Re: Speaking of USB ( was Re: ASR 33 Typing Element) Date: 5 Sep
>1999 18:34:52 GMT
>Message-ID: <7qud4c$n72$[e-mail]>
>References: <[e-mail]>
><3oEy3.1080$[e-mail]>
><[e-mail]>
><[e-mail]>
><[e-mail]> <7qhlb7$ogv$[e-mail]>

>Tarl Neustaedter wrote --

>> I personally like the idea of them being connected "in parallel";
>> moving either mouse would move the cursor, typing at either keyboard
>> would result in keystrokes. That would let me have a trackball and
>> mouse which I could use interchangeably, and a english and russian
>> keyboard, which I could type in on the appropriate keyboard for
>> the appropriate language.

>It seems more sensible to get appropriate software so the same keyboard
>can be used for both languages. That's been the usual practice for typing
>in English and Chinese here in Taiwan since Apple II days or earlier.
>(And just ONE of today's keyboards wastes enough de--- no, I'd better
>not.)

>Dan Strychalski               dski at cameonet, cameo, com, tw (no _x_)

>IBM, oh *International* business machines, are you there ? The Apple II,
>yes APPLE II for god's sakes could communicate with Hong Kong banks.
>Hong Kong, you know that place where all the money for 1.6 *billion*
>people flows through ? And do you read "codepage" anywhere in that
>message ? <sigh>

>skål !


Speaking as a long-time HSBC customer, AFAIK, HSBC is pretty close to an
all-blue shop.  They are, for example, a major user of OS/2.  I can't even
get them to print  the Chinese-part of my company name on my checks - and
it is not a translation -
the company is legally registered with a hybrid name, as many in Hong Kong
are.

HKSC **would not need** a code-page change in a 100% UK-English
environment. Check out their "Hexagon" electronic banking servcie, etc.
All in English. (It is a Bermuda Company with British founders, after
all).

Yes - they output statements bilingually, but that is a special case.

Many Banks in Taiwan and PRC are also IBM-heavy, but IF/AS/WHEN they use
DBCS OS/2 it is a release or two back from the latest US/UK English
version.

In any case, it is a matter of total indifference to a file and print
server.  A byte is a byte, and you either have the right to store and
recall it or you do not.  The app runs, - in whatever language suits you -
on your workstation, not on the server.

An "application" server is another matter, and, AFAIK, Wseb DOES support
many such apps.
 - so long as you are not also trying to use the server as a personal
workstation....which is where this whole thing, I am sure, started.

Get off the server-as-a-workstation and the problem goes away.

WSeb is not aimed at WINXX - it is, IMHO, aimed at the low end of the
AS-400 & RS-6000 market.

Not speaking for either HSBC or IBM, and for sure - YOMD!

Bill Hacker

--
-----------------------------------------------------------
[e-mail] (William B. Hacker, III)
Conducive Group (Asia) Limited
Hong Kong SAR
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               06-Sep-99 12:45:22
  To: All                                               06-Sep-99 10:36:18
Subj: check out  File Commander/2

From: "C.J." <[e-mail]>

File Commander/2
************************

File Manager

File Commander is a 32 bit text mode file manager and shell that allows you
to locate, copy, move, delete, view, edit and execute your files in a quick,
convenient and customizable manner.

Versions for windows 95/98/NT and OS2 are available.

Check it out and download File Commander/2 for a free trial period from:
    http://www.btsoftware.com/os2/filecmdr.htm




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: C.J. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      06-Sep-99 13:16:13
  To: All                                               06-Sep-99 14:34:06
Subj: Re: the future of os/2

From: Martin Nisshagen <[e-mail]>

Richard Steiner [FIELDATA FORTRAN ENTHUSIASTS CLUB] -> comp.os.os2.misc:

» Here in comp.os.os2.misc, Martin Nisshagen <[e-mail]>
» spake unto us, saying:
»
» >NT also easily beats Linux as a web server OS in raw performance of
» >serving pure HTML pages on the exact same hardware.
»
» Are you referring to the Mindcraft tests, or some other source of data?

I have seen several different tests to prove this (including some friends of
mine who did their own), but the latest to show this that I saw was on ZD-net.

They claim this is a proper test, instead of the one done at Mindcraft which
people from RedHat and others didn't approve of. According to them this test
has had both RedHat and Microsoft agree about what hardware to use, and both
vendors to be able to tweak their systems and monitor the test to approve it.

The results form it are here:
http://www.zdnet.com/pcweek/stories/jumps/0,4270,2283480,00.html

Best regards,

m a r t i n | n

--
Martin Nisshagen                 PGP 6.0: 0x45D423AC      K R A F T W E R K
:-)
CS/CE, Chalmers, Sweden          ICQ UIN: 689662          2 x 300A @ 450 MHz
d4nisse-at-dtek-chalmers-se      home2.sbbs2.com/mn
home2.sbbs2.com/mn/kw

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Chalmers University of Technology, Sweden (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           06-Sep-99 06:49:28
  To: All                                               06-Sep-99 14:34:06
Subj: Re: toshiba vs. thinkpad

From: Bob Germer <[e-mail]>

On <37d2f117$3$qnivfs$[e-mail]>, on 09/05/99 at 06:27 PM,
   [e-mail] said:

> Greetings!


> [A} He _strongly_ recommended the Toshiba on its overall quality,
> durability and support. What do you think?

I cannot agree due to personal experience, mine and clients, with both
products. Other than physical damage caused by a redhead who got mad at
one of my clients and deliberately damaged his older IBM, none has ever
had a problem. Conversely, I have four clients who purchased Toshiba
laptops. Every one of them has been in the shop at least once during the
first year. One has made 8 trips in a little over a year for various
failures.

> [b] He agreed with me that the Thinkpad is liable to support OS/2 a bit
> better but I don't anticipate any real problems running OS/2 and Linux
> on either machine. I intend to run Windows9x, OS/2 and Linux. What do
> you think?

This is the biggest falacy. The i14xx and 15xx series do NOT have drivers
available for Warp. The i17xx does as do most other models.

However, AND THIS IS A BIG BUT, the 390e series drivers do not support
sound in DOS/WinOS2 and the modem drivers only allow for V.34 connects,
not V.90 in Warp.

When it comes to IBM notebooks, always visit the device driver matrix at

http://www.pc.ibm.com/us/support/thinkpad/tpopsys.html

There you can verify what is and is not available for Warp support on IBM
Think Pads.

FWIW, I have a 390e with a Celeron and it is quite satisfactory. However,
I do not have V.90 modem access in Warp and I have no sound in WinOS/2.
Moreover, in order to get the modem to work, I had to apply Fixpack 10 and
then replace the new clock01.sys with the one from the archive in order to
get the machine to work.


--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: [e-mail]
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          06-Sep-99 11:30:18
  To: All                                               06-Sep-99 14:34:06
Subj: Re: toshiba vs. thinkpad

From: [e-mail] (Andrew Stephenson)

In article <37d2f117$3$qnivfs$[e-mail]>
       [e-mail]  writes:

> [Considers whether to buy a Toshiba or IBM Thinkpad notebook]

I see you are inclined to plump for the Thinkpad.  Good.  Just to
make you feel even better about the deal, one small detail which
struck me in 1997 when buying a TP380D -- so, NB, things may have
changed -- was that IBM's on-board "mouse substitute" was so much
better engineered than anyone else's, for solidity, for precision
and comfort of use, etc.  This includes "compared with Toshiba".

BTW, when I asked IBM Scotland (site of the local TP380D factory)
where to get extra touchpoint device red caps, they sent me some,
free, so I expect they are at least very cheap.  Not sure you can
say the same for Toshiba's pressure pad.
--
Andrew Stephenson

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DNS (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                06-Sep-99 08:05:20
  To: All                                               06-Sep-99 14:34:06
Subj: Re: Moving OS/2

From: fledermaus <[e-mail]>

Ref:     Append at 15:59:55 on 99/09/05 -0400 (by
[e-mail] (Raphael Tennenbaum)
I moved from C: to E: the hard way, it took several tries and a few hours
each.  Using a binary editor I had to change many items in many INI files.
It can be done, others have been successful as well.  However if you are
not a programmer/hacker do not even think about it.  I did this on
two computers, a desktop and laptop.

"A leader who is above the law is a tyrant (e.g. Gates, Clinton)"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                06-Sep-99 08:12:10
  To: All                                               06-Sep-99 14:34:06
Subj: Re: UMAX + Win-OS/2

From: fledermaus <[e-mail]>

Ref:     Append at 18:54:36 on 99/09/05 GMT (by [e-mail]
(John Hong)

> : ( I had to add the following two lines in my config.sys file before I
> : could get Vistascan to work
>
> : BASEDEV=OS2ASPI.DMD /SHARE

I have umax-astra1220s adaptec-scsi-pci-2906 and yamaha-cdw-crw4416s
 I use "/ALL" as share gives me problems



"A leader who is above the law is a tyrant (e.g. Gates, Clinton)"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              06-Sep-99 12:06:19
  To: All                                               06-Sep-99 14:34:06
Subj: Re: Trouble installing Warp 4.0, please help

From: [e-mail]

> It sounds like the installation procedure is hanging up while
> it tests out the hardware that is present on the system. The
> "Installation Program" requires a set of response files and
> configuration info that is generated during this phase. The
> ctrl-break kills this process leaving it unfinished.
>
> I've known this process to hang up on some network cards
> (such as the SMC Ultra series). What kind of hardware
> (network cards, sound cards etc) is present in the machine.
>
> You might try removing some of the add-on cards, network
> sound etc and see if it will get by this phase of the install.
>
> The install may also be hanging up on the Windows 2000
> C: partition. Is this FAT or is it NTFS (or some variant). You
> could try installing OS/2 to a second primary partition. This
> would allow the Windows 2000 partition to be hidden during
> the installation and anything there would not be able to
> interfere with the OS/2 install.
>
> Lorne Sunley
>
I have a Netgear card, which has the same chipset as a DEC card. I also
have an old SB16, a Matrox Mistique 4MB, 8.4 Western Digital HD, an AMD
K-6 300, and a generic modem.


Sent via Deja.com http://www.deja.com/
Share what you know. Learn what you don't.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Deja.com - Share what you know. Learn what you do
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      06-Sep-99 14:36:12
  To: All                                               06-Sep-99 14:34:06
Subj: Re: toshiba vs. thinkpad

From: Martin Nisshagen <[e-mail]>

Marek Kupsta [@Home Network Canada] -> comp.os.os2.misc:

» Toshiba sucks at notebooks. Their poor, unstable (even in NT). IBM Thinkpads
» are the best from my point of view. I have a thinkpad running @ 266MHz, it
» flys! I worked with both notebooks and I recommend ThinkPads (with Pentium
» MMX, 2, or 3 processors)

Couldn't agree more. I work with a lot of notebook, and the worst problems has
almost always been with Toshiba (and to some extent also Compaq). HP, Dell and
IBM is the ones who usually has had least problems in my experience, and also
the best support.

For OS/2 (and also NT) I would absolutely recommend IBM and one of their
better series of Think Pad. Good quality, stable machines and also great
support on them. Can't stop recommending them (and HP, if OS/2 isn't req.).

Go with IBM TP (but not one of their cheapest consumer series).

Best regards,

m a r t i n | n

--
Martin Nisshagen                 PGP 6.0: 0x45D423AC      K R A F T W E R K
:-)
CS/CE, Chalmers, Sweden          ICQ UIN: 689662          2 x 300A @ 450 MHz
d4nisse-at-dtek-chalmers-se      home2.sbbs2.com/mn
home2.sbbs2.com/mn/kw

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Chalmers University of Technology, Sweden (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    06-Sep-99 07:43:22
  To: All                                               06-Sep-99 14:34:06
Subj: Re: toshiba vs. thinkpad

From: [e-mail] (Dan Casey)

In article <37d34810$5$qnivfs$[e-mail]>,
[e-mail] wrote:
>What an amazing recommendation! Thanks.
>
>The laptop I'm considering is the ThinkPad iSeries (Celeron).

I'd do some more research if I were you. The i14xx series Thinkpads
are NOT supported in OS/2. The i17xx series are. Not sure about the
new i15xx series.

IBM has a page called the Device Driver Matrix on their Thinkpad
support site. All the Thinkpad models are cross referenced with
available drivers for various operating systems (Audio, Video, Mouse,
Modem, installation, etc).

http://www.pc.ibm.com/us/support/thinkpad/tpopsys.html



--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             06-Sep-99 12:58:01
  To: All                                               06-Sep-99 14:34:06
Subj: Re: toshiba vs. thinkpad

From: [e-mail] (Mark Dodel)

On Mon, 6 Sep 1999 11:30:36, [e-mail] (Andrew
Stephenson) wrote:

-)In article <37d2f117$3$qnivfs$[e-mail]>
-)       [e-mail]  writes:
-)
-)> [Considers whether to buy a Toshiba or IBM Thinkpad notebook]
-)
-)I see you are inclined to plump for the Thinkpad.  Good.  Just to
-)make you feel even better about the deal, one small detail which
-)struck me in 1997 when buying a TP380D -- so, NB, things may have
-)changed -- was that IBM's on-board "mouse substitute" was so much
-)better engineered than anyone else's, for solidity, for precision
-)and comfort of use, etc.  This includes "compared with Toshiba".
-)
-)BTW, when I asked IBM Scotland (site of the local TP380D factory)
-)where to get extra touchpoint device red caps, they sent me some,
-)free, so I expect they are at least very cheap.  Not sure you can
-)say the same for Toshiba's pressure pad.
-)--

My Toshiba also has a trackpoint.  That along with the large screen
size was one of the pointst that clinched it for me.   And they
include 3-4 replacement caps for it.  I take it these things
eventually wear out?

Mark

//---------------------------------------------------------
// From the Desk of: Mark Dodel, RN, BSN, MBA
//             Healthcare Computer Consultant
//                   [e-mail]
//    http://home.ptd.net/~madodel
//
//  For a VOICE in the future of OS/2
//             http://www.os2voice.org/index.html
//---------------------------------------------------------


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: PenTeleData http://www.ptd.net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    06-Sep-99 08:02:01
  To: All                                               06-Sep-99 14:34:06
Subj: Re: toshiba vs. thinkpad

From: [e-mail] (Dan Casey)

In article <37d39f14$1$obot$[e-mail]>,
Bob Germer <[e-mail]> wrote:
>
>This is the biggest falacy. The i14xx and 15xx series do NOT have drivers
>available for Warp. The i17xx does as do most other models.
>
>However, AND THIS IS A BIG BUT, the 390e series drivers do not support
>sound in DOS/WinOS2 and the modem drivers only allow for V.34 connects,
>not V.90 in Warp.

The developer who wrote the Lucent drivers (for the Winmodem in the
390 Thinkpads) is still working on the drivers for other platforms,
and may be able to supply the V.90 support for the OS/2 drivers later
this year. It's a matter of getting Lucent to release the V.90 code to
him. IBM has no interest in V.90 support for OS/2 (at this time), so
it's low on his list of priorities.

>When it comes to IBM notebooks, always visit the device driver matrix at
>
>http://www.pc.ibm.com/us/support/thinkpad/tpopsys.html
>
>There you can verify what is and is not available for Warp support on IBM
>Think Pads.

Anyone contemplating the purchase of a Thinkpad, and interested in
OS/2 support, should visit this URL. If the OS/2 drivers exist, you
can download them from this site. All Thinkpad models are listed, and
all drivers available are linked.

>FWIW, I have a 390e with a Celeron and it is quite satisfactory. However,
>I do not have V.90 modem access in Warp and I have no sound in WinOS/2.
>Moreover, in order to get the modem to work, I had to apply Fixpack 10 and
>then replace the new clock01.sys with the one from the archive in order to
>get the machine to work.

I have a 390 with a PII-233 and am very happy with it. I have no use
for sound in anything, and have no Win support installed, so the lack
of sound in WinOS2 sessions was not a factor. I haven't even tried it.
I did, however, need to download the Installation Diskette Image files
from the Matrix site to get Warp 4 to install on this machine. Using
the Installation Diskettes from IBM for the Thinkpad, I had no
problems at all.

--
**************************************************************
*  Dan Casey                                                 *
*  President                                                 *
*  V.O.I.C.E. (Virtual OS/2 International Consumer Education *
*  http://www.os2voice.org                                   *
*  Abraxas on IRC                                            *
*  http://members.iquest.net/~dcasey                         *
*  Charter Associate member, Team SETI                       *
*  Warpstock 99 in Atlanta  http://www.warpstock.org         *
**************************************************************
*  E-Mail (subject: Req. PGP Key) for Public Key             *
**************************************************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: V.O.I.C.E., Indianapolis, IN (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           06-Sep-99 13:44:11
  To: All                                               06-Sep-99 14:34:07
Subj: Re: ditto easy800 tape back up

From: [e-mail] (John Varela)

On Sun, 5 Sep 1999 22:33:18, John Griffin <[e-mail]>
wrote:

> anyone konw where i can get the drivers for this?

Funny you should ask.  As I type this, I am yet again reformatting a
tape cartridge on my Easy 800.

I use BackMaster with the ATAPI.FLT driver.

Oh shit I just got a BackMaster Error 51: DMA overrun.  I've never
seen that before.  Gotta go see if I can figure out what's going on.
Maybe I need to not be on-line while reformatting.

--
John Varela
to e-mail, remove - between mind and spring

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MindSpring Enterprises (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          06-Sep-99 14:24:16
  To: All                                               06-Sep-99 14:34:07
Subj: Re: toshiba vs. thinkpad

From: [e-mail] (Andrew Stephenson)

In article <yRNWO1cJ1gUw-pn2-236Mbdx09Lkg@toshiba>
[e-mail] "Mark Dodel" writes in reply to what
[e-mail] (Andrew Stephenson) wrote:
>
> My Toshiba also has a trackpoint.  That along with the large
> screen size was one of the pointst that clinched it for me.

Oh, okay.  Clearly they have moved on from the ones I saw in 97.

> And they include 3-4 replacement caps for it.  I take it these
> things eventually wear out?

Apparently so.  Even a fingertip can rub away a bit of rubbery
plastic, eventually. <g>
--
Andrew Stephenson

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DNS (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 06-Sep-99 16:29:01
  To: All                                               06-Sep-99 14:34:07
Subj: Re: [OT] Did I kill my laptop?

From: [e-mail]

I'll throw this in for what it is worth.  Just acquired a thinkpad - did some
real minor software things and the system would no longer boot - gave a
flashing error message -
I learned, from the seller, about memory parity.  Even though I'd done
nothing that came close to altering a startup value - it had been flipped
from non-parity to parity.  Without the previous owners tip I'd have been
dead in the water.
Any chance the Sager has a ROM setup menu and some choices which might
have been impacted by the new CPU change?


In <37d35038$9$qnivfs$[e-mail]>, [e-mail] writes:
>Thanks J P.
>
>I've been over the computer pretty closely making sure things are tight.
>
>I can't test memory right now but maybe on Tuesday. I have no idea
>actually where the video card is (I didn't touch it). Essentially, I'd
>have to take it in to a dealer who used to handle Sagers (don't know if he
>still does) and have him look at it.
>
>I used to be friends with the owner but I think he's sold it. I'll end up
>paying for technical help, in one case more; in the other, less. They'll
>also probably sit on it for a week, want to buy parts and charge me labor.
>
>
>Thus, all kinds of figures ($$$) dance through my head and incline me to
>simply buying a new system, and have done with it. I reckon I can get the
>Sager looked at later and if it doesn't cost too much, I'll have it
>repaired and use/donate/sell it somehow.
>
>F.
>
>In <c1.01.2S4wkY$[e-mail]>, on 09/06/99
>   at 01:24 AM, [e-mail] said:
>
>>Look carefully for bent pins, broken connections and such before you
>>give up. It's really easy to bend a pin inserting a cpu without a zif
>>socket and not even know it. It's possible *with* a zif socket (hearsay,
>>of course)
>
>>In <[e-mail]>, on 09/05/99
>>   at 08:22 PM, [e-mail] (J.P. Pasnak) said:
>
>>Before you give up, check the two most common boot-stoppers, your
>>memory and your video card.  I should have said this in my first post,
>>but once again, I jumped the gun.
>>J.P. Pasnak
>>Warped Systems
>>******************
>
>
>
>-----------------------------------------------------------
>      Felmon John Davis
>     [e-mail]    |  [e-mail]
>     Union College /  Schenectady, NY
>     - insert standard doxastic disclaimers -
>     OS/2 - ma kauft koi katz em sack
>-----------------------------------------------------------
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Giganews.Com - Premium News Outsourcing (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              06-Sep-99 16:43:26
  To: All                                               06-Sep-99 14:34:07
Subj: Re: Important News From Dan Porter of Innoval

From: [e-mail] (Brian)

Now if there was only a way to still purchase the spellguard for PRM
product.  That was only offered by Innoval, I checked w/ the author of
spellguard.

    Brian

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 13:21:19
  To: All                                               06-Sep-99 16:46:13
Subj: Re: toshiba vs. thinkpad

From: [e-mail]

In <[e-mail]>, on 09/06/99
   at 02:36 PM, Martin Nisshagen <[e-mail]> said:

>For OS/2 (and also NT) I would absolutely recommend IBM and one of their
>better series of Think Pad. Good quality, stable machines and also great
>support on them. Can't stop recommending them (and HP, if OS/2 isn't
>req.).

>Go with IBM TP (but not one of their cheapest consumer series).

Uh, oh. I was thinking of the iSeries. I'm not sure yet of the specific
model number; I'm about to go check it out again. I think it counts as
'one of their cheapest consumer series'.

F.


-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              06-Sep-99 08:43:07
  To: All                                               06-Sep-99 16:46:13
Subj: Re: Important News From Dan Porter of Innoval

From: [e-mail] (Alan Boritz)

In article <[e-mail]>,
[e-mail] (Esther Schindler) wrote:
>Buddy, you might like it if Innoval posted the source. But your
>quibble doesn't take into account that the company may have very good
>reasons to *not* do so?

Buddy knows the value of intellectual property, even if he didn't happen to
write about it in that particular piece.

>Don't look gift horses in the mouth.

A foolish suggestion, but I'll assume you have more experience with horses.
<g>

>They could have said, "Screw you,
>we're cancelling all product support."

Innoval already DID that, only they just didn't bother telling anyone.  Their
email and web site have been inactive for tech support for months.  Every
customer who bought an Innoval product within the past couple of years,
thinking that it was a contemporary, supported product, was cheated.

>Instead, they gave the OS/2 community a gift.

It's not much of a gift.  It's broken software, only now we're not paying to
subsidize the buglist, and we KNOW that there's no one to call to get it
fixed.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Dyslexics UNTIE (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 13:34:23
  To: All                                               06-Sep-99 16:46:13
Subj: Re: toshiba vs. thinkpad

From: [e-mail]

In <[e-mail]>, on 09/06/99
   at 07:43 AM, [e-mail] (Dan Casey) said:


>I'd do some more research if I were you. The i14xx series Thinkpads are
>NOT supported in OS/2. The i17xx series are. Not sure about the new i15xx
>series.

>IBM has a page called the Device Driver Matrix on their Thinkpad support
>site. All the Thinkpad models are cross referenced with available drivers
>for various operating systems (Audio, Video, Mouse, Modem, installation,
>etc).

>http://www.pc.ibm.com/us/support/thinkpad/tpopsys.html

Thanks. I realize this now. I need to check it out; will do so this
afternoon.

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 13:40:16
  To: All                                               06-Sep-99 16:46:13
Subj: Re: [OT] Did I kill my laptop?

From: [e-mail]

Greetings!

I can recall a lot of the BIOS from memory, I don't recall anything about
parity settings. I can't get to the BIOS screen to check, however. I
evidently don't even have my manual anymore, not that that would have
helped.

F.

In <jZRA3.17419$[e-mail]>, on 09/06/99
   at 04:29 PM, [e-mail] said:

>I'll throw this in for what it is worth.  Just acquired a thinkpad - did
>some  real minor software things and the system would no longer boot -
>gave a  flashing error message -
>I learned, from the seller, about memory parity.  Even though I'd done
>nothing that came close to altering a startup value - it had been flipped
>from non-parity to parity.  Without the previous owners tip I'd have been
>dead in the water.
>Any chance the Sager has a ROM setup menu and some choices which might
>have been impacted by the new CPU change?


>In <37d35038$9$qnivfs$[e-mail]>, [e-mail]
>writes: >Thanks J P.
>>
>>I've been over the computer pretty closely making sure things are tight.
>>
>>I can't test memory right now but maybe on Tuesday. I have no idea
>>actually where the video card is (I didn't touch it). Essentially, I'd
>>have to take it in to a dealer who used to handle Sagers (don't know if he
>>still does) and have him look at it.
>>
>>I used to be friends with the owner but I think he's sold it. I'll end up
>>paying for technical help, in one case more; in the other, less. They'll
>>also probably sit on it for a week, want to buy parts and charge me labor.
>>
>>
>>Thus, all kinds of figures ($$$) dance through my head and incline me to
>>simply buying a new system, and have done with it. I reckon I can get the
>>Sager looked at later and if it doesn't cost too much, I'll have it
>>repaired and use/donate/sell it somehow.
>>
>>F.
>>
>>In <c1.01.2S4wkY$[e-mail]>, on 09/06/99
>>   at 01:24 AM, [e-mail] said:
>>
>>>Look carefully for bent pins, broken connections and such before you
>>>give up. It's really easy to bend a pin inserting a cpu without a zif
>>>socket and not even know it. It's possible *with* a zif socket (hearsay,
>>>of course)
>>
>>>In <[e-mail]>, on 09/05/99
>>>   at 08:22 PM, [e-mail] (J.P. Pasnak) said:
>>
>>>Before you give up, check the two most common boot-stoppers, your
>>>memory and your video card.  I should have said this in my first post,
>>>but once again, I jumped the gun.
>>>J.P. Pasnak
>>>Warped Systems
>>>******************
>>
>>
>>
>>-----------------------------------------------------------
>>      Felmon John Davis
>>     [e-mail]    |  [e-mail]
>>     Union College /  Schenectady, NY
>>     - insert standard doxastic disclaimers -
>>     OS/2 - ma kauft koi katz em sack
>>-----------------------------------------------------------
>>



-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]               06-Sep-99 17:43:01
  To: All                                               06-Sep-99 16:46:13
Subj: Re: toshiba vs. thinkpad

From: "Jan Danielsson" <[e-mail]>

>My trusty Sager has crashed - probably my fault, don't know, feel bad,
>gotta move on....
>
>Anyway, I was with the pre-Labor Day crowd down at CompUSA looking at some
>lappers, and felt drawn to: [A] Toshiba Celeron 400mhz: 64 DRAM, 6.4G HD,
>24X CDROM, 12.1" TFT screen vs. [B] IBM Thinkpad - by memory and notes:
>366mhz, 32MB, 4.8G, 12.1" TFT.

Whichever laptop you choose: More memory!

96MB or 128, if you can afford it.



 /j



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Telia Internet (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    06-Sep-99 17:58:19
  To: All                                               06-Sep-99 16:46:13
Subj: Re: Microsoft Word 5.5b Download

From: [e-mail] (John Hong)

    Some people may experience a black screen trap pointing towards
POINTER$$ or something like that.  It is the POINTDD.SYS file that is
where Microsoft Word 5.5b goes nuts with.  At the time I was using the
DDPAK01's POINTDD.SYS, so I backleveled that to the default Warp 3 one
(10-03-94).  Works fine with the DDPAK01'd MOUSE.SYS and what not.  I
don't see any difference.
    This seems to be agreeable with Word 5.5b.  No trap's...yet.
After playing around with this, it isn't a wonder that Word 5.5 could not
beat WordPerfect 5.1 during its day.  It's not bad, but it does lack some of
the features that WP5.1 had.  No endnote capability (does do footnotes,
though).  The one that I really could not understand was the lack of a
zoom capability during print preview.  Ick.  One thing that I did like
was the graphical display, but the thing is, you can not use the mouse
which sort of made the thing pointless.  One thing that I will give
credit for, which seems to reflect the majority of Microsoft programs is
that they made Word 5.5b, simple.  So I can see why Word 5.x users refuse
to move onto the newer versions of Word.  This must have been the main
reason why Microsoft let Word 5.5b go as a freebie for the existing Word
5.0 users.
    No sign of a free Excel version for DOS users.  I guess during
that time, Lotus 1-2-3 pretty much had the market lock stock and barrel.
Probably no demand for Excel for DOS.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               06-Sep-99 14:05:11
  To: All                                               06-Sep-99 16:46:13
Subj: Q: Rollback IDE drivers?

From: "Mark H. Bickford" <[e-mail]>

How can I safely rollback the IDE drivers to the original level after
applying a Fixpack?  My machine (486 DX4-100) does not have a large HDD,
and some programs cause my machine to trap with a 000D just after
IDEDASD is installed during boot.  I thought of copying the files back
off of the install disks, but will I need to do that every time I
install a new fixpack?  What is the best way to do this?

TIA for any help anyone can shed.

Best regards,
Mark

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TWC Portland, Maine (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                        06-Sep-99 18:00:08
  To: All                                               06-Sep-99 16:46:13
Subj: Re: I got OS/2 2.11... for $1.50!

From: [e-mail] (Alex Taylor)

On Thu, 2 Sep 1999 03:49:08, [e-mail]   (Joe Kovacs) wrote:

> >As for WP/2, well... I thought it was neat to have (even if it doesn't
> >seem to work all that well).
>
> WordPerfect/2 v5.2 is my work processor.  It works quite well.
> Well, it did until I installed OS/2 v4 and moved the Docs
> directory to another HD, and now the associations don't work,
> I have to find out what's wrong.

On my system, the background goes black the instant I do a page down
or a line feed or anything that affects the current line/view.  Makes
it kind of hard to work with...

Plus the interface seems clumsy, and I can't mark properly using
shift-keypad.

Maybe I'll just go pick up a copy of WP 7 for Win16...

-----------------------------------------------------------------
 Alex Taylor                  BA - CIS - University of Guelph
 [e-mail]   http://eddie.cis.uoguelph.ca/~alex
-----------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                        06-Sep-99 18:06:12
  To: All                                               06-Sep-99 16:46:13
Subj: Re: Daylight Savings Time and OS/2 Warp

From: [e-mail] (Alex Taylor)

On Mon, 6 Sep 1999 01:39:31, James Moe <[e-mail]> wrote:

<replying to various responses here...>

> > I've been trying to figure out how to do this myself - we have several
> > OS/2 production servers.  We've been trying to automate as much as
> > possible, unfortunately, we still have to do the DST time change
> > manually.
> >
> > I've been looking for a program that will do this automatically,
> > however, all the time-management programs seem to be based on
> > connecting to a NTP server.
> >
> > Our systems, however, are on a closed network (non-IP, at that).
>
>     Can you set up one system to dial out peridocally? Or have one that
> someone connects to the outside world on a regular basis? We also have a
> closed system but one person uses the dialup Internet connection
> frequently and I put a NTP client and a DAYTIME server on that machine.
> This way the other machines can update their time to that one machine. I
> have no stringent time requirements so having all that machines at mist
> one second in error is no problem. Using cron or some similar scheduler
> automates the time service updates for the local machines.
>     NTP is especially attractive since it maintains information about
> the clock's drift and corrects for it based on that drift value when the
> Internet is not available.

Unfortunately, these servers are part of an EXTREMELY security-conscious
network.
(For starters, they're kept in a locked cabinet to which about
four people have a key, in a highly secured server room.)  Adding any
network traffic or any kind of additional connection to "outside"
at all is basically out of the question.

