home
***
CD-ROM
|
disk
|
FTP
|
other
***
search
/
DP Tool Club 12
/
CD_ASCQ_12_0294.iso
/
vrac
/
jwptags4.zip
/
TAGLINES.TXT
< prev
Wrap
Text File
|
1994-02-07
|
566KB
|
12,077 lines
I'm grinning from <'ere to 'ere>
(a short musical interlude)
I can see clearly now, the brain is gone...
Brave Sir Robin ran away...
Chipmunks roasting on an open fire...
Deck us all with Boston Charlie...
Have you stole your tagline today?
Hmmm mmmm, Hmmm mmm < Can't remember the words
Later on we'll perspire as we sit by the fire
oo e oo ah ah, ting tang, walla walla bing bang
Put on your red shoes and we'll dance the blues...
The Weather Outside is Frightful....but the fire..
Walla Walla Wash and Kalamazoo...
Welcome to my shop, let me cut your mop, DAAAIN-tily
That's the sound of the men..workin on the tag..line
( ( (INTELLIGENCE CAPTIONED FOR THE BRAIN IMPAIRED) ) )
-Chat Mode- SYSOP Here, You have 30 seconds!
:-( ) you backed your car over my toe
» » » » » Bo knows Taglines! « « « « «
!!!teG I sdrawkcaB eroM ehT oG I sdrawroF eroM ehT
!enif tsuj si gnihtyrevE
!noitacidem deen uoy ,egassem siht daer nac uoy fI
!Wh!o wa!lked ac!ross my! t!agline! w!ith mu!dd!y !feet?!
"!" banged she.
"...and then the fun began" - N. Bonaparte
"640K ought to be enough for anybody." - Bill Gates, 1981
"A day without okra is like a day without broccoli." Bush
"A Keyboard. How Quaint": Spock
"A-Chat Magazine": R.I.P.?
"Alaskan Visuals" by A. Roaring Boring Alice
"All art is but imitation of nature." - Seneca.
"All's fair in love and war" - What a contemptible lie!
"Apple" (c) Copyright 1767, Sir Isaac Newton.
"Are you crazy?" "It's a possibility I haven't ruled out.
"Are you pondering what I'm pondering?": Brain
"Arthur, you're safe!" "Am I? Oh good."
"Ask not for whom the bell tolls--" - M. Ali
"Bats are birds in birdless lands." ■ Japanese Proverb
"Beam me aboard, Scotty!" "A 2x4, sir??"
"Beautiful story. Kinda gets you right HERE!" -- Q
"Besides, it is clearly a bunny rabbit!" -- Data
"Better to ask twice than lose your way once." ■ Danish proverb
"Bother," said Pooh as the moderator swung his club.
"Build a watch in 56,179 easy steps" by C. Forsberg.
"C.I.A." -- A contradiction in terms most of the time.
"Can't we all just get along?" - G.A. Custer
"Captain, we're out of Earl Gray." "Bridge, course 180!"
"Captain, why not just give the Borg Windows 3.1?" ■ Worf
"Cashew?" "Gesundheit!"
"Chocolate is a serious thing!" - Counselor Troi
"Close the door, I'm dressing!" - Mayonnaise
"Common sense" is an oxymoron.
"Counselor's Log, StarDate 45623.6. My mother is on board.
"Curiouser and curiouser!" cried Alice.
"Cut life support to all quarters with children." -Picard
"Daddy, what does FORMATTING DRIVE C mean?"
"Damn it, Jim, I'm a doctor, not a tagline." -- McCoy
"Damn, I dropped the toothpaste," she said, crestfallen
"Dash for the Bathroom" by Willy Makit, illus. Betty Wont
"Data does it in serial..." --Tasha Yar
"Death is Irrelevant." ■ Borg
"DEL *.*" = 100% comp.
"Dig the well before you are thirsty." ■ Chinese Proverb
"Do you know any Klingon opera?" - Worf
"Don't bury corpses in the snow." ■ Chinese Proverb
"Don't lose your head over me". Lord High Executioner
"Don't mince words... what do you *REALLY* think?"
"Don't Panic" is the first helpful thing said all day.
"Drop the guy with the devil ears." -- NBC, June, 1965.