I'll keep looking, though.

-----------------------------------------------------------------
 Alex Taylor                  BA - CIS - University of Guelph
 [e-mail]   http://eddie.cis.uoguelph.ca/~alex
-----------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           06-Sep-99 19:00:00
  To: All                                               06-Sep-99 16:46:14
Subj: Re: Q: Rollback IDE drivers?

From: [e-mail] (Lorne Sunley)

On Mon, 6 Sep 1999 18:05:22, "Mark H. Bickford" <[e-mail]>
wrote:

> How can I safely rollback the IDE drivers to the original level after
> applying a Fixpack?  My machine (486 DX4-100) does not have a large HDD,
> and some programs cause my machine to trap with a 000D just after
> IDEDASD is installed during boot.  I thought of copying the files back
> off of the install disks, but will I need to do that every time I
> install a new fixpack?  What is the best way to do this?
>

Just copy them on with a different name (ie: GOODS506.ADD)
and change the basedev=ibm1s506 to basedev=goods506
This should (?) work......

Lorne Sunley


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: jricci@.nospam.ibm.net                            06-Sep-99 19:16:27
  To: All                                               06-Sep-99 16:46:14
Subj: using win95 icons in OS2

From: jricci@.nospam.ibm.net (Joe Ricci)

There are numerous freeware win95 icon libraries.

Are there utilities that will convert them to OS *.ico

Using PMVIEW to open and convert them creates pretty fuzzy icons.

Limitation of the Icons?



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: sborsen"at"ibm.net                                06-Sep-99 19:38:11
  To: All                                               06-Sep-99 19:51:14
Subj: Re: toshiba vs. thinkpad

From: sborsen"at"ibm.net (Steve)

On Sun, 5 Sep 1999 22:27:25, [e-mail] wrote:

>  I am
> eager for any good insights.
>

Just my 2 cents worth... I am on my third Toshiba laptop in 1 year.  I
am gentle, but I have had my 490CDT disk crash, new mother board, and
assorted other problems.  I  wouldn't buy one, if fact, I would
question a freebie.  Since work issues them (I think they'll stop), I
would go with the IBM.

OS/2 is difficult to install on this puppy too.  Especially when
connecting to a WAN.  Toshiba "doesn't support" OS/2, so you are
pretty much on your own.  It can be done, but it is not worth the
frustration.

Thinkpad it!

Steve

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                 06-Sep-99 15:34:08
  To: All                                               07-Sep-99 03:24:05
Subj: Re: Microsoft Word 5.5b Download

From: [e-mail] (Raphael Tennenbaum)

[e-mail] (John Hong) wrote:

>das schnip>
>

>One thing that I will give
>credit for, which seems to reflect the majority of Microsoft programs is
>that they made Word 5.5b, simple.  So I can see why Word 5.x users refuse
>to move onto the newer versions of Word.  This must have been the main
>reason why Microsoft let Word 5.5b go as a freebie for the existing Word
>5.0 users.

Nah, I think they've finally had a change of heart and are
reaching out to OS/2 users.

Heh heh

>    No sign of a free Excel version for DOS users.  I guess during
>that time, Lotus 1-2-3 pretty much had the market lock stock and barrel.
>Probably no demand for Excel for DOS.

Yeah, I poked around looking for that as well -- that would
be a real prize.  (Is it just me, or are MS pages the
slowest to load on the whole web, not to mention poorly
organized?  Well, except maybe for Lotus.)

--
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  06-Sep-99 14:20:20
  To: All                                               07-Sep-99 05:46:02
Subj: Re: Q: Rollback IDE drivers?

From: Chuck McKinnis <[e-mail]>

On my machine, I would go to x:\os2\boot and "copy ibm1s506.add
*.fpxx".  I would then "unpack x:\archive\base\ibm1s506.ad_".

"Mark H. Bickford" wrote:
>
> How can I safely rollback the IDE drivers to the original level after
> applying a Fixpack?  My machine (486 DX4-100) does not have a large HDD,
> and some programs cause my machine to trap with a 000D just after
> IDEDASD is installed during boot.  I thought of copying the files back
> off of the install disks, but will I need to do that every time I
> install a new fixpack?  What is the best way to do this?
>
> TIA for any help anyone can shed.
>
> Best regards,
> Mark

--
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 16:34:16
  To: All                                               07-Sep-99 05:46:02
Subj: Was: toshiba vs. thinkpad, Now: Laptops for Linux & OS/2?

From: [e-mail]

In <[e-mail]>, on
09/06/99
   at 07:38 PM, sborsen"at"ibm.net (Steve) said:

>Just my 2 cents worth... I am on my third Toshiba laptop in 1 year.  I am
>gentle, but I have had my 490CDT disk crash, new mother board, and
>assorted other problems.  I  wouldn't buy one, if fact, I would  question
>a freebie.  Since work issues them (I think they'll stop), I  would go
>with the IBM.

>OS/2 is difficult to install on this puppy too.  Especially when
>connecting to a WAN.  Toshiba "doesn't support" OS/2, so you are  pretty
>much on your own.  It can be done, but it is not worth the  frustration.

>Thinkpad it!

Heh, it's pretty clear: Too many voices against Toshiba.

I went back to my CompUSA and found that the TP iSeries they've got is a
1720 refurbished (for $1699USD; 266 Pentium, 4.3 G, 64MB, 13.3" TFT 32x
CD). The 1720 according to Dr. Martinus's site is a bit questionable for
OS/2. Also, this particular machine's been sitting on the showroom floor
for everyone to pound on.

All their other iSeries stuff is 14xx and that's not very well supported
in OS/2, and I'm scared to consider their support of Linux. Further, I
didn't realize the in-built modems in all of these things are Winmodems.
In one sense, it makes little diff since I always use an external, but
reading these ngs has given me allergies against them.

I may speak to my Sager people again; the new RedHat worked well on it (I
couldn't get a complete install with the older versions - couldn't figure
out video-card stuff). They are heavy as cast iron but they are stuffed
with good technology. However, the compatibility issues remain troubling.

It's time for me to change the thread to 'laptops to run linux and os/2'.

It really comfirms some of the disdain for CompUSA, by the way. They could
really do to enrichen the mix of stuff they sell; it all seems rather
lowball. Plus, after their 'reorganization' it is simply impossible to get
through on the phone.

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 06-Sep-99 20:58:18
  To: All                                               07-Sep-99 05:46:03
Subj: Backups and Warp3 directory/file order?

From: [e-mail] (Terry Kot)

Hello OS2 fans.

I'm a new OS/2'er and have a question about backups and OS/2's
directory/file order/structure on a FAT partition.

Does OS/2 Warp3 have a certain directory/file 'order' and can I
re-arrange (modify) the directory & file order without any changes to
OS/2 somewhere?  (files are still inside their proper directories of
course, with the only difference being that they're sorted)

Every time I try copying OS/2's files & directories to another
partition and then re-copying the re-arranged OS/2 directory/file
order on a clean, formatted partition with an OS/2 file manager
(FileJet V7.41), ... I can boot up OS/2 with no error messages, BUT
then, the Desktop objects are gone and its background color is
different, only the folder icons remain along with a few 'extra' ones,
and the shutdown button doesn't respond. All of Warps files are
present with the only exception being the pesky EA DATA file ... which
gets created new durring the re-copy step anyway. The FileJet program
I'm using to do the copying is EA aware as I can see frequent 'EA'
related messages flash by durring file copying.

The only way, so far, that I can make Warp3 accept the new directory/
file order is to create new OS2*.INI files with the MAKEINI pgm. But
this only produces a basic desktop with only the Template folder
object a couple others.

Is there a another way to make Warp3 accept the modified directory/
file order AND produce the *same* desktop I had immediately before???

PS ... thanks to everyone here who's previously helped me in the
recent past. Much appreciated. <g>

Terry
Toronto, ON, Canada

--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Toronto Free-Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 06-Sep-99 22:35:18
  To: All                                               07-Sep-99 05:46:03
Subj: Re: QuickCam VC USB

From: [e-mail] (Bob Lockie)

In message <[e-mail]> - [e-mail]
(Zamp)5 Sep 1999 09:44:02 GMT writes:
:>
:>Hi
:>
:>Did you know any app. support for subj ?
:>
:>Conoscete se qualche applicazione supporta la Quickcam USB ?

There is no USB version of the driver.

OS/2 and WinNT support the parallel version only.

http://www.shadow.net/~senja/qv2indx.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 22:42:13
  To: All                                               07-Sep-99 05:46:03
Subj: Re: Important News From Dan Porter of Innoval

From: [e-mail]

In <zRQeOedqx8Di-pn2-gdeEn62jU2ti@localhost>, [e-mail] (Brian)
writes:
>Now if there was only a way to still purchase the spellguard for PRM
>product.  That was only offered by Innoval, I checked w/ the author of
>spellguard.
>
>    Brian

Yes .. I paid for it and never got it.  I want it now, but have, as yet,
not been able to find even the downloadable module for which I have the
paid-for key ... :(


--> Sleep well; OS2's still awake! ;)

[e-mail]
[e-mail]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 19:00:01
  To: All                                               07-Sep-99 05:46:03
Subj: XGA w/ OS/2 and Linux on laptop

From: [e-mail]

Greetings!

I'm looking for a new laptop. It looks like I'm going back to Sager
(having somehow blown away my old trusty).

I see some video is designated as XGA.

Does this raise any problems for OS/2 or for Linux?

I note also that a couple run ATI Rage Pro 3D AGP. I have the impression
this isn't good for OS/2 and for Linux; right or wrong?

Thanks loads. I'm probably going to order tomorrow. I'm going to research
ThinkPads a bit tonight but Sager has worked well for me, and the prices
are heavenly. Just worried about compatibility issues.

I really appreciate any guidance anyone can offer. If you have other
laptop suggestions, I'm all eyes.

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------



-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 06-Sep-99 23:28:20
  To: All                                               07-Sep-99 05:46:03
Subj: Re: WSeB don't do no DBCS

From: [e-mail]

In <37d436b7$2$nfxovyy$[e-mail]>, askbill*AT*ibm.net writes:
>
snipped
>
>>IBM, oh *International* business machines, are you there ? The Apple II,
>>yes APPLE II for god's sakes could communicate with Hong Kong banks.


>Speaking as a long-time HSBC customer, AFAIK, HSBC is pretty close to an
>all-blue shop.  They are, for example, a major user of OS/2.  I can't even
>get them to print  the Chinese-part of my company name on my checks - and
>it is not a translation -
>the company is legally registered with a hybrid name, as many in Hong Kong
>are.

you are making my point for me : you can't get them to print the Chinese
portion
of your name because they probably *can't.*

>
>HKSC **would not need** a code-page change in a 100% UK-English
>environment. Check out their "Hexagon" electronic banking servcie, etc.
>All in English. (It is a Bermuda Company with British founders, after
>all).
>
>
>Many Banks in Taiwan and PRC are also IBM-heavy, but IF/AS/WHEN they use
>DBCS OS/2 it is a release or two back from the latest US/UK English
>version.
>

thank you for the post and some better info on the dbcs situation.
IBM has a *serious* problem disseminating what knowledge it does have.

I apologize for the lax use of the word "communicate." I realize that WSeB can

communicate with other computers using bits. bytes, & other electronic pulses.
When I spoke of 'communicating' I was thinking of the need to fax or e-mail
letters, forms, and items which a human being might need to read. Information
which bank officers read, not 11001011101. WSeB  has no provision (though it
claims to) for this type of thing.

>HKSC **would not need** a code-page change in a 100% UK-English
>environment. Check out their "Hexagon" electronic banking servcie, etc.
>All in English. (It is a Bermuda Company with British founders, after
>all).

Of course, in an all-English environment DBCS use is superfluous ! I could
equally well argue that at the China Community Bank in Alhambra the
use of English is superfluous ! Xiang Gang is no longer part of the British
Empire (sorry Tony) and while one can correspond with your Bermuda-based
bank, if you wish to write, fax, e-mail, or otherwise discuss business in any
of the Chinese banks doing Chinese business, better get into the DBSC mode.
In OS/2 this *does* require codepage-switching, as there is no equivalent to
Chinese Star for OS/2. To use languages OS/2 requires a codepage switch.
Too bad that one can only have two prepared codepages - thus one native
and one foreign dialect is ALL you can access without rebooting. There
are two versions of Chinese alone, both require separate codepages.
I hope I am just stupid and some knowledgeable IBM'er will say so ! but I
doubt it. Hasn't happened yet, anyway (with facts, I mean, not just on
general principles.)


>In any case, it is a matter of total indifference to a file and print
>server.  A byte is a byte, and you either have the right to store and
>recall it or you do not.  The app runs, - in whatever language suits you -
>on your workstation, not on the server.
>

Possibly yes, and possibly no. I have had problems with files being used and
saved in different codepages. I don't know enough about the codepage situation
to argue with you ! but I do know there can be issues when you switch around.
IBM's "locale-aware" apps *require* codepage switching, an extremely ugly
and inconvenient 'solution.'


>An "application" server is another matter, and, AFAIK, Wseb DOES support
>many such apps.
> - so long as you are not also trying to use the server as a personal
>workstation....which is where this whole thing, I am sure, started.

You're right, that is where it started for me ! but the incentive for the
thread was an announcement by IBM that "WSeB includes many DBCS
enhancements" etc etc. When I screamed, I was told the same thing, that
the enhancements are there, that WSeB allows DBCS apps to run, but
doesn't address the keyboard input situation. So I located a Japanese (the
only DBCS 'enhancement' in WSeB) application and it refused to display in
Japanese. I sent the app to the persons who told me WSeB would in fact do
dbcs, with a request to explain what the H I was doing wrong, then ?

Silence is golden, golden, but my eyes still see :  WSeB is no more
DBCS-useful than Warp 3 with the Unicode fonts from the Java install. Of
course any computer can talk to any other computer - my Westinghouse
2560 talks regularly to my Warp server 4. This isn't at all the same as
actually sending a message via computer that another human being can
read and respond to !

I also realize that places such as your bank in Hong Kong can and do use OS/2.
(Do they use P-warp or T-warp now ?) What you haven't mentioned is that
for an English-speaker this is not much of a 'solution.' Nor is it even a
solution
between taiwan and China. Chinese OS/2 will do both DBCS and SBCS character
sets, but all the title bars and help is in Chinese. Worse, there are two
versions,
one doing *only* simplified and the other doing *only* traditional. Further,
there is apparently no way to buy any version of foreign OS/2 in the U.S. WSeB

is no better in this respect than Warp 3, so press releases discussing new
capabilities in this area are disingenuous. I know that the people making the
public statements are ethical and honest, but what they are being told is flat

out lies.


>Get off the server-as-a-workstation and the problem goes away.

ah, but we are talking "e-Business" here. "e-Business" implies dealing
with people from all over the world, using all different languages,
server or workstation notwithstanding. I cannot see any way for WSeB
to deal with DBCS on any level other than bits and bytes, and if you have
to switch codepages all the time to do even that, that's sure as hell no
"Solution" for international business of any kind, much less the electronic
kind.
In this respect, NeXT was an 'e-business solution', WSeB is junk.

>
>WSeb is not aimed at WINXX - it is, IMHO, aimed at the low end of the
>AS-400 & RS-6000 market.

can't see what difference it makes who it's aimed at, if Chinese people
can't use or read characters they ain't gonna buy it. If I (and  others with
much more funds than I) can't use it to communicate on a human-to-human
level, then we ain't gonna either. Think, if you can't use it at either end,
why
use it in the middle ? If IBM is silly enough to believe that servicing an
English-speaking British-owned, Bermuda-based bank qualifies as having a
product available for use in China, then they deserve to lose that whole
market.
And they will. Even in xiang gang, english is not the answer anymore.

>
>Not speaking for either HSBC or IBM, and for sure - YOMD!
>
>Bill Hacker
>
>--
>-----------------------------------------------------------
>[e-mail] (William B. Hacker, III)
>Conducive Group (Asia) Limited
>Hong Kong SAR
>-----------------------------------------------------------

>

skål !

----------------------------------------------------------
Härad Ængravvård
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SBC Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                  06-Sep-99 19:57:13
  To: All                                               07-Sep-99 10:47:25
Subj: IBM Anti Virus

From: George Penzenik <[e-mail]>

Does anyone know WHEN Symantec is going to release an OS/2 version of
thier product?  This was promised when IBM 'sold' INBAV to Symantec.

I written and emailed but all I get is a run around.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   07-Sep-99 01:34:28
  To: All                                               07-Sep-99 10:47:25
Subj: Re: Was: toshiba vs. thinkpad, Now: Laptops for Linux & OS/2?

From: [e-mail]

Everything I've seen indicated that the iSeries 1720/1721 should run OS/2
OK...  I looked for one for some time and never could find one.   From when
I looked, it appears that the 172x machines are really ThinkPad 390Es under
the covers. Can't speak for Linus though....

  Mike

In <37d425b7$13$qnivfs$[e-mail]>, [e-mail]
writes:
>In <[e-mail]>, on
>09/06/99
>   at 07:38 PM, sborsen"at"ibm.net (Steve) said:
>
>>Just my 2 cents worth... I am on my third Toshiba laptop in 1 year.  I am
>>gentle, but I have had my 490CDT disk crash, new mother board, and
>>assorted other problems.  I  wouldn't buy one, if fact, I would  question
>>a freebie.  Since work issues them (I think they'll stop), I  would go
>>with the IBM.
>
>>OS/2 is difficult to install on this puppy too.  Especially when
>>connecting to a WAN.  Toshiba "doesn't support" OS/2, so you are  pretty
>>much on your own.  It can be done, but it is not worth the  frustration.
>
>>Thinkpad it!
>
>Heh, it's pretty clear: Too many voices against Toshiba.
>
>I went back to my CompUSA and found that the TP iSeries they've got is a
>1720 refurbished (for $1699USD; 266 Pentium, 4.3 G, 64MB, 13.3" TFT 32x
>CD). The 1720 according to Dr. Martinus's site is a bit questionable for
>OS/2. Also, this particular machine's been sitting on the showroom floor
>for everyone to pound on.
>
>All their other iSeries stuff is 14xx and that's not very well supported
>in OS/2, and I'm scared to consider their support of Linux. Further, I
>didn't realize the in-built modems in all of these things are Winmodems.
>In one sense, it makes little diff since I always use an external, but
>reading these ngs has given me allergies against them.
>
>I may speak to my Sager people again; the new RedHat worked well on it (I
>couldn't get a complete install with the older versions - couldn't figure
>out video-card stuff). They are heavy as cast iron but they are stuffed
>with good technology. However, the compatibility issues remain troubling.
>
>It's time for me to change the thread to 'laptops to run linux and os/2'.
>
>It really comfirms some of the disdain for CompUSA, by the way. They could
>really do to enrichen the mix of stuff they sell; it all seems rather
>lowball. Plus, after their 'reorganization' it is simply impossible to get
>through on the phone.
>
>F.
>
>-----------------------------------------------------------
>      Felmon John Davis
>     [e-mail]    |  [e-mail]
>     Union College /  Schenectady, NY
>     - insert standard doxastic disclaimers -
>     OS/2 - ma kauft koi katz em sack
>-----------------------------------------------------------
>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          06-Sep-99 20:53:29
  To: All                                               07-Sep-99 10:47:25
Subj: Re: IBM Anti Virus

From: Timothy Sipples <[e-mail]>

George Penzenik wrote:
> Does anyone know WHEN Symantec is going to release an OS/2 version of
> thier product?  This was promised when IBM 'sold' INBAV to Symantec.
> I written and emailed but all I get is a run around.

Visit:

   http://www.symantec.com/nav/nav_os2

for more information and/or to purchase.

--
Timothy Sipples
IBM Network Computing Software
Chicago, Illinois
Web: http://www.satdirect.com/aviation

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Network Computing Software (Chicago) (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]_THIS                     06-Sep-99 16:24:08
  To: All                                               07-Sep-99 10:47:25
Subj: Re: UMAX + Win-OS/2

From: [e-mail]_THIS (Robert Fargher)

On Sun, 05 Sep 1999 09:54:42 -0400, [e-mail] wrote:

>Anyone with a 610S has an excellent reason. CFM does not make a TWAIN
>driver for the 610S, although they make one for the 1220S. When I asked
>CFM, they said they had no plans to produce a 610S Twain driver.

  I have an Umax 610S and have it working great in OS/2.  Mind you,
that's using xscanimage and the SANE drivers in XFree86OS/2, scanning
directly into the GIMP.  It's as functional in that environment as
it is in Linux.

  If you'd like some help on getting XFree86OS/2 up and running on your
machine, you might like to check out my article in the February VOICE ezine:

http://www.os2voice.org/VNL/past_issues/VNL0299H/vnewsf2.htm

  Oh, and I have a real SCSI card, one using a Symbios 810 chip.  The
packaged one with the scanner is braindead and doesn't work outside of what
passes for an operating system from Billy the Hutt.

Cheers,
Rob

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   06-Sep-99 22:10:02
  To: All                                               07-Sep-99 10:47:25
Subj: Re: Installing OS/2 Warp 4 on Pentium II machine

From: Alon Stewart <[e-mail]>

You did not mention a new hard disk, but I assume you did or else you would
not
be reinstalling.  Frequently disabling PNP from the Alt-F1 at boot will allow
you to install if one of the devices is in conflict.  Turn the PNP back on
with
the Properties of the System folder when the installation is complete.

[e-mail] wrote:

> Dear All,
> does anyone know if there is a problem installing Warp 4 on Pentium II
> machines?  I get as far as the third installation disk, and the system hangs
> at "loading, please wait".  If there is a problem is there a work around?
> Many thanks in anticipation for your help.
> Ted

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    07-Sep-99 02:17:16
  To: All                                               07-Sep-99 15:25:23
Subj: Re: IBM Anti Virus

From: [e-mail] (John Hong)

George Penzenik ([e-mail]) wrote:
: Does anyone know WHEN Symantec is going to release an OS/2 version of
: thier product?  This was promised when IBM 'sold' INBAV to Symantec.

    Hasn't Norton Antivirus for OS/2 been out for a while now?  I had
read of postings from users of the said product months ago.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                07-Sep-99 03:10:17
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Microsoft Word 5.5b Download

From: [e-mail]

I do not believe there was ever an Excel for DOS.  The M$ DOS spreadsheet
was Multiplan -- a very excellent product -- but it had no graphics
support.  The compute engine in Excel was basically the old Multiplan
engine.  The graphics support in the DOS environment was from another
product, though I forget its name.  The two together would be an Excel.

I have what I believe is the last M$ Multiplan for DOS: 4.2.  Sadly, it has
very serious Y2K problems, which has finally forced me to look for an
alternate.  At this point, I do not regard StarOffice as a viable
alternate.

In <5cB13oXf0P/[e-mail]>,
[e-mail] (Raphael Tennenbaum) writes:
>[e-mail] (John Hong) wrote:
[snip]
>>    No sign of a free Excel version for DOS users.  I guess during
>>that time, Lotus 1-2-3 pretty much had the market lock stock and barrel.
>>Probably no demand for Excel for DOS.
>
>Yeah, I poked around looking for that as well -- that would
>be a real prize.  (Is it just me, or are MS pages the
>slowest to load on the whole web, not to mention poorly
>organized?  Well, except maybe for Lotus.)
>
>--
>Ray Tennenbaum        '99 YZF-R6
>readme@ http://www.ray-field.com

-- Steve Myers

The E-mail addresses in this message are private property.  Any use of them
to  send  unsolicited  E-mail  messages  of  a  commerical  nature  will be
considered trespassing,  and the originator of the message will be  sued in
small claims court in Camden County,  New Jersey,  for the  maximum penalty
allowed by law.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              06-Sep-99 20:14:03
  To: All                                               07-Sep-99 15:25:24
Subj: Re: How to ...

From: "J. R. Fox" <[e-mail]>

Martin Racette wrote:
>
> On Thu, 2 Sep 1999 17:52:09,
> [e-mail] (John
> Hong) wrote:
>
> > Martin Racette ([e-mail]) wrote:
> >
> > : I would like to know How to copy the
> > : content of an Audio cassette (music), to
> > : a CD-R while using RSJ
> >
> >       I don't think there is a way to do that directly onto a CDR
> > program.  Basically it would be a two-step process, get Digital Audio in
> > your Multimedia directory to store the song in .WAV file format first.
> > I've yet to try this, but you should be able to play the song on your
> > stereo and have it hooked up to your soundcard in the in-line plug and to
> > record with Digital Audio with the source being in-line.
> >
> >
>
> So basicly I hvae to do it on a song per
> song ! :-/
>
> //-------------------------

I don't really know what I'm talking about here, but you may
want to check out a shareware OS/2 program called TWAVE.  There
are a couple users on Compuserve who I think are using this to
put tracks from LPs and reel-to-reel tapes into digital form --
probably .WAV files on the h/d, which could then be converted
into MP3 format, or whatever.  I suspect that TWAVE works with
CDs too.  Of course, you'd then have to go from your h/d to a
new cd using RSJ.  I doubt you'll find a one-step solution.

<jf>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: EarthLink Network, Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    07-Sep-99 03:16:16
  To: All                                               07-Sep-99 15:25:24
Subj: (1/2) Backup & Defragmentation 3.1 (Sept. 7, 1999)

From: [e-mail] (John Hong)

                  Backup & Defragmentation 3.1

     This is just a little primer drawn up in order to help OS/2
users to use common compression utilities such as PkZip for
backing up their OS/2 drives.
     Another use for this is also to fight against fragmentation.
OS/2's HPFS file system does not fragment like the way FAT drives
do, but it does become susceptible to it when the drive is almost
full.  So, the best remedy is to backup the data, format the
partition, then unarchive the backup back to the original
partition and you are back in business.
     Prior to doing this, be sure to create boot disks in order
to compress/uncompress the backup files.  You can use either the
Create Utility Diskettes option in OS/2's System Folder or (a
better option) use BootOS/2 in order to make them.  BootOS/2 in
particular is more advantageous since it would only need two 3.5"
1.44 MB diskettes over the three needed by OS/2 Warp 3 & Connect
and the four for OS/2 Warp 4.  Plus, one can also use LxLite
compression with BootOS/2 in order to save that little extra bit
of disk space necessary.  As well, you can probably use it for an
LS-120 or ZIP disk whereas the Utility Diskettes option would not
support it.  BootOS/2 can be found at the Hobbes OS/2 Archive
(http://hobbes.nmsu.edu).  LxLite can be found at LEO
(http://www.leo.org).
     EXTRA: It is a good idea to make your backups booting
through your bootdisks since there maybe locked files that won't
be compressed.  Locked files are files that are currently in use
by OS/2 and will not allow any kind of manipulation from the user
to take place.
     EXTRA EXTRA: Before making a backup, it maybe a good idea to
run CHKDSK from the bootable floppies first.  Another thing, make
sure you run CHKDSK (CHKDSK X: /F:2) twice in a row.  I picked up
this little tidbit from the "OS/2 Warp Unleashed" book by SAMS
Publishing (fine book, BTW).  It is found in Chapter 18, dealing
with troubleshooting on page 941:

     "Note that if you running HPFS, then you should
     periodically run CHKDSK C: /F:2 twice.  The first pass
     checks and cleans the primary HPFS structures, and the
     second pass checks and clears the secondary HPFS
     structures."

     BTW: When I say it was tested personally under an OS/2
system, it means that I had tested it under a bootable OS/2
partition and not just a partition with data on it.

     Updates:

     * Warp for e-Business
     * Windows 95 - FAT32

     To Do List:

     * Testing ARJ/2 2.6x once it gets out of beta



      *NEW*UPDATE* Warp for e-Business *UPDATE*NEW*

     Okay, now that you've seent this, I have read of a user
on Usenet trying to use RAR/2 2.50 in order to backup their
Warp for e-Business partition.  It didn't work, apparently
the EA's were trashed.  Possibly this may have something to
do with the new LVM and JFS.  I don't know since I do not have
Warp for e-Business, and thus have no way of verifying.  So at
this point in time it is best not to try using any of these
methods for backing up Warp for e-Business.


-----------------------------------------------------------------
Overall
-----------------------------------------------------------------
Compression    | Disk Spanning | Requires PM |  Recovery | EA's |
-----------------------------------------------------------------
PkZip/2 2.50   |      Yes      |     Yes     |    Yes    |  Yes |
Info-Zip 2.22  |       No      |      No     |    Yes    |  Yes |
RAR/2 2.50     |      Yes      |      No     |    Yes    |  Yes |
ARJ/2 2.62 Beta|      Yes      |      No     |    Yes    |   No |
-----------------------------------------------------------------
Disk Spanning: Ability to support multiple archives.  Basically
     once the disk or cartridge is full, it can ask the user to
     insert another disk or cartridge in order for it continue.
     A Yes is good.
Requires PM: Does the compression program require the PM,
     Presentation Manager.  This is OS/2's GUI.  A no is a good
     answer since it would be impossible to boot OS/2 up with
     regular floppies with the PM (unless it was a ZIP/LS-120
     booting with A: drive).
Recovery: Ability to recover/fix a corrupt archive, ie. PkZipFix.
     A yes here is a good answer.  If the file is corrupt you can
     at least salvage something from it.
EA's: Ability to save OS/2's Extended Attributes.  A yes here is
     a must for OS/2.
-----------------------------------------------------------------


Info-Zip for OS/2 (v2.22)
http://www.cdrom.com/pub/infozip/

     Works very well under OS/2.  Use the following switches:

zip -rS$ (destination/name of backup) *

example:

zip -rS$ F:\BACKUP.ZIP *

     Stick unzip.exe onto your OS/2 bootdisks, to restore the
drive simply:

unzip (name of backup)

example:

C: (being where I want it unzipped)
unzip F:\BACKUP.ZIP

     Info-Zip is fine if you are just going to back it up to
another partition or have a removable media drive large enough to
fit it.  Currently, Info-Zip is not able to handle disk spanning.
It is a future feature to be added according to their home
webpage when 3.0 comes out.

Personally tested under a Warp 4 system (no FP's).

-----------------------------------------------------------------

PkZip for OS/2 (v2.50)
http://www.pkware.com

     Another that works well under OS/2.  Perhaps a little better
than Info-Zip since PkZip does handle disk spanning.  Use the
following switch:

pkzip /add /attr=all /dir=full /rec /volume=(drive letter)
     (destination/name of backup) *

example:

pkzip /add /attr=all /dir=full /rec /volume=C F:\BACKUP.ZIP *

     To enable disk spanning, add the /span switch before the
/volume one.
     Take note, use pkzip.exe, do not use pkzip2.cmd or else it
will simply fail and just zip up the volume label in a file
called "all.zip".

     Now to uncompress the archive, simply go:

pkzip /attr=all /dir=full /extract /mask=none /rec /volume=C
     (destination/name of backup)

example:

pkzip /attr=all /dir=full /extract /mask=none /rec /volume=C
F:\BACKUP.ZIP C:

Personally tested under a Warp 4 system (no FP's).

     Extra Note: Apparently the geniuses at PkWare designed PkZip
for OS/2 needing the Presentation Manager.  So, using the boot
disks from the Create Utility Disks function will not work.  The
only way for BootOS/2 to get this to work is with the TYPE=PM
option.  This of course will require a bootable device large
enough to handle the extra data.  So really you are going to need
a bootable ZIP or LS-120 device in order to get this working.
With that said, you can use unzip.exe in order to uncompress the
pkzipped files.  But, that has a problem too.  Currently UnZip
5.40 will not be able to unzip multiple archives (like Zip 2.22).
This is slated for the next major release (UnZip 6.00).

-----------------------------------------------------------------

RAR for OS/2 (v2.50)
http://www.rarsoft.com

     Easiest one to use due to its Norton Commander-like
interface.  Go into RAR's configuration (press F9, it is the
first item on the menu) and make sure the following are checked
on:

     X - Always Solid Archiving
     X - Put Recovery Record

     X - Read Only
     X - Hidden
     X - System
     X - Archive

     X - Save extended attributes

     It could also be a good idea to check on multimedia
compression in order to get better compression.  The rest is
merely of choice, especially the compression (six methods to
choose) whether to be for the best compression (slowest) or no
compression at all in simply storing the files (fastest).
     In order to backup your OS/2 drive, simply hit the "+" key
and push enter in order to highlight all the directories (or
select whichever one's you intend to backup).  Push F5 in order
to compress onto a disk/cart and use Autodetect method in order
to ensure spanning across disks/carts (or you can specify exactly
what size you want).  Very easy.

     Take Note: Do not use "UNRAR.EXE" to restore!
     Otherwise you will get a "Desktop can not be found in
     OS2.INI file, attempting to create Temporary Desktop"
     error message, where the Temperary Desktop will also
     fail, leaving you sitting at the PM with one OS/2
     Window session.

     In order to restore, place RAR.EXE onto the OS/2 bootable
diskettes.  Start RAR.EXE up, now go to wherever you have the
file backed up to, enter it, this will allow you view the files
that are compressed inside the archived file.  Once that is done,
hit the "+" key and press enter in order to highlight all the
files.  Now, press ALT-F4 in order to restore by choosing the
destination.  Simply put in "C:" or wherever your original boot
partition was.  Once all of it extracted, there you go.  I think
we have a winner.

Personally tested under a Warp 4 system (no FP's) and a Warp 3
system (FP40 applied).


-----------------------------------------------------------------

ARJ/2 (v2.62)
http://hobbes.nmsu.edu

     I confess that I have not yet tested ARJ/2, but I wouldn't
recommend using it just yet since it is still in a beta stage,
and does not save EA's.  But you could use EAUTIL in order to do
this for you, but that is a bit of a chore especially since the
other compression utilities here can do this automatically.  So
what would be the point?
     To enable disk spanning for ARJ/2, use:

arj a -vxxxx

     xxxx = denotes the specific size you want it to be

-----------------------------------------------------------------

     Note: I only intend to write about currently supported
     compression utilities.  In otherwords, LHA and ZOO for
     instance I simply will ignore.  Neither one has been
     updated since 1989-1993, and are relatively old and
     obsolete given the others listed here.


Windows 95 - FAT32 (http://www.microsoft.com) - *NEW*

     So, you want to just dump OS/2 forever and head off into
merry merry Windows 95 land?  Well, I have not had the
opportunity to try this using Windows 95 on a VFAT partition,
but under FAT32, there is simply no way you can backup a
Windows 95 partition using stuff like PkZip for Windows or
WinRAR.  The problem is that there are certain locked files
at play.  PkZip for Windows did complete, but now you have the
even bigger problem of trying to restore it from a bootdisk.
Won't happen, I'm afraid.  When I tried this booting off of a
Windows 95 boot disk, running PkZip 2.50's PkUnZip utility, it
would not work because it complained of a lack of memory
(apparently the FAT32 support on the bootdisk takes up a lot
of memory as I'm always stuck with 542k conventional RAM).
The last hope was RAR for DOS, but that too also complained of
a lack of memory.  So, what's the point of using a Windows
compression utility in order to backup the entire Windows 95
partition if there is absolutely *NO* way of restoring it?
     Now, where exactly am I going with all this?  Simple,
thanks to the great FAT32 driver written by Henk Kelder, one
can actually follow the exact methods listed here with the
various compression utilities in order for OS/2 to backup
Windows 95 through OS/2!  Using RAR/2 in the identical manner
listed earlier will allow you to backup a Windows 95 partition.
Once backed up, you can boot up with the Windows 95 bootdisk
and then format the partition, re-boot back into OS/2 and use
RAR/2 in order to restore the Windows 95 partition back to
its previous state.  Now when you look at the disk with Norton
Speedisk or booting Windows 95 up with a bootdisk in order to
use ScanDisk (to see the entire disk information) you will see
all the clusters neatly arranged in perfect order.  No
fragmentation!  The advantage to using this method over using
programs like Microsoft Defrag or Norton Speedisk is that they
are not always perfect and can in fact at some times break
files.  My motivation in going to all of this trouble was
because after using Defrag, I found that one of my .WAV files
in my Multimedia Themes was broken and could not be accessible.
Imagine what else could break.
     I have not tried using Info-ZIP or PkZip for OS/2, but
I figure they would work with the same restrictions applied
(ie. Info-Zip no disk spanning, PkZip needing the Presentation
Manager).  In order to install Henk's FAT32 driver, I simply
followed the quicky instructions he had listed in the FAT32.TXT
file, using PARTFLT.FLT and not the OS2DASD.DMD file he had
modifyed (on my OS/2 box it trapped as a result).  On the
IFS=FAT32 line I did not have /EAS on (enabling Extended
Attribute support).
     So, do you *really* want to dump OS/2?  Didn't think
so.  A question...could this method work with Linux?  There
is a ext2 driver available for OS/2, that I know of.  Perhaps
that is something else for me to try and play with! ;-)


CONCLUSION

     The best compression program for backing up OS/2 with is
RAR/2, hands down.  Not only does it support disk spanning,
EA's, doesn't require the Presentation Manager, and can recover
from corrupt archives, but it is also easy to use due to the
text-based Norton Commander-like interface, so no messy command
line switches to are necessary.  A great piece of work, indeed!
Capable of backing up OS/2 onto another partition or onto
multiple disks/cartridges making it right now, the emergency
disaster recovery solution of choice out of the current crop of
common compression utilities.
     There are a few more coming, the next major release of
Info-Zip (Zip 3.00 & UnZip 6.00) are being planned to support
multiple archives.  ARJ/2 2.6x, currently in beta, is another
possible choice to look at since it doesn't need the PM and
supports disk spanning and recovery from corrupt archives.


BOOTOS/2 Notes:
http://hobbes.nmsu.edu - latest version is 9.17

     There seems to be a problem with Warp Connect & FP39 when
trying to make a BootOS/2 TARGET=x TYPE=PM partition.  It creates
it fine, but when I boot it up, it freezes at the "OS/2" box that
appears on the top left-hand corner.  Weird.  I could not boot
to a PM partition (BOOTOS2 TARGET=x TYPE=PM) even when I was back
down in FP26!  Same symptom occurs, during bootup it just freezes
at the "OS/2" box on the top left-hand corner.  The samething
also occurs in FP40, BTW.
     Even making just the floppies seems to cause a small error

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    07-Sep-99 03:16:16
  To: All                                               07-Sep-99 15:25:24
Subj: (2/2) Backup & Defragmentation 3.1 (Sept. 7, 1999)

with Warp 3 & Connect.  Under FP40, for instance, upon making the
two disk system (BOOTOS2 2DISK=A) after loading up the first disk
it would give me a blank screen and stop dead in its tracks,
going no further.  The solution, copy SESMGR.DLL from your
x:\OS2\DLL onto your BOOTOS2 disk 1 (A:\OS2\DLL).  This also
happened under FP39, BTW.  If you do run into any other kind of
problem with the BOOTOS2 floppies, press ALT-F2 upon booting up
the diskettes just to see what happens.  On this occasion for
example, upon pressing ALT-F2, the screen said that SESMGR.DLL
was not installed in any of the LIBPATH directory statements on
the diskette.
     Warp 4 seems to have absolutely no issues whatsoever, either
a TYPE=PM or 2DISK=A under any of the FP's I have used (FP1, FP6,
& FP10).


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            06-Sep-99 19:14:15
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Imation IDE Super Disks and OS/2

From: "Jeff Malka" <[e-mail]>

Where does one get the latest IBM1s506.ADD for Warp 3?

Thanks
--
Jeff Malka <[e-mail]>
John Hong <[e-mail]> wrote in message
news:7qtrj4$qel$[e-mail]...
> William Sonna ([e-mail]) wrote:
>
> : I thought so too. That's what IBM has been claiming.  That's why I
> : bought the drive.
>
> : Unfortunately, it doesn't work that way.
>
> : IBM1S506.ADD sees the device as "PIO3 ATAPI" but no drive letter gets
> : assigned.
>
> You also need IBMATAPI.FLT installed as a BASEDEV, too.  It's an
> ATAPI drive.
>
>


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              06-Sep-99 21:29:04
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Microsoft Word 5.5b Download

From: Dennis Peterson <[e-mail]>


[e-mail]
wrote:
>
> I do not believe there was ever an Excel for DOS.

There was
but it
required
the GUI
shell
known as
Windows
2.1 or a
Windows
2.1
runtime
environment.

[snip]

> I have what I believe is the last M$ Multiplan for DOS: 4.2.  Sadly, it has
> very serious Y2K problems, which has finally forced me to look for an
> alternate.  At this point, I do not regard StarOffice as a viable
> alternate.

Why? I'm
seeing
some
performance
problems
with it in
OS/2 but
it
performs
fine on my
Unix
systems.
Regardless,
it gets
the job
done so
far but
I've
steadfastly
avoided
mucking
with Excel
macros
since they
always
seem to
break in
the next
release.

I'm also
curious if
Excel for
PM has Y2K
problems
-- I
should
light it
off and
see...

dp

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: I'm not organized at all (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          07-Sep-99 16:09:25
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Q: Rollback IDE drivers?

From: "Wayne Bickell" <[e-mail]>

Perhaps it's the default action of enabling Bus Mastering
that is causing the problems. Have you read the advice
on disabling it in the readme?

Cheers

Wayne


On Mon, 06 Sep 1999 14:05:22 -0400, Mark H. Bickford wrote:

:>How can I safely rollback the IDE drivers to the original level after
:>applying a Fixpack?  My machine (486 DX4-100) does not have a large HDD,
:>and some programs cause my machine to trap with a 000D just after
:>IDEDASD is installed during boot.  I thought of copying the files back
:>off of the install disks, but will I need to do that every time I
:>install a new fixpack?  What is the best way to do this?
:>
:>TIA for any help anyone can shed.
:>
:>Best regards,
:>Mark

******************************************************
Wayne Bickell
Tokyo, Japan
[e-mail]
******************************************************
           Posted with PMINews 2 for OS/2
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               07-Sep-99 10:52:05
  To: All                                               07-Sep-99 15:25:24
Subj: Check Out  DCITU

From: "C.J." <[e-mail]>

DCITU
*********

Digital Camera Image Transfer Utility.

This program allows images to be transferred from various digital cameras to
an OS/2-based computer. The transfer is accomplished using the standard
serial port  cable usually supplied with the camera. Currently supported
cameras include various
models from Kodak, Agfa, Epson, Olympus, Sanyo, Sierra and Toshiba.
More information on the camera models is available from DCITU Beta
Information Page

Check it out and download DCITU for a free trial period from:
http://www.btsoftware.com/os2/dcitu.htm


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: C.J. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    06-Sep-99 10:13:14
  To: All                                               07-Sep-99 15:25:24
Subj: Re: the future of os/2

From: [e-mail] (James Knott)

In article <[e-mail]>, [e-mail] wrote:
>In <[e-mail]>, [e-mail] (James Knott) writes:
>
>
>>>╗ I have seen some applications (Personal Communications comes to mind)
>>>╗ that would die, but some part of the program was still "running" and
>>>╗ even the task manager couldn't kill it.  You then have to reboot,
>
>>Would you consider 4 or 5 occasions inside half an hour rare?  I can
>>recreate that situation at will.
>
>>E-mail [e-mail]
>
>Would you agree with me that it is still possible to lock OS/2 Warp 4,
>even as late as FP8, with telecommunications programs and serial port use
>when the serial port connections go berserk?  It produces situations where
>the thread reports "unknown" to Mole, for example and the only way to
>kill the thread is to completely reboot.

I've never claimed OS/2 is perfect.  There are sompe problems.

>Perhaps I should clarify that DOS-VDM's are involved.  I have no idea if
>the same problem(s) would apply to a totally native OS/2 communications
>system setup as a number of apps needed are just not available in native
>OS/2 at all.

I haven't used a DOS com app in almost 7 years.  Come to think of it,
I don't often use any com stuff other than the internet and fax these
days. I have HyperAccess Pro, but it rarely gets used nowadays.


--
E-mail [e-mail]
_________________________________________________________________________
The above opinions are my own and not those of ISM Corp., a subsidiary of
IBM Canada Ltd.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    06-Sep-99 10:17:06
  To: All                                               07-Sep-99 15:25:24
Subj: Re: the future of os/2

From: [e-mail] (James Knott)

In article <fsPSN9=[e-mail]>,
Martin Nisshagen <[e-mail]> wrote:
>James Knott [Global Network Services - Remote Access Mail & News Services] ->
>comp.os.os2.misc:
>
>╗ Would you consider 4 or 5 occasions inside half an hour rare?  I can
>╗ recreate that situation at will.
>
>I'm sure you can if done intentionally (that they you can crash even a
Solaris
>server). Have you tried any of the kill utilities in the resource kit?

While it may be killed with some tools, we can't count on users to do
this.  We have to find the cause of the problem and get it fixed.
Failing that, we have to make sure the help desk people are aware of a
work around.

>
>╗ >╗ Furthermore, performance sucks on NT.  When I do my testing NT, takes
>╗ >╗ me far longer than OS/2 (fastest) or W95.
>╗ >
>╗ >You haven't done your testing very deep me think. OS/2 is a bit difficult
to
>╗ >directly compare as it doesn't run the exactly the same applications
(which I
>╗ >regret as it would have been very interesting to be able to directly
combat
>╗ >such statements like yours), but NT4 running the same application as on
Win95
>╗ >is *much* faster (15-35% faster). This has been shown in several
independent
>╗ >tests by both magazines and NSTL. You can also easily do a real test your
self
>╗ >by running some of the several available application bench marks (they
measure
>╗ >real world performance by scripting typical usage of standard
applications).
>╗
>╗ Some of the applications I test with are available on all three
>╗ platforms. i.e. Personal Communications.  Personal Communications
>╗ works far better on OS/2 than on either Windows version.
>
>This is IMO really pathetic.

I am stating *MY* experiences on the three platforms.  In the testing
I've done, NT comes out slower in most things.  We don't even test NT
in less than 64 MB, because it is so slow with anything less.

 >1.
>
>IE 5.0 on NT runs better than on Solaris, and no, I don't think it's the
fault
>of Solaris. You can't compare same application, but different ports as equal.
>
>2.
>
>And in the case that you *can* compare equally, as in the example above
>between NT4 and Win95/98, you totally seems to ignore that (even if you a
post
>earlier stated that Win9x was more efficient than NT4).
>
>╗ >NT also easily beats Linux as a web server OS in raw performance of
serving
>╗ >pure HTML pages on the exact same hardware. Unfortunately I haven't seen
any
>╗ >such comparison and test between OS/2 and other operating systems (but I
doubt
>╗ >very strongly if it would come close to either NT or Linux on same
hardware).
>╗
>╗ I can't comment Web Servers, but a couple of years ago, one of the
>╗ magazines did a test on file & print servers.  A single CPU Warp
>╗ Server was considerably faster than a single CPU NT server and almost
>╗ as fast as a 4 CPU NT server.
>
>Haven't seen that test, but the last one NT4 Server beat Linux with SAMBA as
>file server (and both on same hardware, and single processor machine).
>
>Best regards,
>
>m a r t i n | n
>
>--
>Martin Nisshagen                 PGP 6.0: 0x45D423AC      K R A F T W E R K
:-)
>CS/CE, Chalmers, Sweden          ICQ UIN: 689662          2 x 300A @ 450 MHz
>d4nisse-at-dtek-chalmers-se      home2.sbbs2.com/mn
home2.sbbs2.com/mn/kw

--
E-mail [e-mail]
_________________________________________________________________________
The above opinions are my own and not those of ISM Corp., a subsidiary of
IBM Canada Ltd.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    06-Sep-99 11:04:16
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Rexx/exe cgi-bin to show system uptime

From: [e-mail] (James Knott)

In article <3Bd8PsIG3uxi-pn2-c8FsFtEhLBHF@octek>,
[e-mail] (Dominique Pivard) wrote:
>On Sun, 5 Sep 1999 15:41:45, [e-mail] (Khairil
>Yusof) wrote:
>>
>> Thanks that did the trick.. Quite a flexible program, you can edit it to
change
>> any text files. Only gripe is the time output format which is fixed.
Hopefully
>> it can be modified in a later version.
>
>V. 1.6 was released on Sep-2 and v. 1.5 on Aug-10, which seems to
>indicate the author is actively working on it. Maybe you should
>contact him directly in order to influence the time format.

If not, it would be easy to run the output through a REXX script to
change the format.


--
E-mail [e-mail]
_________________________________________________________________________
The above opinions are my own and not those of ISM Corp., a subsidiary of
IBM Canada Ltd.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 09:10:15
  To: All                                               07-Sep-99 15:25:24
Subj: Re: Microsoft Word 5.5b Download

From: [e-mail] (Stefan A. Deutscher)

On 6 Sep 1999 17:58:38 GMT, John Hong <[e-mail]> wrote:
>
>    Some people may experience a black screen trap pointing towards
>POINTER$$ or something like that.  It is the POINTDD.SYS file that is
>where Microsoft Word 5.5b goes nuts with.  At the time I was using the
>DDPAK01's POINTDD.SYS, so I backleveled that to the default Warp 3 one
>(10-03-94).  Works fine with the DDPAK01'd MOUSE.SYS and what not.  I
>don't see any difference.
>    This seems to be agreeable with Word 5.5b.  No trap's...yet.
>After playing around with this, it isn't a wonder that Word 5.5 could not
>beat WordPerfect 5.1 during its day.  It's not bad, but it does lack some of
>the features that WP5.1 had.  No endnote capability (does do footnotes,
>though).  The one that I really could not understand was the lack of a
>zoom capability during print preview.  Ick.  One thing that I did like
>was the graphical display, but the thing is, you can not use the mouse

You can, at least with Word 5.0, if you run it in a DOS box rather than
as OS/2 app. It's bound, and even as OS/2 app you don't get long file
names. So, unless you run protectonly=yes you don't gain much from
running it as OS/2 app, but you loose the ability to use the mouse in
graphics mode.

>which sort of made the thing pointless.  One thing that I will give
>credit for, which seems to reflect the majority of Microsoft programs is
>that they made Word 5.5b, simple.  So I can see why Word 5.x users refuse
>to move onto the newer versions of Word.  This must have been the main
>reason why Microsoft let Word 5.5b go as a freebie for the existing Word
>5.0 users.

I really like(d) Word 5.0. Coming from Wordstar 3.x / 4.x it took me
some time to convert, but apart from the key sequences in WS there was
nothing I'd miss in Word 5.0. No nonsense menus, text always visible,
IMHO the only useful piece of software they ever produced.

 Cheers,
              Stefan


--
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  [e-mail]
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           07-Sep-99 11:48:25
  To: All                                               07-Sep-99 15:25:25
Subj: Re: XGA w/ OS/2 and Linux on laptop

From: Csaba Raduly <[e-mail]>

[e-mail] wrote:
>
> Greetings!
>
> I'm looking for a new laptop. It looks like I'm going back to Sager
> (having somehow blown away my old trusty).
>
> I see some video is designated as XGA.
>
> Does this raise any problems for OS/2 or for Linux?
>
> I note also that a couple run ATI Rage Pro 3D AGP. I have the impression
> this isn't good for OS/2 and for Linux; right or wrong?
>
My computer at work has a 3D Rage IIc video card. The drivers
on the CD were passable, but I couldn't get more than 60 Hz
vertical refresh, which is awful. I finally got some newer drivers
which are capable of 80+ Hz. GRADD may be even better.
The SciTech drivers produced all kinds of wonderful
resolution/refresh combinations (up to 100 Hz :-)

Your card has a similar name, which means that there may be
absolutely nothing in common between them :-) . YMMV.

From what I've heard ATI are definitely Linux-unfriendly.
Not only they don't make drivers, they won't let others do it :-(
Csaba
--
-----BEGIN GEEK CODE BLOCK-----
Version 3.1
GCS/>GMU d- s:- a30 C++$ UL+ P+>+++ L++ E- W+ N++ o? K? w++>$ O++$ M-
V- PS PE Y PGP- t+ 5 X++ R* tv++ b++ DI+++ D++ G- e+++ h-- r-- !y+
-----END GEEK CODE BLOCK-----

Csaba Raduly,    Software Developer (OS/2),    Sophos Anti-Virus
mailto:[e-mail]            http://www.sophos.com/
US Support +1 888 SOPHOS 9            UK Support [phone]
Life is complex, with real and imaginary parts.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: SOPHOS Plc (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             07-Sep-99 11:30:08
  To: All                                               07-Sep-99 15:25:25
Subj: Re: Check Out  DCITU

From: [e-mail] (Dominique Pivard)

I have registered DCITU and I must say I'm very disappointed with it:
I have never been able to transfer more than 4-5 pictures at a time
between my Olympus D-500L and my Thinkpad. I have tried almost every
possible trick: with / without SIO drivers, different speeds,
different settings in DCITU etc. Had I known, I would have purchased a
PCMCIA adapter for SmartMedia cards, which can be found for about the
same price on Ebay.

Just my $0.02.

Dominique

On Tue, 7 Sep 1999 08:52:10, "C.J." <[e-mail]> wrote:

> DCITU
> *********
>
> Digital Camera Image Transfer Utility.
>
> This program allows images to be transferred from various digital cameras to
> an OS/2-based computer. The transfer is accomplished using the standard
> serial port  cable usually supplied with the camera. Currently supported
> cameras include various
> models from Kodak, Agfa, Epson, Olympus, Sanyo, Sierra and Toshiba.
> More information on the camera models is available from DCITU Beta
> Information Page
>
> Check it out and download DCITU for a free trial period from:
> http://www.btsoftware.com/os2/dcitu.htm

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: None!! (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 14:08:08
  To: All                                               07-Sep-99 15:25:25
Subj: Re: toshiba vs. thinkpad

From: "Esko Kauppinen" <[e-mail]>

On Mon, 06 Sep 1999 06:49:56 -0400, Bob Germer wrote:

>...
>FWIW, I have a 390e with a Celeron and it is quite satisfactory. However,
>I do not have V.90 modem access in Warp and I have no sound in WinOS/2.
>...

Just curious, what if you use the soundblaster drivers in WinOS/2?

I couldn't get the ESS WinOS/2 drivers on my compaq to work so I installed
the Sound Blaster 1.5 from the drivers setup and have now sound.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      07-Sep-99 14:24:03
  To: All                                               07-Sep-99 15:25:25
Subj: Re: the future of os/2

From: Martin Nisshagen <[e-mail]>

James Knott [Global Network Services - Remote Access Mail & News Services] ->
comp.os.os2.misc:

» >» Would you consider 4 or 5 occasions inside half an hour rare?  I can
» >» recreate that situation at will.
» >
» >I'm sure you can if done intentionally (that they you can crash even a
Solaris
» >server). Have you tried any of the kill utilities in the resource kit?
»
» While it may be killed with some tools, we can't count on users to do

I'm just telling you that even if I had very rare such problems with NT
compared to many others, no fairly complex OS is 100% absolutely problem free
and that some problem always can come up in single circumstances.

» this.  We have to find the cause of the problem and get it fixed.

If you think the problem is with NT you just follow the normal guidelines and
report it (read probrep.txt on the system and mail it to [e-mail]).

If you think (as I think it seems to be in this case judging from your
comments so far) that the problem is with the application (for example setting
a thread so high in priority that Task Manager normally can't kill it when it
fails due to a bug in the application) you should contact that vendor and
report the problem to them according to their routines.

» I am stating *MY* experiences on the three platforms.  In the testing
» I've done, NT comes out slower in most things.  We don't even test NT
» in less than 64 MB, because it is so slow with anything less.

What testing I might ask?

What applications, and how did you measure that?

Sorry for asking and if I'm a bit sceptical to your claims, but all of the
general tests (not measuring one single application, but several of the most
common ones) I have seen so far shows that NT4 beats the hell out of Win95/98
on modern  processors (PPro, PII/Celeron, PIII) already with as little as only
32MB installed in the system.

Best regards,

m a r t i n | n

--
Martin Nisshagen                 PGP 6.0: 0x45D423AC      K R A F T W E R K
:-)
CS/CE, Chalmers, Sweden          ICQ UIN: 689662          2 x 300A @ 450 MHz
d4nisse-at-dtek-chalmers-se      home2.sbbs2.com/mn
home2.sbbs2.com/mn/kw

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Chalmers University of Technology, Sweden (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 07-Sep-99 07:38:27
  To: All                                               07-Sep-99 15:25:25
Subj: Re: UMAX + Win-OS/2

From: "Steve McCrystal" <[e-mail]>

On Sun, 05 Sep 1999 06:02:43 GMT, Stan Goodman wrote:

>You probably have an excellent reason for not getting e.g. the CFM driver,
>so that you could use the scanner under a native OS/2 application. That's
>how I am using my UMAX SCSI scanner.

A UMAX 1220S, perhaps?  If so, can it be hooked to any real SCSI HBA, as
opposed to the one that
came with the scanner?

Regards,

Steve



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ExecPC Internet - Milwaukee, WI (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 07-Sep-99 07:40:26
  To: All                                               07-Sep-99 15:25:25
Subj: Re: UMAX + Win-OS/2

From: "Steve McCrystal" <[e-mail]>

On 5 Sep 1999 08:04:05 EDT, fledermaus wrote:

>I have a umax astra 1220s with scsi card which runs well with os/2 and
>software from cfm (cfmsane) and pmview.

Which SCSI card, please?

Regards,

Steve



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ExecPC Internet - Milwaukee, WI (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 14:48:00
  To: All                                               07-Sep-99 15:25:25
Subj: Re: the future of os/2

From: "Esko Kauppinen" <[e-mail]>

On Fri, 03 Sep 1999 13:08:36 +0100, Martin Lafaix wrote:

>[The figure above is quite pessimistic.  Computers are usually not
> used continuously 14 hours per day.  And you have to take into
> account that you'll also save on office cooling (and heating too, as
> computers are not the most effective heating devices :-).]

So where does the energy go? In my opinion all the energy
my computer takes, turns into heat which helps the heating
device to save the same amount of energy.

As I live in a cold climate this is most of the year true.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  07-Sep-99 13:08:19
  To: All                                               07-Sep-99 15:25:25
Subj: Re: UMAX + Win-OS/2

From: [e-mail] (Stan Goodman)

On Tue, 7 Sep 1999 13:38:55, "Steve McCrystal" <[e-mail]> wrote:

> On Sun, 05 Sep 1999 06:02:43 GMT, Stan Goodman wrote:
>
> >You probably have an excellent reason for not getting e.g. the CFM driver,
> >so that you could use the scanner under a native OS/2 application. That's
> >how I am using my UMAX SCSI scanner.
>
> A UMAX 1220S, perhaps?  If so, can it be hooked to any real SCSI HBA, as
opposed to the one that came with the scanner?

It is 1220S; you can use it with any standard SCSI card -- the one that
comes with the scanner (which is not always the same one) is just a minimal
SCSI card, and a "real one" is a step up, misses nothing. The one that came
with mine wouldn't work with OS/2 (I've forgotten why).


-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to [e-mail] will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           07-Sep-99 13:54:04
  To: All                                               07-Sep-99 18:14:23
Subj: Re: UMAX + Win-OS/2

From: [e-mail] (Lorne Sunley)

On Tue, 7 Sep 1999 13:40:53, "Steve McCrystal" <[e-mail]>
wrote:

> On 5 Sep 1999 08:04:05 EDT, fledermaus wrote:
>
> >I have a umax astra 1220s with scsi card which runs well with os/2 and
> >software from cfm (cfmsane) and pmview.
>
> Which SCSI card, please?
>
>

Just jumping in, I set up my Father's UMAX 1220S with a Tekram DC-390
SCSI-2
controller, and it works great with PMSANE.

Lorne Sunley


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MBnet Networking Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              07-Sep-99 15:09:14
  To: All                                               07-Sep-99 18:14:23
Subj: Re: XGA w/ OS/2 and Linux on laptop

From: [e-mail] (Peter Stein)

In article <[e-mail]>,
Csaba Raduly  <[e-mail]> wrote:
>[e-mail] wrote:
>>
>> Greetings!
>>
>> I'm looking for a new laptop. It looks like I'm going back to Sager
>> (having somehow blown away my old trusty).
>>
>> I see some video is designated as XGA.
>>
>> Does this raise any problems for OS/2 or for Linux?
>>
>> I note also that a couple run ATI Rage Pro 3D AGP. I have the impression
>> this isn't good for OS/2 and for Linux; right or wrong?
>>
>My computer at work has a 3D Rage IIc video card. The drivers
>on the CD were passable, but I couldn't get more than 60 Hz
>vertical refresh, which is awful. I finally got some newer drivers
>which are capable of 80+ Hz. GRADD may be even better.
>The SciTech drivers produced all kinds of wonderful
>resolution/refresh combinations (up to 100 Hz :-)
>
>Your card has a similar name, which means that there may be
>absolutely nothing in common between them :-) . YMMV.
>
>From what I've heard ATI are definitely Linux-unfriendly.
>Not only they don't make drivers, they won't let others do it :-(

xfree86 3.3.5 has ATI Rage support. If this is unsatisfactory there is
the commercial Xinside (www.xig.com) server. I have no experience with
ATI drivers, but have been researching the issue as I'm contemplating
a laptop with the Rage Pro chipset (other chipsets such as NeoMagic are
even worse from an OS2/Linux perspective). I've seen some reports that
the GRADD drivers work, although slowly.

Peter Stein
[e-mail]

>Csaba
>--
>-----BEGIN GEEK CODE BLOCK-----
>Version 3.1
>GCS/>GMU d- s:- a30 C++$ UL+ P+>+++ L++ E- W+ N++ o? K? w++>$ O++$ M-
>V- PS PE Y PGP- t+ 5 X++ R* tv++ b++ DI+++ D++ G- e+++ h-- r-- !y+
>-----END GEEK CODE BLOCK-----
>
>Csaba Raduly,    Software Developer (OS/2),    Sophos Anti-Virus
>mailto:[e-mail]            http://www.sophos.com/
>US Support +1 888 SOPHOS 9            UK Support [phone]
>Life is complex, with real and imaginary parts.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Suburban Robots That Monitor Reality (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 16:51:00
  To: All                                               07-Sep-99 18:14:23
Subj: Re: Check Out  DCITU

From: "Esko Kauppinen" <[e-mail]>

On 7 Sep 1999 11:30:17 GMT, Dominique Pivard wrote:

>I have registered DCITU and I must say I'm very disappointed with it:
>I have never been able to transfer more than 4-5 pictures at a time
>between my Olympus D-500L and my Thinkpad. I have tried almost every
>possible trick: with / without SIO drivers, different speeds,
>different settings in DCITU etc. Had I known, I would have purchased a
>PCMCIA adapter for SmartMedia cards, which can be found for about the
>same price on Ebay.

No problems here between my Olympus C-900 and my Compaq.
What I noticed was that when using the 115200 transfer speed
I easily get transfer errors if I use the computer at the same time.
Attempt to use speeds above that doesn't work at all.

But if I leave it to to it's job I have no problems. I today transferred
46 pictures without errors.

It is slow compared to a PC-Card adapter but you don't have to
hassle with the SM card.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   07-Sep-99 11:25:02
  To: All                                               07-Sep-99 18:14:23
Subj: Re: What ver of warp for a home dual cpu machine?