"Dust bunnies threaten thousand points of light" -G. Bush
"Dyslexic Christian sells soul to Santa" ...News at 11
"Electric Prunes" -- what a powerful combination!
"Energize!" said Picard, and the pink bunny appeared...
"Engage, Mr. Crusher!" (Wesley lunges for Deanna.)
"ET Phone Home" "Deposit 20,000 quarters, please."
"Evolution," they said to themselves, "who needs it?"
"Experience comes from bad judgment." - Mark Twain.
"Extra pickles. A warrior's condiment!" --Worf
"Fall seven times, stand up eight." ■ Japanese Proverb
"Flowers! Is there a 'John Luck Pikkerd' here?"
"FORD": Fixed Or Repaired Daily.
"France. We come from France." The Coneheads
"Future Perfect" was abandoned when found not to be.
"God is subtle but he is not malicious" - A. Einstein
"Ground Beef" -- A Cow With No Legs!
"HA!" he added demoniacally, for good measure.
"Happiness is a warm puppy." said the anaconda.
"Have a nice day!" "No thanks, I have other plans."
"Have a nice day!" "No thanks, I have to work."
"Hello," lied the politician.
"Here taggy taggy, here nice little tagline"...SPLAT!!!
"Hex Dump" - Where Witches put used Curses?
"Hey, I've got an idea!" "Beginners' luck!"
"Hi!" to Wonko if he's watching.
"Hi, Eena."...."Lo, Bo." Just canine chit-achat.
"Hi, I'm a tagline virus. Please copy me!"
"His ears were caught in a mechanical rice picker" -Kirk
"Honey?" is that what you call this bee barf?
"How to Boil Water, in 500 easy steps" by Chuck Forsberg.
"How to Budget Your Money" by I. R. Ess
"How to Catch Worms" by Earl E. Bird
"I am the 2nd greatest computer in the universe."
"I came for a week and got stuck for 15 years."
"I design coastlines. I got an award for Norway."
"I did it. I killed them all." Timothy
"I don't bite. Well, that's wrong. I do bite."
"I drank WHAT!?" - Socrates
"I feel good!" - James Brown
"I hate quotations!" - Ralph Waldo Emerson
"I hates meeces to pieces" - Mr. Jinx
"I have a thousand glaciers ready to roll over Africa."
"I see," said the blind man, as he aimed his gun.
"I speak of the computer that is to come after me."
"I think not," said Descartes; and promptly disappeared.
"I'll be Bach." - Johann Sebastian Schwarzenegger
"I'll trim the shrubs sometime", he hedged.
"I'm Beverly." "I'm Geordi." "We are Hugh."
"I'm game," he said, "we'll see who rusts first."
"I'm standing! And I can't fall down!"
"I've risen and I can't get down!" -Jesus at the disco
"If he catches you, you're through" - Road Runner.
"If the shoe fits, buy it." - Imelda Marcos
"If you can't make it good, make it LOOK good." - B Gates
"If you prick me, do I not... Leak?" -- Data
"Is that funny? Is that a joke?" --Data
"Is that lemon in your tea?" "No, s'lime."
"Is there a Lawyer in the House?" BLAM! "Any more?"
"Isn't everybody happy?" - Machiavelli
"It does SO look like you!" - Picasso
"It" has fallen, and "it" won't get up.
"It's bigger than both of us," said the schizophrenic.
"It's comin' apart, Lad!" - Scotty
"Lawrence Welk In China", By Anna Wong, Anna Tieu
"Let me sweeten the deal a bit for you," - Beelzebub.
"Let Us Open Our Checkbooks and Pray..." -J. Swaggart
"Let's string him up!" "No! Use rope, it's stronger!"
"Let's win this one and go home." - George A. Custer
"Life," he said, "Don't talk to ME about life!".
"Look at all the &*!@(^# Indians!" - General Custer
"Look at this phone bill! It's stamped 'Pay Now or Die'!"
"Luke, your mother am I." - Yoda
"Make love not war" people probably flunked both.
"Maytag" is my middle name -- I'm an agitator.
"Milhouse, we live in the age of cooties!" -Bart Simpson
"Modem," said the gardener when he'd finished the lawn..
"Moms and reason are like oil and water" - Calvin
"Monopoly? No, we just don't want competition" --Intel
"Mostly I prefer it put to bebop", she said jazzily.