From: [e-mail] (Harry Travis)

In <[e-mail]>, on 09/04/99

   at 10:45 PM, [e-mail] (Lorne Sunley) said:

>On Sat, 4 Sep 1999 19:13:21, [e-mail] (Devin) wrote:

>> On Sat, 04 Sep 1999 14:19:08 +0200, Christian Hennecke
>> <[e-mail]> wrote:
>>
>> >Devin schrieb:
>> >>
>> >> Hi. I am completely new to warp and woud like to know what is the best
>> >> version of warp for a home dual cpu?
>> >>
>> >> As far as networking, I would only need peer to peer networking (to
>> >> share files on another home pc) and access to my cable modem via
>> >> ethernet. It will not act as a server in any way.
>> >>
>> >> Thank you.
>> >
>> >None of the client versions supports SMP, only Warp Server SMP or the
>> >new Warp Server for e-business. There are rumours that IF a Stardock
>> >client becomes reality it will have SMP support.
>> >
>> >Christian Hennecke
>> >--
>> >Keep passing the open windows! ("The Hotel New Hampshire", John Irving)
>>
>>
>> Hmmm...just for the sake of arguement (excluding issues of price)
>> would Warp Server SMP with two 550Mhz P3's be faster or using one 550
>> with warp client?

>Based on results from playing around on dual processor P II @400 Mhz
>board (ATC6280) Warp Server SMP is faster with two processors than
>it is with only one installed. When a task does proper multi-threading
>and the processing of the threads don't block because they are
>dependant
>on the processing of other threads, the task seems to complete in
>just over 1/2 the time on two processors than it takes on one.

>Tasks that have only a single working thread (like the SETI@HOME
>client) take just as long on two processors as they do on one. Mind
>you, you can run two SETI@HOME clients and get twice the work
>units completed in the same elapsed time (using two processors).

>General purpose work, when you have multiple acitivities going
>on, is faster with two processors. If all you are doing is a single
>task, like typing a message, you would not be able tell if you
>have one or two processors.

Sitting here with a dual processor-capable  200mhz machine, which would I
rather do, pay $1000 + rebuild/reload time for a new computer with Intel's
latest, or double up what I have for< $150? Given the difference, I'd gladly
pay twice what NT4 client costs  for an SMP-capable OS/2 WS version.



--
-----------------------------------------------------------
[e-mail] (Harry Travis)
DemostiX
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 17:37:13
  To: All                                               07-Sep-99 18:14:23
Subj: Re: [OT] Did I kill my laptop?

From: "Esko Kauppinen" <[e-mail]>

On Sun, 05 Sep 1999 17:20:18 -0400, [e-mail] wrote:

>In <[e-mail]>, on 09/05/99
>   at 09:37 PM, Tim Timmins <[e-mail]> said:
>
>
>>Did you try putting the old CPU back?
>
>>What jumpers/BIOS settings DID you change?
>
>It's the darnedest but _neither_ CPU works. I didn't change any jumpers or
>BIOS settings. Just pulled the old out and put in the new.
>
>I can't really believe I shorted anything but I can't see any other
>explanation.
>
>I just get a brief touch of the HD and a running fan when I boot. No BIOS
>screen or anything else. I've booted without the HD and the FD, makes no
>difference.
>
>Nothing more unnerving than a completely black screen on boot-up!

Heh, I know that feeling.

I recently had a similar thing with my laptop after "deep charging" the
battery. When I installed it the machine would not boot, not even when
plugged in and battery removed.

The solution for me was to remove the small backup battery which is
easily available on my compaq on the bottom.

After installing it the clock was somewhere in year 1997 but the BIOS
otherwise OK. And the machine booted OK!

Afterwards the battery also was and is OK. What upset it is a mystery.

Worth a try if you haven't already.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 11:57:11
  To: All                                               07-Sep-99 20:34:10
Subj: Re: XGA w/ OS/2 and Linux on laptop

From: [e-mail]

In <7r39r8$q0n$[e-mail]>, on 09/07/99
   at 03:09 PM, [e-mail] (Peter Stein) said:

>>From what I've heard ATI are definitely Linux-unfriendly.
>>Not only they don't make drivers, they won't let others do it :-(

>xfree86 3.3.5 has ATI Rage support. If this is unsatisfactory there is
>the commercial Xinside (www.xig.com) server. I have no experience with
>ATI drivers, but have been researching the issue as I'm contemplating a
>laptop with the Rage Pro chipset (other chipsets such as NeoMagic are
>even worse from an OS2/Linux perspective). I've seen some reports that
>the GRADD drivers work, although slowly.

Working my way backwards in this thread - I saw a site (Lindsay Computer
Systems) which preloads Linux. They use the ATI Rage so that's
encouraging.

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 11:59:02
  To: All                                               07-Sep-99 20:34:10
Subj: Re: XGA w/ OS/2 and Linux on laptop

From: [e-mail]

In <[e-mail]>, on 09/07/99
   at 11:48 AM, Csaba Raduly <[e-mail]> said:

>My computer at work has a 3D Rage IIc video card. The drivers on the CD
>were passable, but I couldn't get more than 60 Hz  vertical refresh,
>which is awful. I finally got some newer drivers which are capable of 80+
>Hz. GRADD may be even better.
>The SciTech drivers produced all kinds of wonderful
>resolution/refresh combinations (up to 100 Hz :-)

>Your card has a similar name, which means that there may be
>absolutely nothing in common between them :-) . YMMV.

>From what I've heard ATI are definitely Linux-unfriendly.
>Not only they don't make drivers, they won't let others do it :-( Csaba

At least one reseller preloads Linux on systems with this card (Lindsay
Computers) so it's definitely possible and I assume a stable setup.

Your news about OS/2 sounds encouraging - I hope I interpret you
correctly?

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 12:08:04
  To: All                                               07-Sep-99 20:34:10
Subj: Re: [OT] Did I kill my laptop?

From: [e-mail]

In <[e-mail]>, on 09/07/99
   at 05:37 PM, "Esko Kauppinen" <[e-mail]> said:

>I recently had a similar thing with my laptop after "deep charging" the
>battery. When I installed it the machine would not boot, not even when
>plugged in and battery removed.

>The solution for me was to remove the small backup battery which is
>easily available on my compaq on the bottom.

>After installing it the clock was somewhere in year 1997 but the BIOS
>otherwise OK. And the machine booted OK!

>Afterwards the battery also was and is OK. What upset it is a mystery.

>Worth a try if you haven't already.

No joy.

(As far as I can tell, there's only one battery here.)

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              07-Sep-99 16:18:04
  To: All                                               07-Sep-99 20:34:10
Subj: Re: XGA w/ OS/2 and Linux on laptop

From: [e-mail] (Peter Stein)

In article <37d53618$15$qnivfs$[e-mail]>,
 <[e-mail]> wrote:
>In <7r39r8$q0n$[e-mail]>, on 09/07/99
>   at 03:09 PM, [e-mail] (Peter Stein) said:
>
>>>From what I've heard ATI are definitely Linux-unfriendly.
>>>Not only they don't make drivers, they won't let others do it :-(
>
>>xfree86 3.3.5 has ATI Rage support. If this is unsatisfactory there is
>>the commercial Xinside (www.xig.com) server. I have no experience with
>>ATI drivers, but have been researching the issue as I'm contemplating a
>>laptop with the Rage Pro chipset (other chipsets such as NeoMagic are
>>even worse from an OS2/Linux perspective). I've seen some reports that
>>the GRADD drivers work, although slowly.
>
>Working my way backwards in this thread - I saw a site (Lindsay Computer
>Systems) which preloads Linux. They use the ATI Rage so that's
>encouraging.

I'm familiar with LCS (have ordered product from Rick) as they tend to
carry high quality components and are very OS2 and Linux aware, but I cannot
find any references to preloading Linux and/or use of the ATI Rage. They do
list sample configurations from time to time so perhaps they listed an Asus
laptop with Linux, but I can't find any such configuration on their web site
right now.

>
>F.
>
>-----------------------------------------------------------
>      Felmon John Davis
>     [e-mail]    |  [e-mail]
>     Union College /  Schenectady, NY
>     - insert standard doxastic disclaimers -
>     OS/2 - ma kauft koi katz em sack
>-----------------------------------------------------------
>


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Suburban Robots That Monitor Reality (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               07-Sep-99 16:16:16
  To: All                                               07-Sep-99 20:34:10
Subj: Re: Microsoft Word 5.5b Download

From: [e-mail]  (R.W. Hutchinson)

>I really like(d) Word 5.0. Coming from Wordstar 3.x / 4.x it took me
>some time to convert, but apart from the key sequences in WS there was
>nothing I'd miss in Word 5.0. No nonsense menus, text always visible,
>IMHO the only useful piece of software they ever produced.

    I still think that Word 5.0 was the best Word Processor I ever used, but I
hear rumours that there HAVE been pretty decent versions of Excel too, some
time
in the past perhaps. Never used it myself.
--------------------------------------------------------------
"I would predict that there are far greater mistakes waiting
to be made by someone with your obvious talent for it."
Orac to Vila. [City at the Edge of the World.]
-----------------------------------------------
R.W. Hutchinson. | [e-mail]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: InfiNet (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                07-Sep-99 12:41:26
  To: All                                               07-Sep-99 20:34:10
Subj: Re: Microsoft Word 5.5b Download

From: [e-mail]

[e-mail]  (R.W. Hutchinson) said:

>I still think that Word 5.0 was the best Word Processor I ever used, but I

I missed the beginning of this thread.  Where is this Word download?

Jim L
Remove XX from address to Email
More gun laws will cure the nations ills - just like drug laws do.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                07-Sep-99 12:09:14
  To: All                                               07-Sep-99 20:34:10
Subj: EMX 09d madness...

From: [e-mail] (Jerry McBride)

I just wanted to post my experiences with the latest version of the emx
runtime
modules, 0.9d.

First off, things were running beautifully with the 09c version of runtime,
but
I found I HAD to upgrade when I found the desire to run MSQL 2.0. Plopping in
the new runtime, rebooting and then running mSQL resulted in PURE pleasure...

However, funny things began to happen else where. Namely, Vsoup 1.28 and 1.29
no longer were able to trasnfer newsgroup messages. However, oddly, email
xfers
remaind intact. Also, after a bit of heavy use, my old and trusty Yarn 0.90
begain to corrupt it's database.

I fixed it however... :') I went back to the 09c runtimes and browsed the
Internet for a 2.0 version of mSQL compiled with the "old" libraries and...
I found one at http://www.geocities.com/SiliconValley/Hills/8057/. The
gentleman that did the port is Dirk Ohme. Thanks Dirk!

If you're running Vsoup/Yarn, watch out, you may be in for a surprise...

--

*******************************************************************************

*            Sometimes, the BEST things in life really ARE free...
*
*       Get a FREE copy of NetRexx 1.150 for your next java project at:
*
*                     http://www2.hursley.ibm.com/netrexx
*
*******************************************************************************


/----------------------------------------\
| From the desktop of: Jerome D. McBride |
|         [e-mail]             |
\----------------------------------------/

--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TEAM-NETREXX (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                         07-Sep-99 17:14:11
  To: All                                               07-Sep-99 20:34:10
Subj: Re: How to ...

From: [e-mail] (Martin Racette)

On Tue, 7 Sep 1999 00:14:07, "J. R. Fox"
<[e-mail]> wrote:

> Martin Racette wrote:
> >
> > On Thu, 2 Sep 1999 17:52:09,
> > [e-mail] (John
> > Hong) wrote:
> >
> > > Martin Racette ([e-mail]) wrote:
> > >
> > > : I would like to know How to copy the
> > > : content of an Audio cassette (music), to
> > > : a CD-R while using RSJ
> > >
> I don't really know what I'm talking about here, but you may
> want to check out a shareware OS/2 program called TWAVE.  There
> are a couple users on Compuserve who I think are using this to
> put tracks from LPs and reel-to-reel tapes into digital form --
> probably .WAV files on the h/d, which could then be converted
> into MP3 format, or whatever.  I suspect that TWAVE works with
> CDs too.  Of course, you'd then have to go from your h/d to a
> new cd using RSJ.  I doubt you'll find a one-step solution.
>
> <jf>
>

Thanks for the infornation, I'll check
that later on and let you now :-)

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 13:33:14
  To: All                                               07-Sep-99 20:34:11
Subj: Re: XGA w/ OS/2 and Linux on laptop

From: [e-mail]

In <7r3ds1$ron$[e-mail]>, on 09/07/99
   at 04:18 PM, [e-mail] (Peter Stein) said:

>>
>>Working my way backwards in this thread - I saw a site (Lindsay Computer
>>Systems) which preloads Linux. They use the ATI Rage so that's
>>encouraging.

>I'm familiar with LCS (have ordered product from Rick) as they tend to
>carry high quality components and are very OS2 and Linux aware, but I
>cannot find any references to preloading Linux and/or use of the ATI
>Rage. They do list sample configurations from time to time so perhaps
>they listed an Asus laptop with Linux, but I can't find any such
>configuration on their web site right now.

Sorry, it was J.P. & Associates at
<http://www.jpassociates.com/toshwlin.html>.

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             07-Sep-99 17:24:25
  To: All                                               07-Sep-99 20:34:11
Subj: Re: Check Out  DCITU

From: [e-mail] (Dominique Pivard)

On Tue, 7 Sep 1999 13:51:00, "Esko Kauppinen" <[e-mail]>
wrote:
>
> No problems here between my Olympus C-900 and my Compaq.
> What I noticed was that when using the 115200 transfer speed
> I easily get transfer errors if I use the computer at the same time.
> Attempt to use speeds above that doesn't work at all.

Well, I'd be most happy if you could share your COM and DCITU settings
with me! The versions I have are 1.4i and 1.8beta, if that makes any
difference.

Thanks,

Dominique

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: None!! (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      07-Sep-99 14:13:11
  To: All                                               07-Sep-99 20:34:11
Subj: Re: IBM Anti Virus

From: [e-mail]      (John Thompson)

In <[e-mail]>, George Penzenik
<[e-mail]> writes:

>Does anyone know WHEN Symantec is going to release an OS/2 version of
>thier product?  This was promised when IBM 'sold' INBAV to Symantec.
>
>I written and emailed but all I get is a run around.

Norton Antivirus for OS/2 has been out since about Feb. 1999.  It
took a little effort, but I was able to upgrade my IBMAV to NAV/2
by June 1999.  Go to the Customer Service section of their web
site and leave a message stating that you're a registered user of
IBMAV (asuming you are, of course) and you'd like to get NAV/2.
I had to fax images of my IBMAV diskettes to Norton but
eventually received NAV/2 in the mail on CD.

-John ([e-mail])

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      07-Sep-99 14:21:16
  To: All                                               07-Sep-99 20:34:11
Subj: Re: Shutting WARP 3 VIO-Windows without interaction?

From: [e-mail]      (John Thompson)

In <c1.2b5.2S40Nt$[e-mail]>, [e-mail]
(Chris H Lindley) writes:

>>> I thought that setboot /b would perform a correct shutdown
>>> and then reboot the machine!
>>
>>> Could be wrong!!

>>Hi Chris,
>>nope! It only flushes the cache but doesn't perform a proper shutdown.
>>That's the problem!
>>BTW: I don't want the system to reboot, only going down!

>OK I stand corrected!!!!  Thanks.
>
>In that case I don;t know! Perhaps some kind soul has written
>a utility for this??

On my Warp v3 system there is a /os2/install/shutdown.exe program
that seems to do what you ask.  If you run "sendyes.exe" (I seem
to recall getting it from hobbes, but don't see it there now) it
will close your VIO windows without prompting.

-John ([e-mail])

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   07-Sep-99 13:42:13
  To: All                                               07-Sep-99 20:34:11
Subj: Help - Coping web site using NS of HPP?

From: Dave Critelli <[e-mail]>

Sorry every for posting here but I couldn't find anywhere to post this
question.  Hence I thought, "Maybe one of my Warp brethren might know
this question".

So here goes;

I need to make a copy of an entire web-site (out in WWW land) with all
it's directory structure and put the copy on my hard drive.  Is there a
simple way to do it using ether NS Composer of HomePage Publisher?
Anyone have any experience with this?

Thanks a bunch.
Dave

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Insulated Wire Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  07-Sep-99 17:54:03
  To: All                                               07-Sep-99 20:34:11
Subj: Re: How to ...

From: [e-mail] (Jerry Prather)

In message <[e-mail]> - "J. R. Fox"
<[e-mail]> writes:
:>I don't really know what I'm talking about here, but you may
:>want to check out a shareware OS/2 program called TWAVE.  There
:>are a couple users on Compuserve who I think are using this to
:>put tracks from LPs and reel-to-reel tapes into digital form --
:>probably .WAV files on the h/d, which could then be converted
:>into MP3 format, or whatever.  I suspect that TWAVE works with
:>CDs too.  Of course, you'd then have to go from your h/d to a
:>new cd using RSJ.  I doubt you'll find a one-step solution.

PMFJI but this looked interesting to me as well.  I grabbed it
from the net and read the documentation.  A quick try-out later
and I registered it.  This is going to permit me to do some neat
things!

Thanks for the pointer.


Jerry Prather                    [e-mail]

"Many religions are worth dying for; no religion is worth killing
for."
                    - Me (circa 1998)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: infi.net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    07-Sep-99 18:00:29
  To: All                                               07-Sep-99 20:34:11
Subj: Re: Imation IDE Super Disks and OS/2

From: [e-mail] (John Hong)

Jeff Malka ([e-mail]) wrote:
: Where does one get the latest IBM1s506.ADD for Warp 3?

    IDEDASD.EXE, ftp://ftp.software.ibm.com/ps/products/os2/os2ddpak/



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   07-Sep-99 14:32:27
  To: All                                               07-Sep-99 20:34:11
Subj: Re: NS/2 4.04 is driving me crazy!

From: Norton Boothe <[e-mail]>

I have seen the same thing but not that frequently. I think it might be
related
to cache cleanup (removing xxx files) but not sure.

A worse problem with 4.04 is the long time (over 5 minutes) it takes to exit
it.
I can't even shut down until this program puts itself to bed. I have truncated
the history list, cache, etc but nothing speeds it up. Any ideas, anyone?


Thomas Nagy wrote:

> This problem with NS/2 is getting worse and although I am a long time
> OS/2 user, I cannot figure out what's wrong. It could be an OS/2 problem
> but since it happens to NS/2 ONLY, I have my doubts. Here is the problem:
>
> While using NS/2, every 1-2 minutes, the whole system stops for 10-15
> seconds: the clock does not progress, the mouse shows 'busy' and I cannot
> do anything. If I happen to click the mouse twice during this time, after
the
> 10-15 seconds the window list comes up to make things more frustrating.
> There is a heavy disk activity during this time.
>
> I know that others have experienced the other problem I have with NS/2,
> namely, the system is basically 'hung' for several seconds (or a few
> minutes, if you use NS/2 for a longer period of time) after you close NS/2.
> I bet that this is related to the problem above.
>
> None of this happens with NS/2 2.02. I thought that it could be some java
> problem and tried to play with the parameters -noasyncgc -noclassgc
> and -nojit but this has no effect. Also tried various disk and memory cache
> settings with no positive effects at all.
>
> I am at the limit of my patience. WTF is wrong?
> Please reply if you have a clue. Thank you.
>
> Thomas Nagy
> -----------------------------------------------------------------
> Check out my cats! (http://members.home.net/2832779232/index.htm)
> Free Office Suite: http://www.stardivision.com/so40/index.html



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               07-Sep-99 12:06:11
  To: All                                               07-Sep-99 20:34:11
Subj: Re: NS/2 4.04 is driving me crazy!

From: Frank <[e-mail]>

I have my memory cache at 1000K and Disk at 5000K, and the cleanups only
take a second or two. No delay seen in closing netscape.

Frank.

Norton Boothe wrote:
>
> I have seen the same thing but not that frequently. I think it might be
related
> to cache cleanup (removing xxx files) but not sure.
>
> A worse problem with 4.04 is the long time (over 5 minutes) it takes to exit
it.
> I can't even shut down until this program puts itself to bed. I have
truncated
> the history list, cache, etc but nothing speeds it up. Any ideas, anyone?
>
> Thomas Nagy wrote:
>
> > This problem with NS/2 is getting worse and although I am a long time
> > OS/2 user, I cannot figure out what's wrong. It could be an OS/2 problem
> > but since it happens to NS/2 ONLY, I have my doubts. Here is the problem:
> >
> > While using NS/2, every 1-2 minutes, the whole system stops for 10-15
> > seconds: the clock does not progress, the mouse shows 'busy' and I cannot
> > do anything. If I happen to click the mouse twice during this time, after
the
> > 10-15 seconds the window list comes up to make things more frustrating.
> > There is a heavy disk activity during this time.
> >
> > I know that others have experienced the other problem I have with NS/2,
> > namely, the system is basically 'hung' for several seconds (or a few
> > minutes, if you use NS/2 for a longer period of time) after you close
NS/2.
> > I bet that this is related to the problem above.
> >
> > None of this happens with NS/2 2.02. I thought that it could be some java
> > problem and tried to play with the parameters -noasyncgc -noclassgc
> > and -nojit but this has no effect. Also tried various disk and memory
cache
> > settings with no positive effects at all.
> >
> > I am at the limit of my patience. WTF is wrong?
> > Please reply if you have a clue. Thank you.
> >
> > Thomas Nagy
> > -----------------------------------------------------------------
> > Check out my cats! (http://members.home.net/2832779232/index.htm)
> > Free Office Suite: http://www.stardivision.com/so40/index.html

--
*        Frank Maskus  Portland, Oregon           *
*   Homepage: http://www.pacifier.com/~fmaskus/   *
*                                                 *
*        An oxymoron: Knowledgeable AOLers        *

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Web Page: http://www.pacifier.com/~fmaskus/ (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                 07-Sep-99 15:22:21
  To: All                                               07-Sep-99 20:34:11
Subj: Re: NS/2 4.04 is driving me crazy!

From: [e-mail] (Raphael Tennenbaum)

Norton Boothe <[e-mail]> wrote:

>I have seen the same thing but not that frequently. I think it might be
related
>to cache cleanup (removing xxx files) but not sure.
>
>A worse problem with 4.04 is the long time (over 5 minutes) it takes to exit
it.
>I can't even shut down until this program puts itself to bed. I have
truncated
>the history list, cache, etc but nothing speeds it up. Any ideas, anyone?
>

The update helps with this problem -- a lot -- still the
occasional hang after exiting, but much much better than
before, and it fixes other problems as well (here, anyway).

ftp.software.ibm.com in the

/ps/products/netscape/fixes/a_universal

directory.


--
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                07-Sep-99 19:15:04
  To: All                                               08-Sep-99 05:26:21
Subj: Re: Microsoft Word 5.5b Download

From: [e-mail]

>I still think that Word 5.0 was the best Word Processor I ever used, but
>I hear rumours that there HAVE been pretty decent versions of Excel too,
>some time in the past perhaps. Never used it myself.

Word was more logical then Word Inperfect, but it was flop compaired to
the elegant layout of Lotus Manuscript.  -- Only trouble was that Lotus
marketed it, like IBM has marketed OS2.


_____________
Ed Letourneau <[e-mail]>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      08-Sep-99 11:27:18
  To: All                                               08-Sep-99 05:26:21
Subj: Re: Check Out  DCITU

From: [e-mail] (Khairil Yusof)

On Tue, 7 Sep 1999 17:24:51, [e-mail] (Dominique Pivard) wrote:

>
> > No problems here between my Olympus C-900 and my Compaq.
> > What I noticed was that when using the 115200 transfer speed
> > I easily get transfer errors if I use the computer at the same time.
> > Attempt to use speeds above that doesn't work at all.
>
> Well, I'd be most happy if you could share your COM and DCITU settings
> with me! The versions I have are 1.4i and 1.8beta, if that makes any
> difference.

Is it possible to increase the priority of this program? Is it command line?
You
might want to try out SP (free) at hobbes.nmsu.edu for settting priorities or
Priority Master (commercial - demo version available) and try running this
program at time critical priority and see if the connection drops.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Australian National University (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  07-Sep-99 19:53:23
  To: All                                               08-Sep-99 05:26:21
Subj: Re: Help - Coping web site using NS of HPP?

From: Chuck McKinnis <[e-mail]>

I have HPP installed and use it to mirror my web site.  Works well.
There is also a utility (I think it is out on Hobbes) called Slurp.  It
works, but be careful what you tell it to do or you might find yourself
trying load the world wide web to your hard drive.

Dave Critelli wrote:
>
> Sorry every for posting here but I couldn't find anywhere to post this
> question.  Hence I thought, "Maybe one of my Warp brethren might know
> this question".
>
> So here goes;
>
> I need to make a copy of an entire web-site (out in WWW land) with all
> it's directory structure and put the copy on my hard drive.  Is there a
> simple way to do it using ether NS Composer of HomePage Publisher?
> Anyone have any experience with this?
>
> Thanks a bunch.
> Dave

--
Chuck McKinnis
Senior Systems Engineer
Denver Solutions Group, Inc.
IBM Business Partner
IBM Senior Systems Engineer (retired)

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Denver Solutions Group (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@null                                       08-Sep-99 02:32:04
  To: All                                               08-Sep-99 05:26:21
Subj: Fastback Plus for os/2 and CDRW's Long story

From: nospam@null (Richard Crane)

I have a P75 Mhz Award Bios computer with WARP 4 (at FP 9 I think- 10 does not

seem to have installed successfully) installed and currently running on it as
follows:
Hard Disc1Quantum 1 Gb IDE- master
Primary Part     1 Mb     Boot Manager with DOSos(C Drive), Win95(CDrive) and OS/2
(F
Drive)options
Primary Part     350Mb    For DOS and OS/2 (FAT)
Primary Part    685Mb    For Win95 (FAT)

Hard Disc 2 Maxtor 1Gb IDE- slave

Primary Part    505    D Drive FAT DATA
Logical Part        527             E Drive FAT DATA

CD ROM Matshita CR 585 on IDE Master

Hard Disc 3 SCSI Quantum 3.2 GB SCSI ID 0

Primary Part?    7Mb    Free Space- never created I just end up with this if I only
logically partion this drive
Logical Partition    400Mb    F Drive HPFS OS2 system bootable
Logical Partition    760Mb    G Drive HPFS programs
Logical Partition    1898Mb    H Drive HPFS data and programs

TAPE UNIT Seagate TapeStor 4/8Gb SCSI ID 4

Remainder of System

PCI Flashpoint LW SCSI card (ID's at 7)
PCI S3 864 2Mb video
ISA Soundblaster Vibra16 soundcard
ISA Modem can't remember brand 28K
ISA SCSI card (or pseudo SCSI?) came with  ARTEC AT3 scanner

Part 1 The Problem with Floppies
======================
Currently the heat wet and dirt of Darwin has me go through 1 or 2 floppy
drives
per year also it is not unusual to find that 8 or 9 out a box of10 floppies
you
have stored generate CRC errors with fatal results for getting what was on
them
back off.
Eg in the last month both my original and backup disc's for FASTBACK PLUS for
OS/2 (stored in slightly different locations) showed they were now only
usefull
as drink coasters, I'd pulled them and the Version 1.0 update disc out after
reading about Brad Barclay still using Fastback successfully now (I don't
think
I'd ever had it on Warp 4 and maybe not even Warp 3 Connect - memory goes as
to
exactly when I used it either the days of 2.11 or non Connect 3).
That dreadful squeal that tells you your next thing to do is buy a new floppy
drive greeted me on inserting my last floppy copy of BackAgain ver
2.01(despite
what Roland says for me it has successfully restored my system from major
operator errors made when installing  Linux ) ironically enough I had put it
in
to do a disc copy.

So now I have no floppy based way to reinstall my back up software.

Part 2 The part 1 Problem work around
===========================

Simple I thought, as seen from the above drive table install OS/2 to another
drive copy over the BA/2 drivers and files, manually add the entries to
config.sys that you need. Check it works? Yep, pat self on back.
Getting even smarter putting it on a fat drive means that DOS can see it so if

something happens that takes out my os/2 on both drives (like my stupid error)
I
can restore my restoration software from my DOS eg I have one tape for using
seagates DOS backup software and many floppies with enough to get dos and the
seagate software running again. Further if any thing takes out the DOS it
probably wont touch my main os/2 (f drive) and I can restore the C drive dos
stuff from my os/2 back ups.

Part 3 The Second Problem
===================
Stupidity would be the short summary of it. No, not putting in the Win95
install
disc (as many would say)! But forgetting which C was active and which hidden
and
destroying the system files in the root of the DOS/OS2 partition somehow as I
recall, this was just after some Partition Magic sessions to eliminate the
linux
partitions change partition sizes and locations etc etc. All this done so that
I
would be able to "Solve" a  Win95 problem in the time honoured fashion
(reinstall it ) and with an eye to future likely system changes.
Hey thats what backups are for right? Restore drive from backup and off we go.
Wrong!  Vaguely I recalled something about  being able systx for OS/2 on FAT
drives and sys for DOS before they were bootable again so I think that maybe
that's it but without thinking it through properly went to a command line and
issued C:\os2\boot /dos. thinking I'll just check Dos Works while I'm here -
wrong somehow about now I manged to get my config and autoexec's swapped eg
Dos
tried to boot using OS/2's config.sys file. In short stuffed up the dual boot.
Ok this is no major crisis I can just format the disc and restore either from
DOS or OS/2, a little nervous though as some of you will have noticed a level
of
redundancy is now missing in all this.

Part 4 The Next "Great" Idea
 ===================
Instead of just doing that I now say to myself "Well I've had a problem with
applying the last fixpack, the motherboard isn't 2K compliant so I'll be
changing it soon, I'll upgrade the video to AGP then and (finances depending)
maybe a new "big" drive or two. So maybe I should do a clean Warp 4 install
now
and check that I'll have the appropriately updated drivers available and
working
on floppies for then and I know I've just replaced the floppy drive so it
should
be up to making a number of copies without s----ing itself." Usuall problems
with floppies - throw away about 8 floppies before finally getting 3 good ones

ready to go.

Part 6 How ?
=========
Inital plan: shutdown, insert CD reboot from floppies install small system in
FAt with dual boot (memory check of what to select: TCPIP yes, VGA only
Desktop,
Faxworks, IBM's DOIP and IC should do from the CD - idea is that when I stuff
something up it puts me in a position to email someone or fax them for help if
I
need to - nothing more frustrating than remembering the solution to the
problem
was in an newsgroup last week if you can't access the net).
Shutdown, reboot disc 2 no good. OK boot to main partition and make some new
install discs by running cdinst.cmd off the CD.
Done, Shutdown, reboot, feed discs - install disc two eg the third in the
process trundles away for a while then returns an error That the sytem can't
operate the floppy or the hard drive and is stopped in that usual IBM speak
that
means that you don't know anything eg is it both the floppy and the HD it
can't
run?
Reboot to main system recreate a new disc 2 shutdown reboot with discs feeding

as necessary install starts OK chose Advanced selected the partition I wanted
get reminded that although DOS isn't necessary for installing dual boot its
easier that way- interupt install to put DOS on.

Part 7
OK I'll restore from tape
=================
Lastest backup in and away we go - noises of "shoeshining" from tape unit -
how
long do I let it go? Dilemma solved in 35 minutes or there abouts Backagain
returns an error about tape device.
Second try. Reboot from floppy to minimal  based DOS system and run Seagates
DOS
backup I'll restore from there. Whoops! The program isn't there any more. More

DOS fooling around to get CD working so I can reinstall it. Then "Not enough
memory to run program" - I'd forgotten those EMS/HIMEM games we used to all
play
with DOS. Spend time fiddling DOS drivers. Then have Seagates Backup tell me
that there is a problem with the drive!
Bugger!
Search office for purchase record - experience delight of finding it and
finding
that the unit is still under warranty. Contact retailer "flicked" to importer
(ACA Pacific - I'll mention them by name as they were helpful). Shipped unit
back received new replacement. In the meantime look very closely at adds for
CDRW's - for the general compatability issue it seems that the Yamaha 1644S is

the go.

Part 8
Conclusion
========
At last you say. So why am I boring this group with all this? Well apart from
the cartharsis that writing it has given me, I'd like to know is anyone using
Fastback Plus with the Yamaha 1644S? Any setting up traps/tricks? Can anyone
email me the Fastback Plus install disk files and the 1.0 update - Symantec in

Australia doesn't want to help, seems rough when you've bought the license to
use it ?
If i can't get that going what files do I need to have (and where) for
Cdrecord
for OS/2 to work - can it be setup for "stand alone" (booting from floppy)
restores (given the record I have with tapes, tape units and floppies and
floppy
drives I am expecting a hard drive will fail :(  sometime)?


Richard A Crane    cc emailed replies to rcraneAT ibmDOT net

Foolproof is not good enough ..... we're not dealing with fools

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 20:42:10
  To: All                                               08-Sep-99 05:26:21
Subj: HomePage Publisher Training?

From: [e-mail] (Ray Appleby)

Is there a manual or tutorial for HomePage Publisher?

Best Regards,
Ray Appleby                     [e-mail]
[Team OS/2]                 Multitasking at OS/2 Warp4 Speed.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CADVision Development Corporation (http://www.cad
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              07-Sep-99 22:53:03
  To: All                                               08-Sep-99 05:26:21
Subj: Re: HomePage Publisher Training?

From: "Chris Stumpf" <[e-mail]>

The only docs, I know of are the help files that come with it and the faq on
the developer's website.


On 7 Sep 1999 20:42:20 -0700, Ray Appleby wrote:

:>Is there a manual or tutorial for HomePage Publisher?
:>
:>Best Regards,
:>Ray Appleby                     [e-mail]
:>[Team OS/2]                 Multitasking at OS/2 Warp4 Speed.


        Chris Stumpf
        C.S.E. Computer Services
        Computer Consultant (OS/2, Lan, Wan, CTI)
        Serenity Systems Channel Partner
        IBM Certified Systems Expert - OS/2 Warp 4


web:    http://cse.anterras.net
email:    [e-mail]
phone: [phone]



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Monmouth Internet (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          08-Sep-99 03:05:21
  To: All                                               08-Sep-99 10:38:27
Subj: Re: toshiba vs. thinkpad

From: [e-mail] (e-frog)

[e-mail] wrote:
: Greetings!

: My trusty Sager has crashed - probably my fault, don't know, feel bad,
: gotta move on....

: Anyway, I was with the pre-Labor Day crowd down at CompUSA looking at some
: lappers, and felt drawn to: [A] Toshiba Celeron 400mhz: 64 DRAM, 6.4G HD,
: 24X CDROM, 12.1" TFT screen vs. [B] IBM Thinkpad - by memory and notes:
: 366mhz, 32MB, 4.8G, 12.1" TFT.

: The systems are roughly comparable with the Thinkpad costing a bit less
: ($100).

Only the Thinkpad i-17xx are OS/2 compatible. Forget about the other
i-series ones. You'll be damn lucky if you get it working with OS/2 in any
kind of decent running order.

I don't know which TOshiba model you are referring to, but I have a
Toshiba laptop from work and it works fairly well with OS/2. I think that
Toshiba doesn't quite have the consumer-oriented i-Series like IBM. They
have the issue of supporting their business customers which do not like
big changes in hardware. The older Toshiba's used to support OS/2 and
though official support is dropped, I think much of the hardware remains
the same. (It pretty much has to. Our company has gone through several
years of Toshiba laptops and the IT guys are NOT happy at all if they need
to maintain different images every few months!)

Do NOT go with the screen warranty. It's a scam. If you read the fine
print, I think you'll find that damage is not covered. I've yet to see any
LCD screen that failed due to normal use with time. It's either coming
working to start with or not.


Isaac

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ITServices, University of British Columbia (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          08-Sep-99 03:04:15
  To: All                                               08-Sep-99 10:38:27
Subj: Re: Help - Coping web site using NS of HPP?

From: [e-mail] (Annie K.)

On Tue, 7 Sep 1999 17:42:27, Dave Critelli <[e-mail]> wrote:

:I need to make a copy of an entire web-site (out in WWW land) with all
:it's directory structure and put the copy on my hard drive.  Is there a
:simple way to do it using ether NS Composer of HomePage Publisher?

 Use Sslurp! sslurp20.zip should be at Hobbes.

--
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          08-Sep-99 00:27:08
  To: All                                               08-Sep-99 10:38:27
Subj: Great Color Printer for OS/2 Warp

From: Timothy Sipples <[e-mail]>

[Note that I have no affiliation with Lexmark or BUY.COM.]

Now's a great time to take advantage of some widely available discounts on a
special Lexmark color ink jet printer, the Lexmark Optra 40 Color printer.

What's so special about this ink jet printer?  It has built-in Postscript
Level 2 capability (along with PCL 5c).  Postscript is generally regarded as
the best color print technology for OS/2 Warp (and, for that matter, other
operating systems).

Networking options are available for this printer as well, making it an
excellent choice for a growing home or office LAN.

Many vendors have this printer available at deep discount right now,
including BUY.COM (see
http://www.buy.com/surplus/product.asp?sku=70000013).  Pricing is under 220
USD.

For more information on the Optra 40, including an official statement of
vendor support for OS/2 Warp, please visit Lexmark's web site at:

   http://www.lexmark.com/printers/inkjet/OptraColor/40.html

--
Timothy Sipples
IBM Network Computing Software
Chicago, Illinois
Web: http://www.satdirect.com/aviation

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Network Computing Software (Chicago) (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            08-Sep-99 01:55:17
  To: All                                               08-Sep-99 10:38:27
Subj: Re: toshiba vs. thinkpad

From: [e-mail]

In <7r4jq6$chd$[e-mail]>, on 09/08/99
   at 03:05 AM, [e-mail] (e-frog) said:

>Only the Thinkpad i-17xx are OS/2 compatible. Forget about the other
>i-series ones. You'll be damn lucky if you get it working with OS/2 in
>any kind of decent running order.

>I don't know which TOshiba model you are referring to, but I have a
>Toshiba laptop from work and it works fairly well with OS/2. I think that
>Toshiba doesn't quite have the consumer-oriented i-Series like IBM. They
>have the issue of supporting their business customers which do not like
>big changes in hardware. The older Toshiba's used to support OS/2 and
>though official support is dropped, I think much of the hardware remains
>the same. (It pretty much has to. Our company has gone through several
>years of Toshiba laptops and the IT guys are NOT happy at all if they
>need to maintain different images every few months!)

>Do NOT go with the screen warranty. It's a scam. If you read the fine
>print, I think you'll find that damage is not covered. I've yet to see
>any LCD screen that failed due to normal use with time. It's either
>coming working to start with or not.

Wow! The point about the warranty is a real heads-up. For giggles, I think
I'll ask to see if the next time I'm in the store. The store guy wanted to
me to worry about things like inadvertently leaving a pencil on the
keyboard and slapping down the cover. I saw the problem, of course, but
nothing like that has ever happened to me: I don't tend to put utensils on
the keyboard.

I've in the meantime learned about the iSeries, in line with what you say
here. I've shied away from Toshibas now because of some complaints about
their durability but you seem to have had a good experience. I'll keep
that in mind.

I'm probably going to go back to Sager. They show awareness of OS/2 and
Linux and though it's a hassle, they'll let me return the computer if I
don't like it. Sagers are a bit heavy, like a chunk of iron, but the ones
I've had (two) were good performers.

Thanks!

F.

-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            07-Sep-99 22:59:04
  To: All                                               08-Sep-99 10:38:27
Subj: Re: Great Color Printer for OS/2 Warp

From: Randy Petersen <[e-mail]>

Great news since I'm in the market for an OS/2 compatible color printer!

My only question is "Where are the OS/2 drivers" ?
They are not on this webpage.

>   http://www.lexmark.com/printers/inkjet/OptraColor/40.html


/*----------------------------------------------------------------------*
  Posted with MR/2 ICE v1.51 (#10203) courtesy of In-Joy Pro on OS/2
  Please also email replies to: Randy Petersen <[e-mail]>
  Now Very Happily Warping along with Warp 3.0 Connect at fixpack #40.
  SPAMMERS don't bother me, I direct them to the void at /dev/nul.
*----------------------------------------------------------------------*/

In <[e-mail]>, on 09/08/99
   at 12:27 AM, Timothy Sipples <[e-mail]> said:

>[Note that I have no affiliation with Lexmark or BUY.COM.]

>Now's a great time to take advantage of some widely available discounts on a
>special Lexmark color ink jet printer, the Lexmark Optra 40 Color printer.

>What's so special about this ink jet printer?  It has built-in Postscript
>Level 2 capability (along with PCL 5c).  Postscript is generally regarded as
>the best color print technology for OS/2 Warp (and, for that matter, other
>operating systems).

>Networking options are available for this printer as well, making it an
>excellent choice for a growing home or office LAN.

>Many vendors have this printer available at deep discount right now,
>including BUY.COM (see
>http://www.buy.com/surplus/product.asp?sku=70000013).  Pricing is under 220
>USD.

>For more information on the Optra 40, including an official statement of
>vendor support for OS/2 Warp, please visit Lexmark's web site at:

>   http://www.lexmark.com/printers/inkjet/OptraColor/40.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Netcom (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               07-Sep-99 23:05:16
  To: All                                               08-Sep-99 10:38:27
Subj: JStreet Mailer: Who, What, Where & How

From: Tim Martin <[e-mail]>

Rhys Dow wrote:

> Bill Wild Willy Kredentser wrote:

> > This is good to hear.  I think the method for joining
> > this list is of sufficient general interest that a
> > public request rather than a private E-mail is more
> > appropriate.  This is a public request.
> >
> I'm afraid I can't help you there, I signed off quite a while ago, and
> don't have any old addresses.  Hopefully someone on the list will
> reply.  I imagine Tim Martin knows!  :o

Yes, of course.  J Street Mailer is now under new development by
the J Street Band (of programmers) headed by Paul vanKeep of
Sumatra Software and Mike Bowler.  You would be amazed at what
these two extremely competent Java programmers have accomplished
in just a very short period of time.  To join the current mailing list
simply visit here, select the JStreet Users list and sign up:

http://www.sumatra.nl:81/guest/RemoteAvailableLists

If you have a copy of JSM on your system today you can
click the icon to download version pvk.7 dated august 31.
The file name is inno7.zip.  Download this file directly
into your JSM directory then rename your current innoval.jar
file innoval-old.jar and rename the inno7.zip to innoval.jar.
When you start JSM this new innoval.jar will unzip itself and
update all the necessary files.  Very ingenious.  You'll find
JSM really fast now with some new features and graphics
and much more to come.

The JSM community owes many kudos and special thanks
primarily to Paul vanKeep as well as to his newest team
member, Mike Bowler, for their fine work.  JSM continues
to be the leader in Java emailers.

Tim Martin
The OS/2 Guy
Warp City
http://warpcity.com
"E-ride the wild surf to Warp City!"

P.S.  If you're not a registered owner of J Street Mailer you can
become one very easily.  Dan Porter of InnoVal Systems has
released JSM for free.  Download your copy from here:
http://st6.yahoo.com/lib/innoval.jstreet.zip

and use the free registration code of:  38604851 to activate
your own copy of JSM.  Download the upgrade above to
upgrade it to the most current release.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warp City (http://warpcity.com) (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            08-Sep-99 02:10:20
  To: All                                               08-Sep-99 10:38:27
Subj: Re: Was: toshiba vs. thinkpad, Now: Laptops for Linux & OS/2?

From: [e-mail]

Thanks for the references. I'm browsing around now.

F.

In <[e-mail]>, on 09/07/99
   at 05:52 PM, [e-mail] (Dan Casey) said:


>When I was shopping for a Laptop (I had already decided on a Thinkpad
>.... just needed to figure out which one I wanted), I found the best
>pricing and availability at Microwarehouse
>(http://www.warehouse.com/). If you order it before 10:00PM Eastern Time,
>you'll have it the next day (assuming it's in stock).

>For Refurbished models, I like Egghead's Surplus Direct
>(http://www.egghead.com/store/ent/eggs_portal.browse). Click on the
>Notebooks under Liquidations in the left hand column.  I bought a
>Thinkpad 365D for around $500.00 there, last year (a gift for a friend).
>I bought a Thinkpad 390 for myself, from Microwarehouse for less than
>$1700.00 (+ the RAM upgrade to take it to 96Mb). Other than the lack of
>sound in a WinOS2 session (which I don't need) and the so far lack of
>V.90 drivers for the built in Winmodem (works at  V.34 jsut fine), I'm
>VERY pleased with this laptop.


-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  08-Sep-99 06:44:21
  To: All                                               08-Sep-99 10:38:27
Subj: Re: UMAX + Win-OS/2

From: [e-mail] (Yuri Dario)

On Sun, 5 Sep 1999 02:57:45, [e-mail] (John
Hong) wrote:

>
>         I remember some people reporting here a while back that they had
> their UMAX scsi scanners running under Win-OS/2 like this.  Any tips?

you can use the 610s with SANE 1.0.1 and PMSANE: they are both free.

Bye,

    Yuri Dario

/*
 * member of TeamOS/2 - Italy
 * http://www.quasarbbs.com/yuri
 */

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: MC-link The World On Line (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          08-Sep-99 16:46:09
  To: All                                               08-Sep-99 14:43:00
Subj: Re: Imation IDE Super Disks and OS/2

From: "Wayne Bickell" <[e-mail]>

I just want to know if any ATAPI LS-120 drive will work apart
from the Imation. I'm particularly interested in the Panasonic
SD120S. Any comment?

Cheers

Wayne


On 7 Sep 1999 18:00:58 GMT, John Hong wrote:

:>Jeff Malka ([e-mail]) wrote:
:>: Where does one get the latest IBM1s506.ADD for Warp 3?
:>
:>    IDEDASD.EXE, ftp://ftp.software.ibm.com/ps/products/os2/os2ddpak/
:>
:>
:>

******************************************************
Wayne Bickell
Tokyo, Japan
[e-mail]
******************************************************
           Posted with PMINews 2 for OS/2
******************************************************



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T Internet Service (1:109/42)

+----------------------------------------------------------------------------+

From: nospam                                            08-Sep-99 09:22:20
  To: All                                               08-Sep-99 14:43:00
Subj: Re: NS/2 4.04 is driving me crazy!

From: glennth@<nospam>senet.com.au (Glenn Thompson)

On Sat, 4 Sep 1999 04:10:43, "David D. Huff Jr." <[e-mail]>
wrote:

-> I just found the solution to my problem. The netscape.hst file had grown
over
-> 5 Mb and that was it. I renamed the history file and set the file to 0 in
the
-> preferences
-> and that was all it took. Darn I wasted several evenings trying to find
-> the problem.

Well that's one problem down, does anyone besides me find Netscape
4.04
crashes after initiating a download from a website ?

I find that pressing the shift button  while clicking on a zip file
link improves
things but it willl still crashe after a couple of uses. The error
message is
usually sys3175 - access violation I think.

Glenn.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none here ! (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                     08-Sep-99 10:02:02
  To: All                                               08-Sep-99 14:43:00
Subj: Re: Great Color Printer for OS/2 Warp

From: [e-mail]

In <37d5fb89$3$ecrgrefr$[e-mail]>, Randy Petersen
<[e-mail]> writes:
>Great news since I'm in the market for an OS/2 compatible color printer!
>
>My only question is "Where are the OS/2 drivers" ?
>They are not on this webpage.
>
>>   http://www.lexmark.com/printers/inkjet/OptraColor/40.html
>
>
>/*----------------------------------------------------------------------*
>  Posted with MR/2 ICE v1.51 (#10203) courtesy of In-Joy Pro on OS/2
>  Please also email replies to: Randy Petersen <[e-mail]>
>  Now Very Happily Warping along with Warp 3.0 Connect at fixpack #40.
>  SPAMMERS don't bother me, I direct them to the void at /dev/nul.
>*----------------------------------------------------------------------*/
>
>In <[e-mail]>, on 09/08/99
>   at 12:27 AM, Timothy Sipples <[e-mail]> said:
>
>>[Note that I have no affiliation with Lexmark or BUY.COM.]
>
>>Now's a great time to take advantage of some widely available discounts on a
>>special Lexmark color ink jet printer, the Lexmark Optra 40 Color printer.
>
>>What's so special about this ink jet printer?  It has built-in Postscript
>>Level 2 capability (along with PCL 5c).  Postscript is generally regarded as
>>the best color print technology for OS/2 Warp (and, for that matter, other
>>operating systems).
>
>>Networking options are available for this printer as well, making it an
>>excellent choice for a growing home or office LAN.
>
>>Many vendors have this printer available at deep discount right now,
>>including BUY.COM (see
>>http://www.buy.com/surplus/product.asp?sku=70000013).  Pricing is under 220
>>USD.
>
>>For more information on the Optra 40, including an official statement of
>>vendor support for OS/2 Warp, please visit Lexmark's web site at:
>
>>   http://www.lexmark.com/printers/inkjet/OptraColor/40.html

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           08-Sep-99 06:35:01
  To: All                                               08-Sep-99 14:43:00
Subj: Re: IBM Anti Virus

From: Bob Germer <[e-mail]>

On <c1.2c.2S5sl6$1Ph@rhino_house.ibm.net>, on 09/07/99 at 02:13 PM,
   [e-mail]      (John Thompson) said:

> Norton Antivirus for OS/2 has been out since about Feb. 1999.  It took a
> little effort, but I was able to upgrade my IBMAV to NAV/2 by June 1999.
> Go to the Customer Service section of their web  site and leave a
> message stating that you're a registered user of IBMAV (asuming you are,
> of course) and you'd like to get NAV/2.  I had to fax images of my IBMAV
> diskettes to Norton but
> eventually received NAV/2 in the mail on CD.

> -John ([e-mail])

FYI, I went to their website. I found that one must buy a CD with versions
for other operating systems to get the OS/2 version. Moreover, they don't
sell the CD from the on-line store. Five calls to them yesterday during
business hours on the left coast were not returned. Three vendors in
southern New Jersey and two in Philadelphia couldn't find said CD from any
of their sources.

I am searching old backups for the announcement by IBM and Norton
(Symantec) about continued support for IBM antivirus and OS/2. I hope to
find what I seem to recall,- that there is a contract between the two. If
so, it would appear to me that Norton is in violation of that contract and
legal action can be brought. Perhaps a class action can be filed against
Symantec.

To say that I am angry is like saying that Hitler was a little bit mean.
To quote my S. Carolina born wife, "I'm pissed purple!"

FYI, here is what Symantec's Website says:

__________________Begin paste from Symantec URL_____________________

                     Norton AntiVirus for OS/2
                     Purchase

                     Norton AntiVirus for OS/2 is only available as a
component of the
                     Norton AntiVirus Solution CD. Please:

                          contact your local reseller
                          or
                          contact Symantec at: [phone]

______________End Paste from Symantec________________________________-

As I said, five calls to that number were not returned and no vendor or
wholesaler I tried had any information regarding price/availability of the
product.

Indelible Blue doesn't list it in the OS/2 software category and the CD
they do sell which sells for $207.+ doesn't seem to include the OS/2
version. Moreover, paying $207+ for a product which sells for less than
$30 for Win9x and NT combined is theft as far as I am concerned assuming
that IB is wrong that the CD doesn't have an OS/2 version of the product.

I have long been a vocal opponent of piracy. But if I have to pay $207+
for a CD with a half dozen versions of the program which sells for $27.50
for Windoze, I may well rethink my position.

Frankly, I am beginning to doubt that the product really exists although
you said you finally received it. Unfortunately for me, I cannot locate my
distribution disks for IBM's program which I stopped using after I moved
the office and completely rebuilt my console and installed networking.
That's my stupid fault. I will pay for a new version no matter what the
price. However, if the price is totally unreasonable and I am forced to
pay for products I have no intention of ever using, I will be forced to
rethink my position on piracy.

If I had an email address for the thieves at Symantec, I would forward a
copy of this post to them.

Hmm, I just went to their website. I AM sending a copy of this message to
[e-mail]. I wonder if THIS will garner a response.

--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: [e-mail]
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  08-Sep-99 11:07:29
  To: All                                               08-Sep-99 14:43:00
Subj: Re: JStreet Mailer: Who, What, Where & How

From: [e-mail] (Stan Goodman)

I tried to subscribe to this list as soon as I saw Tim's posting. Two
minutes later, I received a note from the list asking that I confirm the
subscription. Two minutes after that, it turned out that the reason the
list needed this confirmation was so that it could inform me that the list
already had its maximum permissible number of subscribers. Way to go,
fellas.

I can only hope that some of the kind successful subscribers will post here
(and maybe even on comp.os.os2.mail-news) some of the more trenchant
information from the list, so that even those outside the select circle may
profit.

According to Tim's message, I could have downloaded the new version to
replace my registered version by clicking on "the icon". Has anybody
discovered this icon? I saw nothing that looked like a download link or an
icon that might work as advertized.

On Wed, 8 Sep 1999 06:05:33, Tim Martin <[e-mail]> wrote:

> Rhys Dow wrote:
>
> > Bill Wild Willy Kredentser wrote:
>
> > > This is good to hear.  I think the method for joining
> > > this list is of sufficient general interest that a
> > > public request rather than a private E-mail is more
> > > appropriate.  This is a public request.
> > >
> > I'm afraid I can't help you there, I signed off quite a while ago, and
> > don't have any old addresses.  Hopefully someone on the list will
> > reply.  I imagine Tim Martin knows!  :o
>
> Yes, of course.  J Street Mailer is now under new development by
> the J Street Band (of programmers) headed by Paul vanKeep of
> Sumatra Software and Mike Bowler.  You would be amazed at what
> these two extremely competent Java programmers have accomplished
> in just a very short period of time.  To join the current mailing list
> simply visit here, select the JStreet Users list and sign up:
>
> http://www.sumatra.nl:81/guest/RemoteAvailableLists
>
> If you have a copy of JSM on your system today you can
> click the icon to download version pvk.7 dated august 31.
> The file name is inno7.zip.  Download this file directly
> into your JSM directory then rename your current innoval.jar
> file innoval-old.jar and rename the inno7.zip to innoval.jar.
> When you start JSM this new innoval.jar will unzip itself and
> update all the necessary files.  Very ingenious.  You'll find
> JSM really fast now with some new features and graphics
> and much more to come.
>
> The JSM community owes many kudos and special thanks
> primarily to Paul vanKeep as well as to his newest team
> member, Mike Bowler, for their fine work.  JSM continues
> to be the leader in Java emailers.
>
> Tim Martin
> The OS/2 Guy
> Warp City
> http://warpcity.com
> "E-ride the wild surf to Warp City!"
>
> P.S.  If you're not a registered owner of J Street Mailer you can
> become one very easily.  Dan Porter of InnoVal Systems has
> released JSM for free.  Download your copy from here:
> http://st6.yahoo.com/lib/innoval.jstreet.zip
>
> and use the free registration code of:  38604851 to activate
> your own copy of JSM.  Download the upgrade above to
> upgrade it to the most current release.
>

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to [e-mail] will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                08-Sep-99 08:06:14
  To: All                                               08-Sep-99 14:43:00
Subj: Re: UMAX + Win-OS/2

From: fledermaus <[e-mail]>

Ref:     Append at 13:54:09 on 99/09/07 GMT (by [e-mail] (Lorne
Sunley)
I'm using scsi adaptec 2906, a pci, about $50 at compusa.
Software: cfm and pmview, total pkg, $90.

"A leader who is above the law is a tyrant (e.g. Gates, Clinton)"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                08-Sep-99 08:14:09
  To: All                                               08-Sep-99 14:43:00
Subj: Re: XGA w/ OS/2 and Linux on laptop

From: fledermaus <[e-mail]>

Ref:     Append at 15:09:28 on 99/09/07 GMT (by [e-mail] (Peter
Stein)
I had a hell of a time with getting ATI-64 RAGE working under OS/2,
I suspect my fault with part of it - I do not obey instructions exactly.
However, NO problems with LINUX and my APTIVA-C55 for "X".
Don't know about other models - and I know that newer APTIVAs are not
for OS/2.

"A leader who is above the law is a tyrant (e.g. Gates, Clinton)"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             08-Sep-99 06:36:23
  To: All                                               08-Sep-99 14:43:01
Subj: Re: NS/2 4.04 is driving me crazy!

From: [e-mail]

In <L8W8d0hqkiHX-pn2-6cpvPbVJ1r4L@localhost>, on 09/08/99
   at 09:22 AM, glennth@<nospam>senet.com.au (Glenn Thompson) said:

>Well that's one problem down, does anyone besides me find Netscape
>4.04 crashes after initiating a download from a website ?

You're  not alone with problems with 4.04. It crashes for me on many
different web sites and it has problems completing a download, not
necessarily crashing, but just quitting in the middle of a download
and telling me "Document done" when it is only half done. For
reliability I use 2.02 which has never crashed on me or failed to
complete a download, but unfortunately does not support newer
JavaScript versions which many web sites are using. I would love to
see a JavaScript update to 2.02 instead of all the time and effort
that is being expended on 4.61.

The 4.61 betas have been giving me similar problems to the 4.04
version, but I am encouraged that they are paying attention to the
bug reports that I have been submitting. Perhaps they will
eventually get it right. When all a person wants or needs is just a
good, reliable browser, it is a real burden to have to put up with
all the other so-called "goodies" that come bundled with an
overblown product like Communicator. It is way too much of a good
thing for my purposes. I hope that in the final product there will
be a way to simply install the browser portion and ignore the rest
of the bloat.


--
-----------------------------------------------------------
Bob Stephan [e-mail] or [e-mail]
  Happily using OS/2 Warp on the Central California Coast.
   http://www.redshift.com/~bstephan
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 08-Sep-99 10:50:13
  To: All                                               08-Sep-99 16:42:17
Subj: Re: Imation IDE Super Disks and OS/2

From: "John Getsoian" <[e-mail]>

On 5 Sep 1999 13:59:02 GMT, William Sonna wrote:

>For example - have you had any experience/difficulties
>reinstalling/installing OS/2 on one of these devices configured as A:?

There is at least one small issue.

If you still have any installable IBM accessories on XDF floppies, be
aware that the XDFLOPPY.FLT does not attach to ATAPI drives.


regards;
-john getsoian
([e-mail])


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: CompuServe Interactive Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              07-Sep-99 19:35:08
  To: All                                               08-Sep-99 20:57:22
Subj: Re: ORB drive help

From: "Larry Snider" <[e-mail]>

In <zmlz3.49833$[e-mail]>, on 09/02/99
   at 02:34 AM, fmiller1@[e-mail] said:
=>In <[e-mail]>, Dale Winters <[e-mail]>
=>writes: >Anybody know how to get Warp v4 to recognize and run an ORB
=>drive. The >co. puts out win98
=>>drivers but they are still working on Warp drivers. I looked at the IBM
=>>site for new drivers but
=>>couldnt find anything. If somebody got one working under Warp Id sure
=>>appreciate knowing
=>>how !  Thanks,Dale
=>>
=>Which version of the Orb do you have??  The EIDE drive "should" work
=>with the new idedasd.exe package.  The SCSI should also work.  The
=>Parallel Port version will require drivers from Castlewood.

The parallel port model will NOT work with OS/2 (yet).

--
Larry Snider - Portsmouth, RI
Internet: [e-mail]
FidoNet: 1:109/921.52

"That OS/2 Feller"

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               08-Sep-99 08:25:19
  To: All                                               08-Sep-99 20:57:22
Subj: Re: JStreet Mailer: Who, What, Where & How

From: Tim Martin <[e-mail]>

Stan Goodman wrote:

> I tried to subscribe to this list as soon as I saw Tim's posting. Two
> minutes later, I received a note from the list asking that I confirm the
> subscription. Two minutes after that, it turned out that the reason the
> list needed this confirmation was so that it could inform me that the list
> already had its maximum permissible number of subscribers. Way to go,
> fellas.

I know there was some discussion of resticting the mail list
for various reasons.  Do not feel slighted or angry because
you can't get on.  There is a purpose to all the madness.

The developers may want to keep the number of subscribers
on a manageable level.  As a web master who also restricts the
number of members who have access to our services (free
tech support) it is very difficult to make everyone happy or
to meet all the requests for help that come in.  I can sometimes
get so bogged down from 'help me' requests that the Warp City
site suffers, updates cannot be accomplished, other members
requests cannot be fulfilled.  And as with all free things, there are
those who need a lot of step-by-step hand holding or personalized
assistance.  All of that is time consuming and takes focus away
from the JSM updating work.  The JStreet Band developers are releasing
updates that are considered solid Betas.  You know people, the
minute an update causes a problem some folks go completely
berserk and trash the work, flame the developers and end up
generating a bunch of negativity.  Always save your previous
updates and simply backlevel when you find the latest update
causes a problem.

Paul vanKamp released update 8 today adding in a few new 'gizmos'.
The speed of JSM is now superior to anything I've seen.

> I can only hope that some of the kind successful subscribers will post here
> (and maybe even on comp.os.os2.mail-news) some of the more trenchant
> information from the list, so that even those outside the select circle may
> profit.

My focus is Warp City members and I run as much new JSM
information as I can to keep members updated on new releases
and features.  Perhaps a JSM user outside of WC can post
updated information here too.

> According to Tim's message, I could have downloaded the new version to
> replace my registered version by clicking on "the icon". Has anybody
> discovered this icon? I saw nothing that looked like a download link or an
> icon that might work as advertized.

To download the latest update (which I left out of my previous message)
you can do so from: http://paul.vanKeep.com/jstreet/index.html.

>
>
> On Wed, 8 Sep 1999 06:05:33, Tim Martin <[e-mail]> wrote:
>
> > Rhys Dow wrote:
> >
> > > Bill Wild Willy Kredentser wrote:
> >
> > > > This is good to hear.  I think the method for joining
> > > > this list is of sufficient general interest that a
> > > > public request rather than a private E-mail is more
> > > > appropriate.  This is a public request.
> > > >
> > > I'm afraid I can't help you there, I signed off quite a while ago, and
> > > don't have any old addresses.  Hopefully someone on the list will
> > > reply.  I imagine Tim Martin knows!  :o
> >
> > Yes, of course.  J Street Mailer is now under new development by
> > the J Street Band (of programmers) headed by Paul vanKeep of
> > Sumatra Software and Mike Bowler.  You would be amazed at what
> > these two extremely competent Java programmers have accomplished
> > in just a very short period of time.  To join the current mailing list
> > simply visit here, select the JStreet Users list and sign up:
> >
> > http://www.sumatra.nl:81/guest/RemoteAvailableLists
> >
> > If you have a copy of JSM on your system today you can
> > click the icon to download version pvk.7 dated august 31.
> > The file name is inno7.zip.  Download this file directly
> > into your JSM directory then rename your current innoval.jar
> > file innoval-old.jar and rename the inno7.zip to innoval.jar.
> > When you start JSM this new innoval.jar will unzip itself and
> > update all the necessary files.  Very ingenious.  You'll find
> > JSM really fast now with some new features and graphics
> > and much more to come.
> >
> > The JSM community owes many kudos and special thanks
> > primarily to Paul vanKeep as well as to his newest team
> > member, Mike Bowler, for their fine work.  JSM continues
> > to be the leader in Java emailers.
> >
> > Tim Martin
> > The OS/2 Guy
> > Warp City
> > http://warpcity.com
> > "E-ride the wild surf to Warp City!"
> >
> > P.S.  If you're not a registered owner of J Street Mailer you can
> > become one very easily.  Dan Porter of InnoVal Systems has
> > released JSM for free.  Download your copy from here:
> > http://st6.yahoo.com/lib/innoval.jstreet.zip
> >
> > and use the free registration code of:  38604851 to activate
> > your own copy of JSM.  Download the upgrade above to
> > upgrade it to the most current release.
> >
>
> -------------
> Stan Goodman
> Qiryat Tiv'on
> Israel
>
> Spammers are getting smarter; email sent to [e-mail] will not reach
> me. Sorry.
> Send E-mail to: domain: hashkedim dot com, username: stan.
>
> 




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warp City (http://warpcity.com) (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            08-Sep-99 15:28:27
  To: All                                               08-Sep-99 20:57:22
Subj: Re: IBM Anti Virus

From: [e-mail]

In <37d63be9$3$obot$[e-mail]>, Bob Germer
<[e-mail]> writes:
>On <c1.2c.2S5sl6$1Ph@rhino_house.ibm.net>, on 09/07/99 at 02:13 PM,
>   [e-mail]      (John Thompson) said:


>FYI, I went to their website. I found that one must buy a CD with versions
>for other operating systems to get the OS/2 version. Moreover, they don't
>sell the CD from the on-line store. Five calls to them yesterday during
>business hours on the left coast were not returned. Three vendors in
>southern New Jersey and two in Philadelphia couldn't find said CD from any
>of their sources.

Oh it gets worse.  Their web site lists some 30+ vendors whom have
on-line capability.  I checked EACH and EVERY ONE of these URL's yesterday
in view of Tim Sipple's comment.  There is not *ONE* single site that I
could research, nor *ONE* single search engine which can be keyed to
look up "OS/2" which will provide a thread to that CD disk or any other
Aintivirus disk with OS/2 support!

The Symantec spokesperson was *ADAMANT* about saying that it could *NOT*
be bought from the factory and *MUST* be bought from a resale source.  I
was instructed to select from them via the URL link on the frame that
took me to these URL's.

  OK.

    So I looked,

      ZERO ability to find anything.

You apparently know or someone here knows the actual Symantec part number
for the actual CD-ROM which has the OS/2-only version on it.

Maybe if we all know the appropriate part number for the OS/2-only disk
that has the needed product, it would help.

Will someone post the proper *PART NUMBER* here so that all of us can
then go looking for a source that will sell us this disk based upon
knowledge that even Symantec, it seems, will not provide to their
distribs and sales sites?

Maybe that way a distrib or retail site can prompt this bear out of
hibernation with a flashlight.


--> Sleep well; OS2's still awake! ;)

[e-mail]
[e-mail]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    08-Sep-99 15:40:13
  To: All                                               08-Sep-99 20:57:22
Subj: Re: EMX 09d madness...

From: [e-mail]

:>I just wanted to post my experiences with the latest version of the emx
runtime
:>modules, 0.9d.
:>
:>However, funny things began to happen else where. Namely, Vsoup 1.28 and
1.29
:>no longer were able to trasnfer newsgroup messages. However, oddly, email
xfers
:>remaind intact. Also, after a bit of heavy use, my old and trusty Yarn 0.90
:>begain to corrupt it's database.


Yeow! Thought I was going crazy. Had to switch to Emtec (and even
considered slrn) 'cause of this. Maybe, as C. Hennecke suggested, I'll
try the latest fix.
Hope it works; Yarn is still my fave.



thanx
jehnk


>



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            08-Sep-99 15:44:03
  To: All                                               08-Sep-99 20:57:22
Subj: Re: Microsoft Word 5.5b Download

From: [e-mail] (Stefan A. Deutscher)

On Tue, 07 Sep 1999 12:41:52 -0400, [e-mail]
<[e-mail]> wrote:
>[e-mail]  (R.W. Hutchinson) said:
>>I still think that Word 5.0 was the best Word Processor I ever used,
>>but I
>
>I missed the beginning of this thread.  Where is this Word download?

http://officeupdate.microsoft.com/downloadDetails/Wd55eng.htm

It states it is an upgrade for registered users of Word 5.0. Stefan


--
=========================================================================
Stefan A. Deutscher                       | (+33-(0)1)   voice      fax
Laboratoire des Collisions Atomiques et   | LCAM :  6915-7699  6915-7671
Mol\'{e}culaires (LCAM), B\^{a}timent 351 | home :  5624-0992  call first
Universit\'{e} de Paris-Sud               | email:  [e-mail]
91405 Orsay Cedex, France (Europe)        |         (forwarded to France)
=========================================================================
 Do you know what they call a quarter-pounder with cheese in Paris?

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Universite Paris-Sud, France. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   08-Sep-99 16:00:13
  To: All                                               08-Sep-99 20:57:23
Subj: Re: IBM Anti Virus

From: "Rob Burton" <[e-mail]>

Notifying Symantec of my interest in accepting the offer to "crossgrade" to
NOrton AntiVirus Solution from IBM AntiVirus 3.0, I received a yellow CD
labeled Release 3.03 January 1999 and containing desktop, server, gateway and
administration versions for, variously, DOS, windows 3.1, Windows 9x, Win NT
3.51 and 4.0, Mac and OS/2. The part number appears to be 07-26-00143. HTH

BTW, Norton continues to post updates for the IBM AV 3.0 product. Last I saw
was AV30EI.ZIP.

On Wed, 08 Sep 1999 15:28:55 GMT, [e-mail] wrote:

|In <37d63be9$3$obot$[e-mail]>, Bob Germer
<[e-mail]> writes:
|>On <c1.2c.2S5sl6$1Ph@rhino_house.ibm.net>, on 09/07/99 at 02:13 PM,
|>   [e-mail]      (John Thompson) said:
|
|
|>FYI, I went to their website. I found that one must buy a CD with versions
|>for other operating systems to get the OS/2 version. Moreover, they don't
|>sell the CD from the on-line store. Five calls to them yesterday during
|>business hours on the left coast were not returned. Three vendors in
|>southern New Jersey and two in Philadelphia couldn't find said CD from any
|>of their sources.
|
|Oh it gets worse.  Their web site lists some 30+ vendors whom have
|on-line capability.  I checked EACH and EVERY ONE of these URL's yesterday
|in view of Tim Sipple's comment.  There is not *ONE* single site that I
|could research, nor *ONE* single search engine which can be keyed to
|look up "OS/2" which will provide a thread to that CD disk or any other
|Aintivirus disk with OS/2 support!
|
|The Symantec spokesperson was *ADAMANT* about saying that it could *NOT*
|be bought from the factory and *MUST* be bought from a resale source.  I
|was instructed to select from them via the URL link on the frame that
|took me to these URL's.
|
|  OK.
|
|    So I looked,
|
|      ZERO ability to find anything.
|
|You apparently know or someone here knows the actual Symantec part number
|for the actual CD-ROM which has the OS/2-only version on it.
|
|Maybe if we all know the appropriate part number for the OS/2-only disk
|that has the needed product, it would help.
|
|Will someone post the proper *PART NUMBER* here so that all of us can
|then go looking for a source that will sell us this disk based upon
|knowledge that even Symantec, it seems, will not provide to their
|distribs and sales sites?
|
|Maybe that way a distrib or retail site can prompt this bear out of
|hibernation with a flashlight.
|
|
|--> Sleep well; OS2's still awake! ;)
|
|[e-mail]
|[e-mail]
|



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  08-Sep-99 16:28:16
  To: All                                               08-Sep-99 20:57:23
Subj: Re: JStreet Mailer: Who, What, Where & How

From: [e-mail] (Stan Goodman)

On Wed, 8 Sep 1999 11:07:58, [e-mail] (Stan Goodman) wrote:

> I tried to subscribe to this list as soon as I saw Tim's posting. Two
> minutes later, I received a note from the list asking that I confirm the
> subscription. Two minutes after that, it turned out that the reason the
> list needed this confirmation was so that it could inform me that the list
> already had its maximum permissible number of subscribers. Way to go,
> fellas

Tim Martin was good enough to tell me the REAL address at which to get this
update (the Unofficial JStreet Users Page):

http://paul.vankeep.com/jstreet

and I have downloaded the new JAR file and installed it. The Webpage asks
that one send email to the JStreet List to report on one's impressions.
Because the list refused to subscribe me (because it says it is full), I
guess I should report here that it looks very good, and I hope the new
developers will keep up the good work.

-------------
Stan Goodman
Qiryat Tiv'on
Israel

Spammers are getting smarter; email sent to [e-mail] will not reach
me. Sorry.
Send E-mail to: domain: hashkedim dot com, username: stan.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Verio (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    08-Sep-99 08:53:08
  To: All                                               08-Sep-99 20:57:23
Subj: Re: the future of os/2

From: [e-mail] (James Knott)

On Fri, 03 Sep 1999 13:08:36 +0100, Martin Lafaix wrote:

>[The figure above is quite pessimistic.  Computers are usually not
> used continuously 14 hours per day.  And you have to take into
> account that you'll also save on office cooling (and heating too, as
> computers are not the most effective heating devices :-).]

Actually, they're quite effective.  Every bit of electricity that
enters the computer, is eventually converted to heat, one way or
another.  They produce just as much heat as an electrical heater
consuming an equal amout of electricity.


 --
E-mail [e-mail]
_________________________________________________________________________
The above opinions are my own and not those of ISM Corp., a subsidiary of
IBM Canada Ltd.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              08-Sep-99 18:57:11
  To: All                                               08-Sep-99 20:57:23
Subj: Re: fixpaks on CDROM

From: [e-mail] (Peter Stein)

In article <M3mPvLdzxX1t-pn2-wbFc27iW3Exb@localhost>,
rj friedman <[e-mail]> wrote:
>On Thu, 2 Sep 1999 21:23:41, [e-mail] (Peter
>Stein) wrote:
>
>Hmmm. I previously got to the fixpak page at bmtmicro from another OS2
>site and didn't see any answers to my questions. I now double checked
>by going directly to the bmtmicro home page and sure enough if you go
>to the fixpak page from there you get a different page (one that has
>all the answers).
>
>You are correct that it includes other updates and can be directly
>installed from CD (via a graphical install utility). Maybe $15 isn't
>so bad after all. :-)
>
>It's only US$15 the first time. All times after that it is
>only US$8. Well worth it, IMO.

Well, I decided to go for it and am glad I did. The upgrade was a snap.
Nicely done BMT Micro!

Peter Stein
[e-mail]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Suburban Robots That Monitor Reality (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               08-Sep-99 19:16:07
  To: All                                               08-Sep-99 20:57:23
Subj: Re: the future of os/2

From: [e-mail]  (R.W. Hutchinson)

>>[The figure above is quite pessimistic.  Computers are usually not
>> used continuously 14 hours per day.  And you have to take into
>> account that you'll also save on office cooling (and heating too, as
>> computers are not the most effective heating devices :-).]
>
>Actually, they're quite effective.  Every bit of electricity that
>enters the computer, is eventually converted to heat, one way or
>another.  They produce just as much heat as an electrical heater
>consuming an equal amout of electricity.
>
>
> --
>E-mail [e-mail]
>_________________________________________________________________________
>The above opinions are my own and not those of ISM Corp., a subsidiary of
>IBM Canada Ltd.

    Well, SOME "electrical heaters" are really "heat pumps" and produce MORE
heat than the amount of electricity consumed, pulling in a supplement from
outdoors.
--------------------------------------------------------------
"I would predict that there are far greater mistakes waiting
to be made by someone with your obvious talent for it."
Orac to Vila. [City at the Edge of the World.]
-----------------------------------------------
R.W. Hutchinson. | [e-mail]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: InfiNet (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    08-Sep-99 19:33:22
  To: All                                               08-Sep-99 21:38:26
Subj: Re: Imation IDE Super Disks and OS/2

From: [e-mail] (John Hong)

John Getsoian ([e-mail]) wrote:

: There is at least one small issue.

: If you still have any installable IBM accessories on XDF floppies, be
: aware that the XDFLOPPY.FLT does not attach to ATAPI drives.

    I remember reading about this.  Sam explained it that it was
because XDF was not a IBM product, it was a 3rd-party addon thing.  So
they have no way of fixing it themselves.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: St. John's InfoNET (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            08-Sep-99 21:45:27
  To: All                                               09-Sep-99 00:41:22
Subj: Re: EMX 09d madness...

From: [e-mail] (Jaap van Geels)

[e-mail] (Jerry McBride) wrote:

>I just wanted to post my experiences with the latest version of the emx
runtime
>modules, 0.9d.
>[...]
>However, funny things began to happen else where. Namely, Vsoup 1.28 and 1.29
>no longer were able to trasnfer newsgroup messages. However, oddly, email
xfers
>remaind intact. Also, after a bit of heavy use, my old and trusty Yarn 0.90
>begain to corrupt it's database.

I got vsoup129b38 from The Vsoup author's website to solve this.
Look at http://privat.swol.de/ReinhardGriech/

Dirk

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: van Geels & Co (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          08-Sep-99 22:02:15
  To: All                                               09-Sep-99 03:51:07
Subj: Re: Linux is doomed...

From: Matthew Barratt <[e-mail]>

Jaime A. Cruz, Jr. wrote:
> IBM is fully committed to the Linux platform, as it is to SOM, OpenDoc,
> Open32, OS/2, PowerPC, WorkPlace OS, the Mach kernel, ad nauseum...
>
> </SARCASM>
>
> Jaime A. Cruz, Jr.

PowerPC alive and well in embedded systems/VME market. Outdoes Intel on
size&power per unit performnce. Nice and quick too...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          08-Sep-99 22:01:22
  To: All                                               09-Sep-99 03:51:07
Subj: Re: Linux is doomed...

From: Matthew Barratt <[e-mail]>

Jaime A. Cruz, Jr. wrote:
> IBM is fully committed to the Linux platform, as it is to SOM, OpenDoc,
> Open32, OS/2, PowerPC, WorkPlace OS, the Mach kernel, ad nauseum...
>
> </SARCASM>
>
> Jaime A. Cruz, Jr.

PowerPC alive and well in embedded systems/VME market. Outdoes Intel on
size&power per unit performnce. Nice and quick too...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                08-Sep-99 21:13:14
  To: All                                               09-Sep-99 03:51:07
Subj: Re: Fastback Plus for os/2 and CDRW's Long story

From: [e-mail] (Gideon Singer)

On Wed, 8 Sep 1999 02:32:09, nospam@null (Richard Crane) wrote:

-> Can anyone
-> email me the Fastback Plus install disk files and the 1.0 update - Symantec
in
-> Australia doesn't want to help, seems rough when you've bought the license
to
-> use it ?
->

Wish I could help with the Fastback Plus install disk, but I am
looking for that one as well. I put mine somewhere and have not been
able to find it. The Fastback 1.0 update is on hobbes. As for Symantec
they will not help even here in NA. The software is no longer
supported at any level. So If anyone sees this message and has a copy
of Fastback Plus for OS2 install disk please zip it up and mail it to
both of us and then put it on Hobbes as well. I use Fastback with a
zip drive and find that it works well.

---
Gideon Singer
"It's A Magical World, Hobbes, Ol' Buddy... ...Let's Go Exploring !"
Calvin's Last Words 12/31/95
Where do you want to Warp today?
Remove the Z to email.
Webpage: members.home.net:80/gsinger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               08-Sep-99 14:22:22
  To: All                                               09-Sep-99 03:51:07
Subj: Re: JStreet Mailer: Who, What, Where & How

From: Tim Martin <[e-mail]>

Stan Goodman wrote:

> On Wed, 8 Sep 1999 11:07:58, [e-mail] (Stan Goodman) wrote:
>
> > I tried to subscribe to this list as soon as I saw Tim's posting. Two
> > minutes later, I received a note from the list asking that I confirm the
> > subscription. Two minutes after that, it turned out that the reason the
> > list needed this confirmation was so that it could inform me that the list
> > already had its maximum permissible number of subscribers. Way to go,
> > fellas
>
> Tim Martin was good enough to tell me the REAL address at which to get this
> update (the Unofficial JStreet Users Page):
>
> http://paul.vankeep.com/jstreet

The 'real' url was offered in the post to which I responded.

> and I have downloaded the new JAR file and installed it. The Webpage asks
> that one send email to the JStreet List to report on one's impressions.
> Because the list refused to subscribe me (because it says it is full), I
> guess I should report here that it looks very good, and I hope the new
> developers will keep up the good work.

I was hoping my information was helping the OS/2 user.
In the future I'll limit such information to Warp City members.

> -------------
> Stan Goodman
> Qiryat Tiv'on
> Israel
>
> Spammers are getting smarter; email sent to [e-mail] will not reach
> me. Sorry.
> Send E-mail to: domain: hashkedim dot com, username: stan.
>
> 




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Warp City (http://warpcity.com) (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            08-Sep-99 18:01:04
  To: All                                               09-Sep-99 03:51:07
Subj: Re: XGA w/ OS/2 and Linux on laptop

From: [e-mail]

In <[e-mail]>, on 09/08/99
   at 08:14 AM, fledermaus <[e-mail]> said:

>Ref:     Append at 15:09:28 on 99/09/07 GMT (by [e-mail]
>(Peter Stein) I had a hell of a time with getting ATI-64 RAGE working
>under OS/2, I suspect my fault with part of it - I do not obey
>instructions exactly. However, NO problems with LINUX and my APTIVA-C55
>for "X". Don't know about other models - and I know that newer APTIVAs
>are not for OS/2.

>"A leader who is above the law is a tyrant (e.g. Gates, Clinton)"

I think there're several different drivers for the ATI and the very
lastest isn't necessarily the best. I found out that XGA simply refers to
the resolution the screen is capable of and with the Virge S3 chipset, I
think I should be ok.

F.


-----------------------------------------------------------
      Felmon John Davis
     [e-mail]    |  [e-mail]
     Union College /  Schenectady, NY
     - insert standard doxastic disclaimers -
     OS/2 - ma kauft koi katz em sack
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Logical Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          08-Sep-99 23:02:24
  To: All                                               09-Sep-99 05:38:01
Subj: Re: the future of os/2

From: [e-mail] (Buddy Donnelly)

On Wed, 8 Sep 1999 12:53:16, [e-mail] (James Knott) a ┌crit dans un
message:

> On Fri, 03 Sep 1999 13:08:36 +0100, Martin Lafaix wrote:
>
> >[The figure above is quite pessimistic.  Computers are usually not
> > used continuously 14 hours per day.  And you have to take into
> > account that you'll also save on office cooling (and heating too, as
> > computers are not the most effective heating devices :-).]
>
> Actually, they're quite effective.  Every bit of electricity that
> enters the computer, is eventually converted to heat, one way or
> another.  They produce just as much heat as an electrical heater
> consuming an equal amout of electricity.

You're assuming, I guess, that the lightwave output from the monitors and
the soundwave output from the speakers ultimately energizes some
intercepting mass somewhere and "decays" into a rise in temperature?

But what about the electrostatic effects produced around the internal
high-voltage components that land a charge on dust particles? Should these
charged dust particles float out the door, and then give up their energy to
the great wilderness out there, isn't there a loss of useful energy going
on?

I guess these losses are offset by the gain resulting collaterally from
bugs in software that cause us to expend further keyboard and mouse moving
biological energy to overcome them.


Good luck,

Buddy

Buddy Donnelly
[e-mail]


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          08-Sep-99 18:15:24
  To: All                                               09-Sep-99 05:38:01
Subj: Re: Great Color Printer for OS/2 Warp

From: Timothy Sipples <[e-mail]>

From that web page click on "Services and Support" then click on "Printer
Drivers."

Or just visit the IBM OS/2 Device Driver Pak Online.  (The whole point of
this printer is that it's Postscript, and you'll be using the OS/2 Warp
Postscript driver.)

Randy Petersen wrote:
> Great news since I'm in the market for an OS/2 compatible color printer!
> My only question is "Where are the OS/2 drivers" ?
> They are not on this webpage.
> >   http://www.lexmark.com/printers/inkjet/OptraColor/40.html

--
Timothy Sipples
IBM Network Computing Software
Chicago, Illinois
Web: http://www.satdirect.com/aviation

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: IBM Network Computing Software (Chicago) (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                 08-Sep-99 23:57:13
  To: All                                               09-Sep-99 05:38:02
Subj: Launchpad at lower left corner

From: [e-mail] (S.D. Rhodes)

Recently my launchpad has started deciding that every time I boot up, it
should be located at the lower left corner, instead of near the center
of the bottom where I prefer it.  Every time I boot, I move it to where
I want it to be; every time I turn the machine off and then on again, it
goes right back to the lower left.  It has only started doing this in
recent months (before, it stayed where I left it when I shut it off),
and I'm unaware of any changes I have made to the system that could have
caused this (i.e., I haven't installed any new programs, utilities, or
peripherals lately).

Does anyone know what's causing this, and more importantly, how to fix
it?  It's certainly not an insurmountable problem (it takes all of three
seconds to fix), but it is mildly aggravating.




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: iPass.Net (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      09-Sep-99 02:29:17
  To: All                                               09-Sep-99 05:38:02
Subj: Re: Linux is doomed...

From: Martin Nisshagen <[e-mail]>

Matthew Barratt [] -> comp.os.os2.misc:

» PowerPC alive and well in embedded systems/VME market. Outdoes Intel on
» size&power per unit performnce. Nice and quick too...

Absolutely.

IBM has used it in many of it's AIX machines, and just like Motorola has for
some time, IBM will now also start to focus more on the embedded market for
PowerPC (which the chip seems to do very well in).

Best regards,

m a r t i n | n

--
Martin Nisshagen                 PGP 6.0: 0x45D423AC      K R A F T W E R K
:-)
CS/CE, Chalmers, Sweden          ICQ UIN: 689662          2 x 300A @ 450 MHz
d4nisse-at-dtek-chalmers-se      home2.sbbs2.com/mn
home2.sbbs2.com/mn/kw

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Chalmers University of Technology, Sweden (1:109/42)

+----------------------------------------------------------------------------+

From: nospam@null                                       09-Sep-99 01:50:00
  To: All                                               09-Sep-99 10:27:18
Subj: OT Slightly only  OS/2 FastBack Plus

From: nospam@null (Richard A Crane)

It has beeen suggested to me that "Mike Stephen" who wrote FB/2 is active in
these newsgroups - if so can he post a reply please? I would like to contact
him.


Richard A Crane
Check Copyright of this with the author or you may suffer litigation or
embarrassment.

ps Foolproof is not good enough ..... we're not dealing with fools

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   09-Sep-99 01:29:18
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Help - Coping web site using NS of HPP?

From: [e-mail]

In <[e-mail]>, Dave Critelli <[e-mail]> writes:
>Thank you everyone for the information - I'll give slurp a try.
>Dave
>

Dave,

You might want to also look at Templeton (also available from Hobbes).
Templeton has many more features than Sslurp and can better handle
"bad" HTML code.  In particular, Templeton has been explicitly designed
to download web pages and save them in a form that can be burnt to CD-ROM
or accessed by a local web server.  (Or accessed with "File -> Open" under
your favorite browser.)

You can also find it at BMT Micro:  http://www.bmtmicro.com/catalog/tton/
The distribution contains all of the documentation in HTML form, as
well as executables for OS/2, Redhat Linux, and Solaris.

(Then again, I'm a biased source.)

                    -Neal Krawetz
                    Templeton Project


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          09-Sep-99 02:11:14
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Launchpad at lower left corner

From: [e-mail] (Buddy Donnelly)

On Wed, 8 Sep 1999 23:57:27, [e-mail] (S.D. Rhodes) a ┌crit dans
un message:

> Recently my launchpad has started deciding that every time I boot up, it
> should be located at the lower left corner, instead of near the center
> of the bottom where I prefer it.  Every time I boot, I move it to where
> I want it to be; every time I turn the machine off and then on again, it
> goes right back to the lower left.  It has only started doing this in
> recent months (before, it stayed where I left it when I shut it off),
> and I'm unaware of any changes I have made to the system that could have
> caused this (i.e., I haven't installed any new programs, utilities, or
> peripherals lately).
>
> Does anyone know what's causing this, and more importantly, how to fix
> it?  It's certainly not an insurmountable problem (it takes all of three
> seconds to fix), but it is mildly aggravating.

You say you "turn the machine off" but you don't say you're using the OS/2
Shutdown process. Shutdown should save the location, but just turning the
switch off won't.

You can force a location change to be saved by closing the Launchpad. Just
RMB click on some dead area in it, to popup the context menu, and select
"Close" at the bottom. This should lock it into place okay, but start using
Shutdown or you'll end up with a system full of other problems.

Also, under Desktop | Properties | Desktop , make sure the "Save Desktop
properties" box is checked.


Good luck,

Buddy

Buddy Donnelly
[e-mail]


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   08-Sep-99 22:31:18
  To: [e-mail], @, worldnet.att..               09-Sep-99 12:44:11
Subj: Re: NS/2 4.04 is driving me crazy!

To: [e-mail], @, [e-mail]
From: Norton Boothe <[e-mail]>

Thanks for the tip. It looks as if the fix is for the 40bit version. Maybe it
works
for the US version but I am not sure.

Raphael Tennenbaum wrote:

> Norton Boothe <[e-mail]> wrote:
>
> >I have seen the same thing but not that frequently. I think it might be
related
> >to cache cleanup (removing xxx files) but not sure.
> >
> >A worse problem with 4.04 is the long time (over 5 minutes) it takes to
exit it.
> >I can't even shut down until this program puts itself to bed. I have
truncated
> >the history list, cache, etc but nothing speeds it up. Any ideas, anyone?
> >
>
> The update helps with this problem -- a lot -- still the
> occasional hang after exiting, but much much better than
> before, and it fixes other problems as well (here, anyway).
>
> ftp.software.ibm.com in the
>
> /ps/products/netscape/fixes/a_universal
>
> directory.
>
> --
> Ray Tennenbaum        '99 YZF-R6
> readme@ http://www.ray-field.com



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   08-Sep-99 22:51:13
  To: All                                               09-Sep-99 12:44:11
Subj: Re: IBM Anti Virus

From: Alon Stewart <[e-mail]>

There was a phone number posted at the Symantec web site for several
months that you could call if you were a registered IBM AV user and they
would sent the OS/2 version.  The one I got is dated April 1999 and has
all their AV products including server versions.
I'll post the phone number if I still have it.  BTW, it is much slower
than IBM AV in scanning files, but the active on-line update feature is
handy.  I had to deactivate the DOS-WIN live session because it is so
slow that some Windows programs would not run.

George Penzenik wrote:

> Does anyone know WHEN Symantec is going to release an OS/2 version of
> thier product?  This was promised when IBM 'sold' INBAV to Symantec.
>
> I written and emailed but all I get is a run around.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: askbill*AT*ibm.net                                09-Sep-99 11:05:29
  To: All                                               09-Sep-99 12:44:11
Subj: Re: the future of os/2

From: askbill*AT*ibm.net

In <[e-mail]>, on
09/08/99
   at 11:02 PM, [e-mail] (Buddy Donnelly) said:

>On Wed, 8 Sep 1999 12:53:16, [e-mail] (James Knott) a écrit dans un
> message:

>> On Fri, 03 Sep 1999 13:08:36 +0100, Martin Lafaix wrote:
>>
>> >[The figure above is quite pessimistic.  Computers are usually not
>> > used continuously 14 hours per day.  And you have to take into

*SNIP*
>You're assuming, I guess, that the lightwave output from the monitors and
> the soundwave output from the speakers ultimately energizes some
>intercepting mass somewhere and "decays" into a rise in temperature?

Curious sounding, but fact.  Entropy in action.

Known for years with respect to audio energy, and General Electric makes
use of it in their training on office building lighting.  For example,
100% of the energy input to a fluorescent lighting "system" ends up as
heat. Some may radiate electromagnetically from the ballast, a percentage
serves us (temporarily) as visible light - but ALL ends as heat - and
quickly so.

>But what about the electrostatic effects produced around the internal
>high-voltage components that land a charge on dust particles? Should
>these  charged dust particles float out the door, and then give up their
>energy to the great wilderness out there, isn't there a loss of useful
>energy going  on?

Hmmmm...... dy'a think enough charged dust could obviate the need for air
confitioning? Might be a patent lurking here.....  or at least a "Sharper
Image" gadget.

>I guess these losses are offset by the gain resulting collaterally from
>bugs in software that cause us to expend further keyboard and mouse
>moving  biological energy to overcome them.

Paltry few ergs compared to the mental "road rage" when we encounter the
bugs!

Cheers!

Bill Hacker

--
-----------------------------------------------------------
[e-mail] (William B. Hacker, III)

Titanic '12   NYSE '29   Windows '95 and subsequent.....
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          09-Sep-99 03:52:11
  To: All                                               09-Sep-99 12:44:11
Subj: Re: the future of os/2

From: [e-mail] (Buddy Donnelly)

On Thu, 9 Sep 1999 15:05:59, askbill*AT*ibm.net a ┌crit dans un message:

>
> Known for years with respect to audio energy, and General Electric makes
> use of it in their training on office building lighting.  For example,
> 100% of the energy input to a fluorescent lighting "system" ends up as
> heat. Some may radiate electromagnetically from the ballast, a percentage
> serves us (temporarily) as visible light - but ALL ends as heat - and
> quickly so.

Including the percentage that transforms (sorry) in the aging ballasts to
sound. And the phased pulsations of the light that combines with that sound
to generate "shopper's madness" or other forms of interior road rage in the
aisles of yer typical 5 year old Wal-Mart.


>
> >But what about the electrostatic effects produced around the internal
> >high-voltage components that land a charge on dust particles? Should
> >these  charged dust particles float out the door, and then give up their
> >energy to the great wilderness out there, isn't there a loss of useful
> >energy going  on?
>
> Hmmmm...... dy'a think enough charged dust could obviate the need for air
> confitioning? Might be a patent lurking here.....  or at least a "Sharper
> Image" gadget.

Sharper Image issued an historic statement, that there was no further need
for inventing Sharper Image products, because all possible Sharper Image
products had already been invented. And then either broken or sold at least
twice in yard sales or Sheriff's Bankruptcy Sales.


>
> >I guess these losses are offset by the gain resulting collaterally from
> >bugs in software that cause us to expend further keyboard and mouse
> >moving  biological energy to overcome them.
>
> Paltry few ergs compared to the mental "road rage" when we encounter the
> bugs!

Some of us ride only half-awake on the calm sea of complacency when things
are going well (as they are for me these days) to only come completely
alive when something fails to act the way it should.


Good luck,

Buddy

Buddy Donnelly
[e-mail]


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             09-Sep-99 00:03:15
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Fastback Plus for os/2 and CDRW's Long story

From: Alan Beagley <[e-mail]>

Would it be "kosher" to put FastBack Plus on Hobbes? I think I have the
program
somewhere.

Alan


Gideon Singer wrote:

> On Wed, 8 Sep 1999 02:32:09, nospam@null (Richard Crane) wrote:
>
> -> Can anyone
> -> email me the Fastback Plus install disk files and the 1.0 update -
Symantec in
> -> Australia doesn't want to help, seems rough when you've bought the
license to
> -> use it ?
> ->
>
> Wish I could help with the Fastback Plus install disk, but I am
> looking for that one as well. I put mine somewhere and have not been
> able to find it. The Fastback 1.0 update is on hobbes. As for Symantec
> they will not help even here in NA. The software is no longer
> supported at any level. So If anyone sees this message and has a copy
> of Fastback Plus for OS2 install disk please zip it up and mail it to
> both of us and then put it on Hobbes as well. I use Fastback with a
> zip drive and find that it works well.
>
> ---
> Gideon Singer
> "It's A Magical World, Hobbes, Ol' Buddy... ...Let's Go Exploring !"
> Calvin's Last Words 12/31/95
> Where do you want to Warp today?
> Remove the Z to email.
> Webpage: members.home.net:80/gsinger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                09-Sep-99 04:49:26
  To: All                                               09-Sep-99 12:44:11
Subj: Re: Fastback Plus for os/2 and CDRW's Long story

From: [e-mail]   (Baden Kudrenecky)

In <[e-mail]>,
[e-mail] (Gideon Singer) writes:
>On Wed, 8 Sep 1999 02:32:09, nospam@null (Richard Crane) wrote:
>
>-> Can anyone
>-> email me the Fastback Plus install disk files and the 1.0 update -
Symantec in
>-> Australia doesn't want to help, seems rough when you've bought the license
to
>-> use it ?
>->
>
>Wish I could help with the Fastback Plus install disk, but I am
>looking for that one as well. I put mine somewhere and have not been
>able to find it. The Fastback 1.0 update is on hobbes. As for Symantec
>they will not help even here in NA. The software is no longer
>supported at any level. So If anyone sees this message and has a copy
>of Fastback Plus for OS2 install disk please zip it up and mail it to
>both of us and then put it on Hobbes as well. I use Fastback with a
>zip drive and find that it works well.

   I cannot see it being released to the public domain (Hobbes),
as Symantec owns it, and I doubt that they would release it.
The developers do not have the rights to it.  That being said, I
have a (hidden) copy on my WWW site, so if you can let me
believe that you own a licence, I'll send you the URL.

baden

[e-mail]
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                08-Sep-99 22:14:19
  To: All                                               09-Sep-99 12:44:11
Subj: TCP/IP error when sending e-mail

From: "J. Weinkam" <[e-mail]>

I am getting the an error in the IBM Dial-Up for TCP/IP when I send an
email message using Communicator 4.61 Preview 2.  The error is
error  : [NETW] Invalid fcs.

This error is reported several times and makes the email transfer very
slow.  The email eventually gets sent but should be able to be sent much
faster.

How can I get rid of this error?

Thanks,

James

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Sprint Canada Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                  08-Sep-99 19:00:23
  To: All                                               09-Sep-99 12:44:12
Subj: Re: JStreet Mailer: Who, What, Where & How

From: Tony Wright <[e-mail]>

Tim Martin wrote:

> Stan Goodman wrote:
>
> > I tried to subscribe to this list as soon as I saw Tim's posting. Two
> > minutes later, I received a note from the list asking that I confirm the
> > subscription. Two minutes after that, it turned out that the reason the
> > list needed this confirmation was so that it could inform me that the list
> > already had its maximum permissible number of subscribers. Way to go,
> > fellas.
>
> I know there was some discussion of resticting the mail list
> for various reasons.  Do not feel slighted or angry because
> you can't get on.  There is a purpose to all the madness.
>
> The developers may want to keep the number of subscribers
> on a manageable level.  As a web master who also restricts the
> number of members who have access to our services (free
> tech support) it is very difficult to make everyone happy or
> to meet all the requests for help that come in.  I can sometimes
> get so bogged down from 'help me' requests that the Warp City
> site suffers, updates cannot be accomplished, other members
> requests cannot be fulfilled.  And as with all free things, there are
> those who need a lot of step-by-step hand holding or personalized
> assistance.  All of that is time consuming and takes focus away
> from the JSM updating work.  The JStreet Band developers are releasing
> updates that are considered solid Betas.  You know people, the
> minute an update causes a problem some folks go completely
> berserk and trash the work, flame the developers and end up
> generating a bunch of negativity.

What a nice,courteous and thoughtful reply for a change......A real
pleasure to read.......

Of course if a certain other ISV had been developing JStreet mailer then
perhaps one might be excused for expecting someone in particular to go
*berserk* with some very *negative* *flames* in an attempt to *trash*
their efforts? Strange 'ol world........

...but do PLEASE keep up the *CONSTRUCTIVE* work....

--
Rgds Tony W   Email: [e-mail]

"humanum est errare: To err is human
.... and to fail is to be a Project Manager...
...but to foul things up completely needs a computer!"


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Equi-Tek CompCon (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                         09-Sep-99 06:47:26
  To: All                                               09-Sep-99 12:44:12
Subj: Re: TCP/IP error when sending e-mail

From: "Dave {Reply Address in.sig}" <[e-mail]>

On Wed, 08 Sep 1999 22:14:38 -0700, J. Weinkam wrote:

>I am getting the an error in the IBM Dial-Up for TCP/IP when I send an
>email message using Communicator 4.61 Preview 2.  The error is
>error  : [NETW] Invalid fcs.
>
>This error is reported several times and makes the email transfer very
>slow.  The email eventually gets sent but should be able to be sent much
>faster.
>
>How can I get rid of this error?
>
What spec machine are you running? Sounds like you're dropping
characters on the serial port due to the machine being excessively busy
elsewhere.

Dave
--
mail dav [e-mail]
http://www.llondel.demon.co.uk
Cricket: old English traditional variant of the rain dance.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: the bus stop (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                09-Sep-99 01:10:05
  To: All                                               09-Sep-99 12:44:12
Subj: Re: I got OS/2 2.11... for $1.50!

From: Bovine Unit #243 <[e-mail]>

>> WordPerfect/2 v5.2 is my work processor.  It works quite well.
>> Well, it did until I installed OS/2 v4 and moved the Docs
>> directory to another HD, and now the associations don't work,
>> I have to find out what's wrong.

>On my system, the background goes black the instant I do a page down
>or a line feed or anything that affects the current line/view.  Makes
>it kind of hard to work with...

The only way I could get WP5.2 to work is have the video mode in 256
colors -- which is not fun. I've stuck with WP5.1 DOS...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Moo Org. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               09-Sep-99 13:03:12
  To: All                                               09-Sep-99 15:49:21
Subj: File Commander/2 !!!!!!!!!

From: "C.J." <[e-mail]>

File Commander/2
************************

File Manager

File Commander is a 32 bit text mode file manager and shell that allows you
to locate, copy, move, delete, view, edit and execute your files in a quick,
convenient and customizable manner.

Versions for windows 95/98/NT and OS2 are available.

Check it out and download File Commander/2 for a free trial period from:
    http://www.btsoftware.com/os2/filecmdr.htm






--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: C.J. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                09-Sep-99 07:05:01
  To: All                                               09-Sep-99 15:49:21
Subj: Re: EMX 09d madness...

From: [e-mail] (Jerry McBride)

In article <LrvB3.417$[e-mail]>, [e-mail] wrote:
>:>I just wanted to post my experiences with the latest version of the emx
runtime
>:>modules, 0.9d.
>:>
>:>However, funny things began to happen else where. Namely, Vsoup 1.28 and
1.29
>:>no longer were able to trasnfer newsgroup messages. However, oddly, email
xfers
>:>remaind intact. Also, after a bit of heavy use, my old and trusty Yarn 0.90
>:>begain to corrupt it's database.
>
>
>Yeow! Thought I was going crazy. Had to switch to Emtec (and even
>considered slrn) 'cause of this. Maybe, as C. Hennecke suggested, I'll
>try the latest fix.
>Hope it works; Yarn is still my fave.
>

Just to add to the information. After applying the emxfix02 package the
problems STILL persist. Vsoup 1.29.44 for OS/2 works fairly well, although I
don't like the new "graphics in VIO" interface, but yarn will sill happily
corrupt it's database.

I'm going to stay at the EMX version 09c and let the rest of the world pass me
by on this one. It's not worth the trouble...

Good luck,


--

*******************************************************************************

*            Sometimes, the BEST things in life really ARE free...
*
*       Get a FREE copy of NetRexx 1.150 for your next java project at:
*
*                     http://www2.hursley.ibm.com/netrexx
*
*******************************************************************************


/----------------------------------------\
| From the desktop of: Jerome D. McBride |
|         [e-mail]             |
\----------------------------------------/

--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: TEAM-NETREXX (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   09-Sep-99 05:36:28
  To: All                                               09-Sep-99 15:49:21
Subj: Re: JStreet Mailer: Who, What, Where & How

From: "Dale Curren" <[e-mail]>

On Wed, 08 Sep 1999 19:00:46 +0100, Tony Wright wrote:

Paul VanKeep just increased the number of members to 200.  Try again.

>> Stan Goodman wrote:
>>
>> > I tried to subscribe to this list as soon as I saw Tim's posting. Two
>> > minutes later, I received a note from the list asking that I confirm the
>> > subscription. Two minutes after that, it turned out that the reason the
>> > list needed this confirmation was so that it could inform me that the
list
>> > already had its maximum permissible number of subscribers. Way to go,
>> > fellas.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           08-Sep-99 22:26:10
  To: All                                               09-Sep-99 15:49:21
Subj: Re: Shutting WARP 3 VIO-Windows without interaction?

From: "D.J. van Enckevort" <[e-mail]>

On Tue, 07 Sep 1999 14:21:33 GMT, John Thompson wrote:

>
>On my Warp v3 system there is a /os2/install/shutdown.exe program
>that seems to do what you ask.  If you run "sendyes.exe" (I seem
>to recall getting it from hobbes, but don't see it there now) it
>will close your VIO windows without prompting.
Is enhanced shutdown of XFolders not a solution???
Ciao,
   David
--
David van Enckevort

homepage: http://huizen.dds.nl/~enckevor
          http://home.hccnet.nl/van.enckevort



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://home.hccnet.nl/van.enckevort (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           08-Sep-99 22:37:10
  To: All                                               09-Sep-99 15:49:21
Subj: Re: Great Color Printer for OS/2 Warp

From: "D.J. van Enckevort" <[e-mail]>

On Tue, 07 Sep 1999 22:59:08 -0700, Randy Petersen wrote:

>Great news since I'm in the market for an OS/2 compatible color printer!
>
>My only question is "Where are the OS/2 drivers" ?
>They are not on this webpage.
>
>>   http://www.lexmark.com/printers/inkjet/OptraColor/40.html
At least for the Optra E310 laserprinter they are on the CD-ROM included with
the product! Yes, really a piece of computer hardware with _out of the box_
OS/2 support!

Ciao,
   David

--
David van Enckevort

homepage: http://huizen.dds.nl/~enckevor
          http://home.hccnet.nl/van.enckevort



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: http://home.hccnet.nl/van.enckevort (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              09-Sep-99 13:12:19
  To: All                                               09-Sep-99 15:49:21
Subj: Re: Fastback Plus for os/2 and CDRW's Long story

From: luistino <[e-mail]>

Baden Kudrenecky wrote:
>
> In <[e-mail]>,
[e-mail] (Gideon Singer) writes:
> >On Wed, 8 Sep 1999 02:32:09, nospam@null (Richard Crane) wrote:
> >
> >-> Can anyone
> >-> email me the Fastback Plus install disk files and the 1.0 update -
Symantec
>
>    I cannot see it being released to the public domain (Hobbes),
> as Symantec owns it, and I doubt that they would release it.
> The developers do not have the rights to it.  That being said, I
> have a (hidden) copy on my WWW site, so if you can let me
> believe that you own a licence, I'll send you the URL.
>
> baden
>
> [e-mail]
> http://baden.nu/
> OS/2, Solaris & Linux
Hi Baden

I own a company which did licence it. Now I can't find the box.I have a
whole bunch of fastback backed up manuals and no software to read them.
System crashed and that's all she wrote. A copy of the prog would be
great.

Thanks

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    09-Sep-99 14:11:04
  To: All                                               09-Sep-99 15:49:21
Subj: Re: EMX 09d madness...

From: [e-mail]

:>>However, funny things began to happen else where. Namely, Vsoup 1.28 and
1.29
:>>no longer were able to trasnfer newsgroup messages. However, oddly, email
xfers
:>>remaind intact. Also, after a bit of heavy use, my old and trusty Yarn 0.90
:>>begain to corrupt it's database.
:>
:>I got vsoup129b38 from The Vsoup author's website to solve this.
:>Look at http://privat.swol.de/ReinhardGriech/

Nada with emxfix02 and, as Mr. McBride tried, vSoup 1.28 or 1.29.
Couldn't get to the listed website for further nfo.



ohwell
jehnk


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              09-Sep-99 23:08:16
  To: All                                               09-Sep-99 15:49:21
Subj: Re: the future of os/2

From: [e-mail] (Ahmad Jawed Hirobumi Atif)

In article <[e-mail]>,
[e-mail] (James Knott) wrote:

> On Fri, 03 Sep 1999 13:08:36 +0100, Martin Lafaix wrote:
>
> > (and heating too, as
> > computers are not the most effective heating devices :-).]
>
> Actually, they're quite effective. Every bit of electricity that
> enters the computer, is eventually converted to heat, one way or
> another.

I don't have data to refute what you are saying, however, I think that at
least monitors are not heat efficient, because some energy is dissipated
in electromagnetic field such as light.

--
Regards, Jawed
To email directly, please remove the last x.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: To email directly, please remove the last x. (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           09-Sep-99 17:52:02
  To: All                                               09-Sep-99 17:03:11
Subj: Re: IBM Anti Virus

From: doug.bissett"at"ibm.net (Doug Bissett)

On Thu, 9 Sep 1999 02:51:27, Alon Stewart <[e-mail]> wrote:

> I had to deactivate the DOS-WIN live session because it is so
> slow that some Windows programs would not run.
>

Isn't that kind of like leaving the spare tire, for your car, in the
garage, because it takes up room in the trunk??? Seems to me that the
DOS-WIN live session (if that is really what it sounds like) is the
single most important part of the antivirus thing (to STOP viruses,
before they do any damage).

I have been considering getting NAV, but it is difficult to get, and I
have seen the Win9x version, which didn't work worth a damn. I am
still using IBMAV, and will continue to do so, until Symantec gets
their act together, or some other AV program is better (McAfee did not
work worth a damn either, the last time I tried that, which was a few
years ago). Personally, I am working toward "PROTECTONLY=YES", which
should protect my system better than any AV program.
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                09-Sep-99 17:58:12
  To: All                                               09-Sep-99 17:03:11
Subj: Re: OT Slightly only  OS/2 FastBack Plus

From: [e-mail] (Mike Stephen)

In message
<[e-mail]> -
nospam@null (Richard A Crane) writes:
:>
:>It has beeen suggested to me that "Mike Stephen" who wrote FB/2 is active in

:>these newsgroups - if so can he post a reply please? I would like to contact

:>him.
:>
:>
:>Richard A Crane
:>Check Copyright of this with the author or you may suffer litigation or
:>embarrassment.
:>
:>ps Foolproof is not good enough ..... we're not dealing with fools
:>

Just to clarify.....  I do not write code.  Never have (other than a
few Rexx scripts).  I did however get Fastback/2 rolling with %th
Generation Systems.  I did negotiate a contract with then.  I did help
with the initial design style.  I did test the hell out of it....

And finally I did get paid to do so.

And yes of couse I did get screwed by Symantec when they bought 5Th
Generation Systems.


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: M Stephen Contracting (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          09-Sep-99 19:05:08
  To: All                                               09-Sep-99 20:01:15
Subj: Re: the future of os/2

From: [e-mail] (Buddy Donnelly)

On Thu, 9 Sep 1999 14:08:32, [e-mail] (Ahmad Jawed Hirobumi
Atif) a ┌crit dans un message:

>
> In article <[e-mail]>,
> [e-mail] (James Knott) wrote:
>
> > On Fri, 03 Sep 1999 13:08:36 +0100, Martin Lafaix wrote:
> >
> > > (and heating too, as
> > > computers are not the most effective heating devices :-).]
> >
> > Actually, they're quite effective. Every bit of electricity that
> > enters the computer, is eventually converted to heat, one way or
> > another.
>
> I don't have data to refute what you are saying, however, I think that at
> least monitors are not heat efficient, because some energy is dissipated
> in electromagnetic field such as light.

Yes it is radiated as light, but when the light particles hit mass their
energy is converted almost 100% into heat. (A tiny bit might go into
chemical changes, fading the colored pigments in my wallpaper.)

Good luck,

Buddy

Buddy Donnelly
[e-mail]


--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: RoadRunner - TampaBay (1:109/42)

+----------------------------------------------------------------------------+

From: askbill*AT*ibm.net                                10-Sep-99 04:16:21
  To: All                                               09-Sep-99 23:52:09
Subj: Re: IBM Anti Virus

From: askbill*AT*ibm.net

In <SKfw30zmCGmZ-pn2-dPPBRdNdyDOy@localhost>, on 09/09/99
   at 05:52 PM, doug.bissett"at"ibm.net (Doug Bissett) said:

>On Thu, 9 Sep 1999 02:51:27, Alon Stewart <[e-mail]> wrote:

>> I had to deactivate the DOS-WIN live session because it is so
>> slow that some Windows programs would not run.
>>

>Isn't that kind of like leaving the spare tire, for your car, in the
>garage, because it takes up room in the trunk??? Seems to me that the
>DOS-WIN live session (if that is really what it sounds like) is the
>single most important part of the antivirus thing (to STOP viruses,
>before they do any damage).

Disagree.  The ABSENCE of ANY DOS or WIN-OS2 helps stop viri.

>I have been considering getting NAV, but it is difficult to get, and I
>have seen the Win9x version, which didn't work worth a damn. I am  still
>using IBMAV, and will continue to do so, until Symantec gets  their act
>together, or some other AV program is better (McAfee did not work worth a
>damn either, the last time I tried that, which was a few  years ago).

Have a look at the trial version of Pandasoft.  Surprisingly effective for
 "cheapware".  Fails to handle a whole slew of StarOffice files, dies
outright with a GPF on some of my files (but they are elsewhere on a LAN).
But accurately found several copies of a Word macro virus I had been
gifted (no harm - SO ignored it), plus two copies of Anticmos (also no
harm - disk partitioning is boot-sector virus immune).

>Personally, I am working toward "PROTECTONLY=YES", which  should protect
>my system better than any AV program.

It does that - and is effective against nonsense as well as viri.

You might have, for example, a more stable Netscape, 'tho "Realtime" goes
away.

A little care with your HDD partitioning, and even the boot-sector viri
are stopped in their tracks. And for "serious" work, my servers use the
ASUS DA-210 RAID controller.  The "boot sector" sits in NVRAM behind a
dedicated 486DX4-100, and can be changed only with the ASUS utility.

Downtime?  Yep.  Gotta clean the fans once a year and wash the Hong Kong
mold off the MB.

YMMV!

Bill "PROTECTONLY=YES" Hacker
--
-----------------------------------------------------------
[e-mail] (William B. Hacker, III)

Titanic '12   NYSE '29   Windows '95 and subsequent.....
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    09-Sep-99 23:42:29
  To: All                                               10-Sep-99 04:48:07
Subj: Re: IBM Anti Virus

From: [e-mail] (Frank Kirk)

On Wed, 8 Sep 1999 10:35:02, Bob Germer <[e-mail]>
wrote:

> Hmm, I just went to their website. I AM sending a copy of this message to
> [e-mail]. I wonder if THIS will garner a response

    Don't hold your breath.  If you receive a response, it'll probably be
a standard form letter;  "Thank you for your interest, blah, blah,
blah.

    Someone recently put me on hold for a long time while I listened to
recordings telling me "your call is important to us", shortly before I
was disconnected.

FWK

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   09-Sep-99 17:57:09
  To: All                                               10-Sep-99 04:48:07
Subj: Astra 610P scanner, anyone using it in Warp?

From: [e-mail]

I bought one because more than a few folks said it works great in WinOS2.

Well, the software works, and it is a nice scanner, but no matter what I
try, I cannot use an app to scan, and then print, without first quitting
the scan application.

PSP, the stuff that comes with the scanner, even the copier function
requires that I shut down the copier app before it will print. The print
window pops up, and shows the big red X and says the device is in use.

I have tried what I think are every combination of settings in the winos2
session, and using the print manager or not, but nothing will allow me to
print without shutting down the apps first. I even put the scanner on LPT2
and the printer on LPT1 to no avail. The scanning app is locking out the
printer for some reason.

If anyone is using this scanner and scanning to the printer without
problems like this, I would love to hear from you. I know have a Microtek
E3 that doesn't work in OS/2 and the 610P (it works, but its not
convenient at all) Sane does NOT work with the E3, and CFM is not an
option.

Much obliged for any ideas or comments.

Thanks,

John



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: ArosNet Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                               09-Sep-99 18:05:29
  To: All                                               10-Sep-99 04:48:07
Subj: DOS/OS/2 question

From: Jim Devenport <[e-mail]>

I just inherited an older IBM slooooooooww laptop with OS/2, and this is
my first exposure.  I'd really like to just disable OS/2 and have the
laptop default to DOS when booting, but can find nothing of the sort to
modify in autoexec.bat  .
Any quik 'n dirty ideas on how to accomplish this?
Jim W5AOX

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Concentric Internet Services (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                         10-Sep-99 11:36:06
  To: All                                               10-Sep-99 04:48:07
Subj: XFree86/2 3.3.5: Server problem

From: Arnstein Prytz <[e-mail]>

After reading the documentation for the latest XFree86/2 release
I only updated the appropriate server XF86_SVGA.  I get as far
as the `gray woven' background and then it stops.  The error
log is full of entries like the following

_X11TransOs2OpenClient: Open server pipe \PIPE\X\xf86.0 failed, rc=3
_X11Trans       Probable causes: either the XServer is not running,...
_X11Trans       or the DISPLAY variable is set incorrectly.
_X11TransOpen: transport open failed for local/localhost:0

The error log seems to indicate that everything else is ok.
If I reinstate the previous XF86_SVGA file there are no problems.

Have I been daft and should have installed the whole set of files
from 3.3.5?

Regards, Arnstein.
------------------------------------------------------------------
Arnstein Prytz                 [e-mail]
Department of Physics                ph:  61-7-47815183
James Cook University                        fax: [phone]
Townsville, Queensland 4811, Australia
------------------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Queensland (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                10-Sep-99 01:13:19
  To: All                                               10-Sep-99 04:48:07
Subj: Lost Mb's - where are they?

From: [e-mail] (Max)

I run an 486 notebook with one HPFS-partition on a 540mb harddisk.
When unzipping some files I observed some unusual disk activity which
almost brought the system to a stillstand, I shut down and restarted.
When back on, the free space decreased from 200mb to 68mb, chkdsk OS2
reported 465mb in 13000 filez, Xtgold (DOS) reports 330mb in 11000
files, however, both agree on 60mb free space. Where are these 130mb?

        anybody with any clues - please....

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Zip World (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    10-Sep-99 02:22:10
  To: All                                               10-Sep-99 04:48:07
Subj: Re: DOS/OS/2 question

From: [e-mail] (Peter Moylan)

Jim Devenport <[e-mail]> wrote:
>I just inherited an older IBM slooooooooww laptop with OS/2, and this is
>my first exposure.  I'd really like to just disable OS/2 and have the
>laptop default to DOS when booting, but can find nothing of the sort to
>modify in autoexec.bat  .
>Any quik 'n dirty ideas on how to accomplish this?

First off, autoexec.bat is the wrong place to look.  OS/2 doesn't ever
use autoexec.bat, except when starting up a copy of DOS as a sub-process.
The sorts of things that DOS & Windows users are used to find in
autoexec.bat will instead be found in config.sys in an OS/2 system.

Now to the main question.

Unlike Windows, OS/2 is not just a shell running on top of DOS.  It is
an operating system that's entirely independent of DOS.  Thus, you
can't do precisely what you're asking.

Luckily, there are a few ways to get a roughly equivalent result:

Method 1: The preferred method, for people who want both OS/2 and DOS
on their computer, is to install the OS/2 Boot Manager, and install
DOS on one partition and OS/2 on another.  This, however, requires
a re-installation, so it's probably not what you're looking for.

Method 2: Find the line in CONFIG.SYS that says something like
             PROTSHELL=D:\OS2\PMSHELL.EXE
and stick a REM at the beginning of this line.  Once you've commented
out this line, the graphics-mode part of OS/2 won't be loaded during
boot-up, and you'll be left with an OS/2 command line environment.
The OS/2 commands aren't precisely the same as DOS commands, but
they're near enough for most purposes - you probably won't notice the
difference.  The catch with this approach is that you end up with
a dumbed-down system, where some of the best features of OS/2 are
missing, but it does sound like this is what you want.

Method 3: A compromise solution is to go to http://hobbes.nmsu.edu
and pick up a copy of the freeware PC/2.  You can use PC/2 as a
substitute for PMSHELL, but with all the fancier features stripped
out, leading to much faster booting.

--
Peter Moylan                                         [e-mail]
See http://eepjm.newcastle.edu.au for OS/2 information and software

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Newcastle (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   09-Sep-99 22:39:21
  To: All                                               10-Sep-99 04:48:07
Subj: ?Why post-script for OS/2?

From: [e-mail] (Harry Travis)

Why is post-script something to value using OS/2 (and almost entirely
OS/2 apps with printed presentation output? (LIke asking  "Why SCSI
instead of IDE?"  in the coo scsi newsgroup).

BTW, the post-script and PCL5e-capable -Lexmark Color Optra 40 whose
closeout pricing T. Sipples has pointed out has a duty cycle rating of
3000 copies/month, not surprising, really for a unit designed for
network connection. (and the cartridges are the same as for mass-market
Lexmark 5700)

--
-----------------------------------------------------------
[e-mail] (Harry Travis)
DemostiX
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                10-Sep-99 01:50:17
  To: All                                               10-Sep-99 04:48:07
Subj: Re: Please help, 2400 baud sucks!  need v.90 modem

From: [e-mail] (Max)

[e-mail] wrote:

>Hi,

>My ISP upgraded to V.90 and now my old Supra 14.4 faxmodem
>can only connect at 2400. Ouch.

>Can anyone tell me what v.90 modem will work with my system?

>I have a Pentium 60 PCI system.  I have Warp 3.0 with fixpack 40.

I just bought a MOTOROLA PCI modem, V90 PCI bus.
IT REALLY REALLY SUCKS.
It only runs under WIN 98, motorola ignores any questions, and on the
attached cd you find everything but OS2 or Linux drivers.
Claiming they support the linux revolution, didn't result in anyhting
but window drivers, so these $50 dollars are down the drain.
I did never experience any difficulties with any ISA internal modems
though.

..good luck

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Zip World (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                        09-Sep-99 22:53:07
  To: All                                               10-Sep-99 04:48:07
Subj: E.EXE

From: Felix Miata <[e-mail]>

Anyone know a way to make it stop appending ACSII 26 to the end of an
HTML file?
--
When pride comes, then comes disgrace, but with humility comes
wisdom.                Proverbs 11:2 NKJV

 Team OS/2

Felix Miata  ***  http://mrmazda.members.atlantic.net

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Webmasters, have you read: http://www.mcsr.olemis
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                10-Sep-99 03:24:22
  To: All                                               10-Sep-99 04:48:07
Subj: Re: Lost Mb's - where are they?

From: [e-mail]   (Baden Kudrenecky)

In <7r9p6v$vu3$[e-mail]>, [e-mail] (Max) writes:
>I run an 486 notebook with one HPFS-partition on a 540mb harddisk.
>When unzipping some files I observed some unusual disk activity which
>almost brought the system to a stillstand, I shut down and restarted.
>When back on, the free space decreased from 200mb to 68mb, chkdsk OS2
>reported 465mb in 13000 filez, Xtgold (DOS) reports 330mb in 11000
>files, however, both agree on 60mb free space. Where are these 130mb?
>
>        anybody with any clues - please....

   It may be in a SWAPPER.DAT file, or in a 'delete' directory.
What I use to find recently written drive space is the "Seek
and Find File" object, as it will display the files in reverse
date, and show their size.


baden

[e-mail]
http://baden.nu/
OS/2, Solaris & Linux

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: @Home Network Canada (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                    10-Sep-99 03:47:05
  To: All                                               10-Sep-99 04:48:07
Subj: Re: E.EXE

From: [e-mail] (Peter Moylan)

Felix Miata <[e-mail]> wrote:
>Anyone know a way to make it stop appending ACSII 26 to the end of an
>HTML file?

I'm pretty sure you can't.  Luckily there are plenty of other
editors around.

--
Peter Moylan                                         [e-mail]
See http://eepjm.newcastle.edu.au for OS/2 information and software

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The University of Newcastle (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                            10-Sep-99 07:46:18
  To: All                                               10-Sep-99 04:48:07
Subj: Re: Check Out  DCITU

From: "Esko Kauppinen" <[e-mail]>

On 8 Sep 1999 11:27:36 +1000, Khairil Yusof wrote:

>On Tue, 7 Sep 1999 17:24:51, [e-mail] (Dominique Pivard) wrote:
>
>>
>> > No problems here between my Olympus C-900 and my Compaq.
>> > What I noticed was that when using the 115200 transfer speed
>> > I easily get transfer errors if I use the computer at the same time.
>> > Attempt to use speeds above that doesn't work at all.
>>
>> Well, I'd be most happy if you could share your COM and DCITU settings
>> with me! The versions I have are 1.4i and 1.8beta, if that makes any
>> difference.
>
>Is it possible to increase the priority of this program? Is it command line?
You
>might want to try out SP (free) at hobbes.nmsu.edu for settting priorities or

>Priority Master (commercial - demo version available) and try running this
>program at time critical priority and see if the connection drops.

Yes, I just a moment ago noticed that on the preferences page there is
a option "use highest possible thread priority". I didn't have that checked
but
now i selected it and I'll see if it makes the transfer more stable.

But for the settings for DCITU I have nothing special. The only change I
made was to select the camera to Olympus, the com port to COM1 and
transfer speed to 115200.

I'm using the v1.8a of DCITU. At the moment I'm using the SIO drivers but
I used the standard com drivers also without problems.

Check that you have the DTR and RTS control modes enabled on the
serial line page (it is by default). All the other selection on that page
I have unselected.



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                10-Sep-99 07:57:19
  To: All                                               10-Sep-99 10:22:08
Subj: Re: Lost Mb's - where are they?

From: [e-mail] (Max)

[e-mail]   (Baden Kudrenecky) wrote:


>   It may be in a SWAPPER.DAT file, or in a 'delete' directory.
>What I use to find recently written drive space is the "Seek
>and Find File" object, as it will display the files in reverse
>date, and show their size.


>baden

>[e-mail]
>http://baden.nu/
>OS/2, Solaris & Linux

Thanks Baden, but this is more complex, I checked this first, swapfile
4mb and no undelete at all (Ihate that)..
                thanks anyway

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Zip World (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                      10-Sep-99 01:16:04
  To: All                                               10-Sep-99 10:22:08
Subj: Forwarding through multiple proxies

From: [e-mail]      (John Thompson)

I am trying to configure junkbuster to work through a second
proxy running on a different machine.  I have been using
junkbuster through localhost on port 8000 for quite some time,
but now need to access a second proxy on a different machine.  I
have tried using the "forward.ijb" file to specify the second
machine thus:

*       proxy.remote.com:9876        .       .

which, if I understand things properly, tells junkbuster to
forward all requests through the proxy running on
proxy.remote.com's port 9876.

Unfortunately, when I do this I can no longer access anything
outside my machine; requests time out and I get the Junkbuster
"no such domain" screen.

In Netscape's manual proxy configuration, if I replace junkbuster
running on localhost port 8000 with proxy.remote.com port 9876 I
can access other sites through the remote proxy, but then
junkbuster has been cut out of the loop.

I don't think I'm crazy in thinking that I should be able to add
another proxy; I used to run both junkbuster and WBI proxies on
localhpst and it worked fine through both.  But I can't make it
work with this remote proxy.

What am I doing wrong?

-John ([e-mail])

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                   10-Sep-99 07:54:13
  To: All                                               10-Sep-99 14:32:04
Subj: Re: Lost Mb's - where are they?

From: Dave Critelli <[e-mail]>

Well - if I had to throw a dart I'd say the unzip put a bunch of junk
somewhere on your system.  What was the file you were unzipping?

Max wrote:

> I run an 486 notebook with one HPFS-partition on a 540mb harddisk.
> When unzipping some files I observed some unusual disk activity which
> almost brought the system to a stillstand, I shut down and restarted.
> When back on, the free space decreased from 200mb to 68mb, chkdsk OS2
> reported 465mb in 13000 filez, Xtgold (DOS) reports 330mb in 11000
> files, however, both agree on 60mb free space. Where are these 130mb?
>
>                 anybody with any clues - please....

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Insulated Wire Inc. (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           10-Sep-99 08:00:24
  To: All                                               10-Sep-99 14:32:04
Subj: Re: IBM Anti Virus

From: Bob Germer <[e-mail]>

On <9ddCdfeFk555-pn2-SdMNbMs42God@localhost>, on 09/09/99 at 11:42 PM,
   [e-mail] (Frank Kirk) said:

> On Wed, 8 Sep 1999 10:35:02, Bob Germer <[e-mail]>
> wrote:

> > Hmm, I just went to their website. I AM sending a copy of this message to
> > [e-mail]. I wonder if THIS will garner a response

>     Don't hold your breath.  If you receive a response, it'll probably be a
> standard form letter;  "Thank you for your interest, blah, blah,  blah.

>     Someone recently put me on hold for a long time while I listened to
> recordings telling me "your call is important to us", shortly before I
> was disconnected.

Oh, I got the same treatment, but I was more persistent. I finally got
through to a live human being. Here in a nutshell is the gist of the
conversation:

One must buy the "Enterprise" CD which contains NAV for OS/2 as well as
for NT, Win95, Win98, DOS, MAC, and some others. Plus one must also buy
site licenses for a MINIMUM of 10 users. One can only buy those items from
a reseller. A reseller must contact a "Symantec Specialist" at Ingram to
get the part number and order the software and license. THEN, and ONLY
then will Symantec ship the product to Ingram which in turn will ship to
the reseller.

The 10 user license is a site license. There is no provision for the SOHO
market since "OS/2 is deployed only in large companies" according to a
management contact I finally made by calling the headquarters of Symantec.
Since I was so "upset" she offered to send me a complimentary copy. I told
her I would rather institute a class action lawsuit against Symantec, that
I have clients with 3,4,5 etc. workstations who want the product and are
unwilling to pay for software for computers they don't own, software for
operating systems they do not use, and for 3 or more times the number of
machines they own.

They only sell NAV for Windows and NT as "retail" packages. They sell for
$36 from Symantec but for under $30 from various retailers.

I then called Indelible Blue. They neglected to include OS/2 as one of the
various platforms supported by the Norton AntiVirus Solution CD which they
sell for $207. In addition, one must buy a minimum of 10 site licenses at
$39 each. Thus the SOHO or individual user must pay a MINIMUM of $597 plus
shipping for what Windoze users get for under $30.

Now I see two possible solutions here.

One, and the one I am leaning toward, is to file a breach of contract suit
against Symantec based upon the press releases issued at the time they
took over IBM's antivirus product. Possibly IBM would also have to be a
party defendant to the suit since otherwise Symantec could claim, in
defense, that IBM wanted them to eliminate the SOHO and individual user
after promising support, applications, etc. for OS/2 which induced us to
buy the OS in the first place.

It would not cost nearly the price of the CD and 10 licenses for an
individual to file a suit. If a dozen or so do it at the same time, the
suits would be combined into a class action on behalf of all purchasers of
OS/2.

Naming IBM as co-defendant would probably get IBM to force Symantec to
release individual copies of the software to end users rather than be
charged by Symantec as the instigator of the policy. It would bring IBM
"out of the closet" so to speak regarding its non-support of OS/2
purchasers. If Symantec has documents, etc. to prove that IBM deliberately
wanted to keep the software from end users and SOHO's it would put IBM at
risk of a second class action suit from both users and ISV's.

The second solution would be for a group of users, SOHO's, etc. to form a
non-profit corporation, pool our money, and buy one copy of the software
and the requisite licenses. This is afterall an "enterprise" CD with
server versions, etc. as well as workstation versions. I was informed that
the user licenses were not based on a physical site, but on the total
number of licenses an enterprise wanted for its total number of
workstations, servers, etc.  they wished to protect.

This would reduce the cost of each copy to around $75 per copy. The site
license is $39. The cost of copying the CD and shipping one each would
raise the end user price to $75 or so after adding the distributed cost of
forming a non-profit company, opening a bank account, etc.

I am sure that there might be a price break if someone wanted to buy say
500 or a thousand licenses. That could conceivably reduce the cost even
more.

I had a discussion with a representative of Indelible Blue regarding this
matter. This person told me that there have been many, many calls for
individual copies of the OS/2 product. I have a call into Buck Bohoc, the
owner of IB, and I will explore the matter with him, hopefully today.

IF enough people in the OS/2 community are interested in getting NAV and
willing to pay less than $80 per copy, I will explore the first option at
length with my company's lawyer. If this doesn't look promising, I will
refine idea 2. I personally would be willing to absorb the cost of 20 or
30 copies and setting up the non-profit enterprise based upon promises of
purchase. However, I am not willing to put out the cost for more than
that. Some sort of pre-payment or at least partial pre-payment would be
necessary for me to foot the entire up-front costs.

So, if anyone is really wanting NAV for Warp, please do 3 things:

1. Respond here. I am saving this thread to use as a hammer on Symantec.

2. Email me at [e-mail] (NOTE just clicking on a CC button to this
posting will not get to me. You must change the anti-spam automatic
address) so that I can be sure of getting your message.

3. Search your disks, etc. for any announcement material issued by IBM and
Symantec in the event we decide to file a class action.

And if you really want to help, cross-post this message to every OS/2
related and MAC workgroup. MAC users could also purchase from the
non-profit if we go that route.

Bob Germer

PS. Regarding the non-profit company. I would likely list its purpose as
to raise money for Jerry's Kids (The Muscular Disease Foundation) or some
similar eleemosynary organization. $1 of every "purchase" would be sent to
the charity.

--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: [e-mail]
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                           10-Sep-99 08:28:22
  To: All                                               10-Sep-99 14:32:04
Subj: Re: Lost Mb's - where are they?

From: Bob Germer <[e-mail]>

On <[e-mail]>, on 09/10/99 at 07:54 AM,
   Dave Critelli <[e-mail]> said:

> Well - if I had to throw a dart I'd say the unzip put a bunch of junk
> somewhere on your system.  What was the file you were unzipping?

> Max wrote:

> > I run an 486 notebook with one HPFS-partition on a 540mb harddisk.
> > When unzipping some files I observed some unusual disk activity which
> > almost brought the system to a stillstand, I shut down and restarted.
> > When back on, the free space decreased from 200mb to 68mb, chkdsk OS2
> > reported 465mb in 13000 filez, Xtgold (DOS) reports 330mb in 11000
> > files, however, both agree on 60mb free space. Where are these 130mb?
> >
> >                 anybody with any clues - please....

At the C:\ prompt in an OS/2 session issue the following command:

Dir *.* /s /a:h /p

The files are undoubtedly zip temporary files with the hidden attirbute
set.

Once you find the subdirectory where they are (and assuming there are no
hidden files you WANT there) issue:

cd (subdirectory)
attrib -rh *.*
Del  *.* (or whatever will delete these junk files without deleting
anything else you want there.)

I would suggest you check first the SET TEMP directory specified in your
config.sys.



--
-------------------------------------------------------------------------------
---------------
Bob Germer from Mount Holly, NJ - E-mail: [e-mail]
Proudly running OS/2 Warp 4.0 w/ FixPack 8
MR/2 Ice Registration Number 67
Aut Pax Aut Bellum
-------------------------------------------------------------------------------
---------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          10-Sep-99 14:49:02
  To: All                                               10-Sep-99 14:32:05
Subj: Re: E.EXE

From: Paul Ratcliffe <[e-mail]>

Peter Moylan wrote:
>
> Felix Miata <[e-mail]> wrote:
> >Anyone know a way to make it stop appending ACSII 26 to the end of an
> >HTML file?
>
> I'm pretty sure you can't.  Luckily there are plenty of other
> editors around.

I know I looked at patching it to do this. I can't remember whether I
succeeded or not now. Will look when I get home...

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: BBC Bristol (1:109/42)

+----------------------------------------------------------------------------+

From: nospam                                            10-Sep-99 14:05:20
  To: All                                               10-Sep-99 17:01:23
Subj: Re: NS/2 4.04 is driving me crazy!

From: glennth@<nospam>senet.com.au (Glenn Thompson)

On Wed, 8 Sep 1999 13:36:47, [e-mail] wrote:


-> In <L8W8d0hqkiHX-pn2-6cpvPbVJ1r4L@localhost>, on 09/08/99
-> The 4.61 betas have been giving me similar problems to the 4.04
-> version, but I am encouraged that they are paying attention to the
-> bug reports that I have been submitting. Perhaps they will
-> eventually get it right. When all a person wants or needs is just a
-> good, reliable browser, it is a real burden to have to put up with
-> all the other so-called "goodies" that come bundled with an
-> overblown product like Communicator. It is way too much of a good
-> thing for my purposes. I hope that in the final product there will
-> be a way to simply install the browser portion and ignore the rest
-> of the bloat.

   We can live in hope I guess :-)))))

   Glenn.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: none here ! (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          10-Sep-99 15:19:21
  To: All                                               10-Sep-99 17:01:23
Subj: Re: DOS/OS/2 question

From: [e-mail] (Annie K.)

On Thu, 9 Sep 1999 18:05:58, Jim Devenport <[e-mail]> wrote:

:I just inherited an older IBM slooooooooww laptop with OS/2, and this is
:my first exposure.  I'd really like to just disable OS/2 and have the
:laptop default to DOS when booting, but can find nothing of the sort to
:modify in autoexec.bat  .
:Any quik 'n dirty ideas on how to accomplish this?

 Format the hard drive and install your favorite DOS.

--
Anthropomorphic Hamburger

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Team OS/2 (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                          10-Sep-99 15:12:22
  To: All                                               10-Sep-99 17:01:24
Subj: Re: DOS/OS/2 question

From: [e-mail] (Andrew Stephenson)

In article <[e-mail]>
       [e-mail] "Jim Devenport" writes:

> I just inherited an older IBM slooooooooww laptop with OS/2, and this is
> my first exposure.  I'd really like to just disable OS/2 and have the
> laptop default to DOS when booting, but can find nothing of the sort to
> modify in autoexec.bat  .
> Any quik 'n dirty ideas on how to accomplish this?

Would a "quik 'n clean" idea be equally acceptable? <g>

On the principle, "if you don't need it, don't install it," you
could try plain old real DOS.  OS/2's Virtual DOS is excellent
and serves me well, complete to the point of implementing all the
undocumented calls I have tried.  One of the best real DOSes was
DR-DOS (later Novell DOS), used by me until my switch to Warp 3.
This is said to be available and very much alive, in an evolved
form, but I have lost track of who now owns/supplies it.

If you ever needed to use OS/2, you could _easily_ install it and
use VDOS (keeping the real DOS stuff handy in its own directory).

However the instant benefits of running OS/2's VDOS include HPFS,
multi-tasking, greater free RAM for the DOS apps, the ability to
run OS/2 and W-3.1 apps and exchange data with them via Clipboard
-- and other goodies which escape me.  You could also gradually
transfer to OS/2 apps, as circumstances allow or dictate.  And if
you already own OS/2, you already own its VDOS.
--
Andrew Stephenson

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DNS (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                10-Sep-99 14:58:04
  To: All                                               10-Sep-99 17:01:24
Subj: Re: Lost Mb's - where are they?

From: [e-mail] (Max)

Bob Germer <[e-mail]> wrote:

>On <[e-mail]>, on 09/10/99 at 07:54 AM,
>   Dave Critelli <[e-mail]> said:

>> Well - if I had to throw a dart I'd say the unzip put a bunch of junk
>> somewhere on your system.  What was the file you were unzipping?



>Dir *.* /s /a:h /p

>The files are undoubtedly zip temporary files with the hidden attirbute
>set.

>Once you find the subdirectory where they are (and assuming there are no
>hidden files you WANT there) issue:

>cd (subdirectory)
>attrib -rh *.*
>Del  *.* (or whatever will delete these junk files without deleting
>anything else you want there.)

>I would suggest you check first the SET TEMP directory specified in your
>config.sys.

Thanks guys, I tried that, but no avail.
The files I unzipped where some small c-samples, which i transferred
from cd via floppy.
I must say that the floppy was corrupt, but I do not suspect a virus,
the disk activity happened during the unzip action. The files came
from a reputeable magazine and where some kilobyte in size.
Please keep in mind that i alos checked the disk via Xtgold, which
reports hidden and system-files, but reported ca 2000 files less than
the os2 chkdsk.
I still have no idea, the space is still unaccounted for...

            thanks : max




--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Zip World (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                10-Sep-99 15:01:21
  To: All                                               10-Sep-99 17:01:24
Subj: Re: Linux is doomed...

From: [e-mail] (Max)

Matthew Barratt <[e-mail]> wrote:

>Jaime A. Cruz, Jr. wrote:
>> IBM is fully committed to the Linux platform, as it is to SOM, OpenDoc,
>> Open32, OS/2, PowerPC, WorkPlace OS, the Mach kernel, ad nauseum...
>>
>> </SARCASM>
>>
>> Jaime A. Cruz, Jr.

>PowerPC alive and well in embedded systems/VME market. Outdoes Intel on
>size&power per unit performnce. Nice and quick too...

The point is, IBM is 'committed' to linux. If it does that the same
way as it did to os2, cyrix and lotus, Linux is doomed for sure  :]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Zip World (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                              10-Sep-99 15:34:27
  To: All                                               10-Sep-99 17:01:24
Subj: Re: E.EXE

From: [e-mail] (DG)

In message <[e-mail]> -
[e-mail] (Peter Moylan) writes:

 <=Luckily there are plenty of other editors...=>


   ...such as SmallEditor, Boxer and Kon, all shareware...
plus Mr Edit [prog name change?] and also the "WebWriter"
HTML editor, which are both offered now as freeware. All 5
editors will allow writing of an HTML text file w/o the
end-of-file marker.
   There are still more OS/2 text and HTML editors that
probably will do the same, either for free or low-cost.

DG





--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: DG (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                         10-Sep-99 16:52:09
  To: All                                               10-Sep-99 17:01:24
Subj: RealAudio Problem

From: [e-mail] (Martin Racette)

Hi guys,

I've got a really weird problem with
RealAudio, I can play local files
correctly, but as soon as it has to go
to the Internet for the data, my entire
computer locks upnad I have to do a
RESET to make the system work again.

It was working about a month ago
perfectly well, and a couple of days ago
I tried it again and the problem
started, I tried to re-install it
several times to no avail

My system is P-II Celeron 400Mhz with
128Mb RAM, Warp 4 FP11

BTW. don't tell me that its FP11,
because it was working OK shortly after
I installed FP11

//-------------------------
Thank you in advance

Merci a l'avance

Martin

http://205.237.57.73/

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                    10-Sep-99 08:27:11
  To: All                                               10-Sep-99 17:01:24
Subj: Re: the future of os/2

From: [e-mail] (James Knott)

In article <[e-mail]>,
[e-mail] (Ahmad Jawed Hirobumi Atif) wrote:
>
>In article <[e-mail]>,
>[e-mail] (James Knott) wrote:
>
>> On Fri, 03 Sep 1999 13:08:36 +0100, Martin Lafaix wrote:
>>
>> > (and heating too, as
>> > computers are not the most effective heating devices :-).]
>>
>> Actually, they're quite effective. Every bit of electricity that
>> enters the computer, is eventually converted to heat, one way or
>> another.
>
>I don't have data to refute what you are saying, however, I think that at
>least monitors are not heat efficient, because some energy is dissipated
>in electromagnetic field such as light.

And what happens to that light?  Eventually, it will be absorbed by
something, somewhere and be converted to heat.  Since most computers
are used inside, that light will be absorbed by the walls, contents,
etc.  All energy eventually degrades to heat.

--
E-mail [e-mail]
_________________________________________________________________________
The above opinions are my own and not those of ISM Corp., a subsidiary of
IBM Canada Ltd.

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                     10-Sep-99 13:05:07
  To: All                                               10-Sep-99 17:01:24
Subj: GLBSSTUB & Winos2???

From: [e-mail] (ALDEL)

I cannot get a Dialer loaded to Winos2 (Warp4)
I get this error msg. no matter which one I try.

< Application Error>
GLBSSTUB caused a General Protection Fault
in module  ~GLC0005.TMP at
0002:B3ED.
Choose OK. GLBSSTUB will close..

Everything else in Winos2 work ok,
but I need the dialer. ;-(

TIA
Albert, Wa3fib.



--
-----------------------------------------------------------
[e-mail] (ALDEL)
-----------------------------------------------------------

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                10-Sep-99 12:33:18
  To: All                                               10-Sep-99 17:01:24
Subj: Re: Lost Mb's - where are they?

From: [e-mail]

XTree: Use the Branch fuction, then sort by date or size to see the new
ones.


>Thanks guys, I tried that, but no avail.
>The files I unzipped where some small c-samples, which i transferred from
>cd via floppy.
>I must say that the floppy was corrupt, but I do not suspect a virus, the
>disk activity happened during the unzip action. The files came from a
>reputeable magazine and where some kilobyte in size. Please keep in mind
>that i alos checked the disk via Xtgold, which reports hidden and
>system-files, but reported ca 2000 files less than the os2 chkdsk.
>I still have no idea, the space is still unaccounted for...

>            thanks : max
>



_____________
Ed Letourneau <[e-mail]>

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Origin Line 1 Goes Here (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                10-Sep-99 14:09:15
  To: All                                               10-Sep-99 17:01:24
Subj: Re: IBM Anti Virus

From: Sushenjit Bandyopadhyay <[e-mail]>

I don't need a retail copy of NAV for OS/2.  I got mine when I called
Symantec and told them I have IBM AV and I want to upgrade to NAV for
OS/2.  They sent it free and didn't ask for any proof.

Now it seems they are charging some $9.95.  It seems odd that they
would upgrade single licence but not sell them.

In principle I agree that (a threat of) a class action suit may help
move that matter along.

Sushenjit

>>>>>>>>>>>>>>>>>> Original Message <<<<<<<<<<<<<<<<<<

On 9-10-99, 12:00:49 PM, Bob Germer <[e-mail]> wrote
regarding Re: IBM Anti Virus:


> On <9ddCdfeFk555-pn2-SdMNbMs42God@localhost>, on 09/09/99 at 11:42 PM,
>    [e-mail] (Frank Kirk) said:

> > On Wed, 8 Sep 1999 10:35:02, Bob Germer <[e-mail]>
> > wrote:

> > > Hmm, I just went to their website. I AM sending a copy of this message
to
> > > [e-mail]. I wonder if THIS will garner a response

> >     Don't hold your breath.  If you receive a response, it'll probably
be a
> > standard form letter;  "Thank you for your interest, blah, blah,
blah.

> >     Someone recently put me on hold for a long time while I listened
to
> > recordings telling me "your call is important to us", shortly before I
> > was disconnected.

> Oh, I got the same treatment, but I was more persistent. I finally got
> through to a live human being. Here in a nutshell is the gist of the
> conversation:

> One must buy the "Enterprise" CD which contains NAV for OS/2 as well
as
> for NT, Win95, Win98, DOS, MAC, and some others. Plus one must also
buy
> site licenses for a MINIMUM of 10 users. One can only buy those items
from
> a reseller. A reseller must contact a "Symantec Specialist" at Ingram
to
> get the part number and order the software and license. THEN, and ONLY
> then will Symantec ship the product to Ingram which in turn will ship
to
> the reseller.

> The 10 user license is a site license. There is no provision for the
SOHO
> market since "OS/2 is deployed only in large companies" according to a
> management contact I finally made by calling the headquarters of
Symantec.
> Since I was so "upset" she offered to send me a complimentary copy. I
told
> her I would rather institute a class action lawsuit against Symantec,
that
> I have clients with 3,4,5 etc. workstations who want the product and
are
> unwilling to pay for software for computers they don't own, software
for
> operating systems they do not use, and for 3 or more times the number
of
> machines they own.

> They only sell NAV for Windows and NT as "retail" packages. They sell
for
> $36 from Symantec but for under $30 from various retailers.

> I then called Indelible Blue. They neglected to include OS/2 as one of
the
> various platforms supported by the Norton AntiVirus Solution CD which
they
> sell for $207. In addition, one must buy a minimum of 10 site licenses
at
> $39 each. Thus the SOHO or individual user must pay a MINIMUM of $597
plus
> shipping for what Windoze users get for under $30.

> Now I see two possible solutions here.

> One, and the one I am leaning toward, is to file a breach of contract
suit
> against Symantec based upon the press releases issued at the time they
> took over IBM's antivirus product. Possibly IBM would also have to be
a
> party defendant to the suit since otherwise Symantec could claim, in
> defense, that IBM wanted them to eliminate the SOHO and individual
user
> after promising support, applications, etc. for OS/2 which induced us
to
> buy the OS in the first place.

> It would not cost nearly the price of the CD and 10 licenses for an
> individual to file a suit. If a dozen or so do it at the same time,
the
> suits would be combined into a class action on behalf of all
purchasers of
> OS/2.

> Naming IBM as co-defendant would probably get IBM to force Symantec to
> release individual copies of the software to end users rather than be
> charged by Symantec as the instigator of the policy. It would bring
IBM
> "out of the closet" so to speak regarding its non-support of OS/2
> purchasers. If Symantec has documents, etc. to prove that IBM
deliberately
> wanted to keep the software from end users and SOHO's it would put IBM
at
> risk of a second class action suit from both users and ISV's.

> The second solution would be for a group of users, SOHO's, etc. to
form a
> non-profit corporation, pool our money, and buy one copy of the
software
> and the requisite licenses. This is afterall an "enterprise" CD with
> server versions, etc. as well as workstation versions. I was informed
that
> the user licenses were not based on a physical site, but on the total
> number of licenses an enterprise wanted for its total number of
> workstations, servers, etc.  they wished to protect.

> This would reduce the cost of each copy to around $75 per copy. The
site
> license is $39. The cost of copying the CD and shipping one each would
> raise the end user price to $75 or so after adding the distributed
cost of
> forming a non-profit company, opening a bank account, etc.

> I am sure that there might be a price break if someone wanted to buy
say
> 500 or a thousand licenses. That could conceivably reduce the cost
even
> more.

> I had a discussion with a representative of Indelible Blue regarding
this
> matter. This person told me that there have been many, many calls for
> individual copies of the OS/2 product. I have a call into Buck Bohoc,
the
> owner of IB, and I will explore the matter with him, hopefully today.

> IF enough people in the OS/2 community are interested in getting NAV
and
> willing to pay less than $80 per copy, I will explore the first option
at
> length with my company's lawyer. If this doesn't look promising, I
will
> refine idea 2. I personally would be willing to absorb the cost of 20
or
> 30 copies and setting up the non-profit enterprise based upon promises
of
> purchase. However, I am not willing to put out the cost for more than
> that. Some sort of pre-payment or at least partial pre-payment would
be
> necessary for me to foot the entire up-front costs.

> So, if anyone is really wanting NAV for Warp, please do 3 things:

> 1. Respond here. I am saving this thread to use as a hammer on
Symantec.

> 2. Email me at [e-mail] (NOTE just clicking on a CC button to
this
> posting will not get to me. You must change the anti-spam automatic
> address) so that I can be sure of getting your message.

> 3. Search your disks, etc. for any announcement material issued by IBM
and
> Symantec in the event we decide to file a class action.

> And if you really want to help, cross-post this message to every OS/2
> related and MAC workgroup. MAC users could also purchase from the
> non-profit if we go that route.

> Bob Germer

> PS. Regarding the non-profit company. I would likely list its purpose
as
> to raise money for Jerry's Kids (The Muscular Disease Foundation) or
some
> similar eleemosynary organization. $1 of every "purchase" would be
sent to
> the charity.

> --
>
-----------------------------------------------------------------------
-----------------------
> Bob Germer from Mount Holly, NJ - E-mail: [e-mail]
> Proudly running OS/2 Warp 4.0 w/ FixPack 8
> MR/2 Ice Registration Number 67
> Aut Pax Aut Bellum
>
-----------------------------------------------------------------------
-----------------------



--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: University of Maryland College Park (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                             10-Sep-99 12:28:18
  To: All                                               10-Sep-99 19:59:23
Subj: DATMAN software under os/2?

From: elmar schmeisser <[e-mail]>

Assembled gurus:

Corresponding with Kan Yabumoto of Pixelab, Inc.
(http://www.datman.com), he writes:

"We heard a year or so ago that some OS/2 experts succeeded in running
DATMAN-DOS under OS/2.  But, we do not have details.."

Deja-news does not catalog any such occasion.  The relevent item seems
to be that DATMAN-DOS uses a real mode driver for aspi :

"That is, DATMAN-DOS is a TSR which behaves very much like MSCDEX.EXE
both of which are "Network Redirector" in order to assign a drive letter
to the system and all file I/O API goes through the pretty much
"undocumented" INT 2FH."

Does anyone have any imformation on this?

thanks
--
p.s. this server gets only about 30% of the news posts.  E-mail in
parallel to
[e-mail] would be greatly appreciated.

- elmar
--

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: warped with os/2 (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                                10-Sep-99 14:48:26
  To: All                                               10-Sep-99 19:59:23
Subj: Re: GLBSSTUB & Winos2???

From: Dale Erwin <[e-mail]>

ALDEL wrote:
>
> I cannot get a Dialer loaded to Winos2 (Warp4)
> I get this error msg. no matter which one I try.
>
> < Application Error>
> GLBSSTUB caused a General Protection Fault
> in module  ~GLC0005.TMP at
> 0002:B3ED.
> Choose OK. GLBSSTUB will close..
>
> Everything else in Winos2 work ok,
> but I need the dialer. ;-(
>
> TIA
> Albert, Wa3fib.
>
> --
> -----------------------------------------------------------
> [e-mail] (ALDEL)
> -----------------------------------------------------------

I get the same thing when I try to load NoteWorthy Composer.
But it has always done that.
--
Dale Erwin
3624 Coral Gables Drive
Dallas, Texas 75229-2619
[phone]

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Erwin Technology Corporation (1:109/42)

+----------------------------------------------------------------------------+

From: [e-mail]                 10-Sep-99 15:14:12
  To: All                                               10-Sep-99 19:59:23
Subj: Re: GLBSSTUB & Winos2???

From: [e-mail] (Raphael Tennenbaum)

[e-mail] (ALDEL) wrote:

>I cannot get a Dialer loaded to Winos2 (Warp4)
>I get this error msg. no matter which one I try.
>
>< Application Error>
>GLBSSTUB caused a General Protection Fault
>in module  ~GLC0005.TMP at
>0002:B3ED.
>Choose OK. GLBSSTUB will close..
>
>Everything else in Winos2 work ok,
>but I need the dialer. ;-(
>
>TIA
>Albert, Wa3fib.

You probably have your reasons for needing the dialer, but
usually Winos2 comm programs work fine once OS/2 has
established the connection, so your best bet would be to see
if you could use slippm.exe and then launch whatever else
needs it.

Anyway, you don't say if you've tried anything to make it
work.  One of the first places to start tweaking is the
WinOS2 properties page: right-mouse-button click on the icon
of the program, click on the "Session" tab, and press the
WIN-OS/2 Properties button.  You may as well leave the radio
button for "All DOS and WIn-OS/2 settings" selected before
you click on OK.

As you'll see, there are many, many things you can try.
COM_DIRECT_ACCESS set to "On" might be one; there are three
other COM ones as well.  The problem you're having could be
a result of any number of other seemingly unrelated things
(might do to explain a little further just what happens when
you try dialing):  things like mouse button behavior, video
redrawing, memory management, session priority -- any of
these might (or might not) be causing the problem.

Let us know how things go; if nothing works try again.


--
Ray Tennenbaum        '99 YZF-R6
readme@ http://www.ray-field.com

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: AT&T WorldNet Services (1:109/42)

+----------------------------------------------------------------------------+

From: doug.bissett"at"ibm.net                           10-Sep-99 20:28:29
  To: All                                               10-Sep-99 19:59:23
Subj: Re: IBM Anti Virus

From: doug.bissett"at"ibm.net (Doug Bissett)

On Fri, 10 Sep 1999 12:00:49, Bob Germer <[e-mail]>
wrote:

> The second solution would be for a group of users, SOHO's, etc. to form a
> non-profit corporation, pool our money, and buy one copy of the software
> and the requisite licenses. This is afterall an "enterprise" CD with
> server versions, etc. as well as workstation versions. I was informed that
> the user licenses were not based on a physical site, but on the total
> number of licenses an enterprise wanted for its total number of
> workstations, servers, etc.  they wished to protect.
>
> This would reduce the cost of each copy to around $75 per copy. The site
> license is $39. The cost of copying the CD and shipping one each would
> raise the end user price to $75 or so after adding the distributed cost of
> forming a non-profit company, opening a bank account, etc.
>

I support whatever you think is best.

I am beginning to think that *WE*, the OS/2 user's, could be an
"ENTERPRISE". If we ALL pool our dollars (invest $80 in the
"company"), we could buy a single copy, with a few thousand licences
(should be even cheaper than $80). All that would be required, is to
set up a site with the original disk, available on a FTP server
(password protected, so you need to pay your bucks to become a part of
the "enterprise"). I suspect that there would be some legal thing to
prevent that, but it might be worth investigating. Perhaps BMT micro,
or IB would take that on (IB already sells site licenses etc.). After
all, even IBM wouldn't buy more than one copy of the CD (well, they
might, but they shouldn't), and would just make it available on their
intranet for all who need it.

It might also be possible to do the same thing with OS/2 itself, after
all, IBM is only interested in selling, and supporting, large
"enterprises", and a few thousand user's would be as big as any
"enterprise". (A COMMON share, gets you access to NAV, a PREFERED
share gets you access to OS/2, or something like that). All you would
need is a set of install disks that would get you connected to the
internet, and do a CID install of OS/2.

I am sure that the technical details can be worked out (the legal
details might be more difficult). There are a LOT of very knowledgable
people in the OS/2 community. (Then again, why limit this to just the
OS/2 community, the more site licences we can get, the lower the cost
should be, and the software is already on the CD).

A great name for the company, would be "The Starship Enterprise", but
I am sure that there would be legal problems with that <g>.

Perhaps. we can use IBM's, and Symantec's, lack of cooperation to nail
them to the wall <g>...
******************************
From the PC of Doug Bissett
doug.bissett at ibm.net
The " at " must be changed to "@"
******************************

--- WtrGate+ v0.93.p7 sn 165
 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne
(1:109/42)

+----------------------------------------------------------------------------+

+============================================================================+