"Mr. Worf, fire phasers at @TOFIRST@" ... Zzzzzap!
"My 2 cents" is now worth $1.24 due to inflation.
"My brain is my second favorite organ." - Woody Allen
"My favorite part of dinner!"- Riker
"Myself, I'd trust him to the end of the Earth."
"NEWS FLASH":= America Elects Clinton and Gets GORED!!!!!
"Nietzsche is dead," God.
"No light," said Arthur Dent. "Dark, no light."
"No! I meant a BUD LIGHT!" - David Koresh
"No, I meant BUD Light!" - Captain of the Hindenburg
"Noah! How long can you tread water?" - God
"None of the Above" for President.
"Off with her head!" shouted the Queen.
"Once," adverb: Enough.
"One cloud feels lonely." ■ Rabbit Proverb
"Oops, I dropped the toothpaste," she said, crestfallen
"Peck...Peck...Peck...BOOM!!" - Chicken in a minefield.
"Please Captain, not in front of the Klingons" - Spock
"Ploys-R-Us" -- a department of the CIA.
"Politically Correct" is a contradiction in terms.
"Politically Correct," the perfect oxymoron.
"Press to test." <click> "Release to detonate."
"Read my Lips! No Nude Texans!" - What Bush REALLY said!
"RESISTANCE IS FUTILE...." The Borg
"Scotty. hurry. beam me uragg^*·■£" NO CARRIER.
"Serfs Up!" - Mikhail Gorbachev
"Set phasers to Shake and Bake": Kirk
"Share and enjoy" Sirius Cybernetics Corp Complaints Div
"She turned me into a Borg." "A Borg?" "Well, I got better."
"Skeptics are never deceived." ■ French Proverb
"Space is big, REALLY big." Hitchiker's Guide
"Spock! I thought you were dead!" "I rebooted."
"State Of The Art" is technospeak for "unproven".
"Stress" What you get from owning a computer!
"Stressed" is just desserts spelled backwards.
"Supernatural" is a null word.
"Take me, you wonderful brute!" - Tammy TagLine
"That was the stun setting." <bleep> "This is not."
"That's entertainment," - Vlad the Impaler.
"The above Statement is absolutely True." --God
"The voice of reason may be an alto." --Dick Eney
"There's Lies, Damn Lies, and Statistics!" - Mark Twain
"They turned me into a Borg." "A Borg?" "Well, I got better."
"Tis but a scratch!" "A scratch?!?!?! Your arm's off!"
"Too much of good thing is WONDERFUL!" - Mae West
"Tourist Season" : When it's OK to shoot them.
"Tricks are for bids." - Malcolm Pimpster.
"Troi, are you reading my mind?" "Yes I am!" (Slap!)
"Trust in Allah, but tie your camel." ■ Arab proverb
"Two can live as cheaply as one!" is a LIE! <g>
"Waddja expect? Another pretty face?" - Frankenstein
"We have met the enemy and he is us..." Pogo
"We have met the enemy and they are ours." O H Perry
"We must laugh at man, to avoid crying for him" Napoleon
"We Still Live!" - John Carter
"We're on a mission from God." - Blues Brothers
"Wesley!" "Yes Sir?" "Get OFF my bridge!"
"What is your favorite color?" "Blue - no - yel-aaaiii!"
"What's new?" "Most of my wife..."
"What's on the Telly?" "It looks like a penguin."
"When you win, nothing hurts." -- Joe Namath
"Where do these stairs go?" "They go up."
"Who cares for you? You're but a deck of cards," -Alice.
"Wise folk grow their own herbs," said Tom, sagely.
"Won't talk hey?!? OK Bugsy, BREAK the Modem!!"
"Worf! Still struggling up the evolutionary ladder?" - Q
"Write injuries in sand, kindness in marble." ■ French Proverb
"Yo' got mo' chance of teachin' a mule to sing Op'ry" - Pogo
"You are who you know." ■ Street Proverb
"Your move" - Colossus
######## IN STEREO WHERE AVAILABLE ########
########### <------Scratch off to reveal your prize.
#:-) <:≈≈≈≈≈≈≈ - Snake stalking person.
#@!?> NO CARRIER...
#define flame_retardant I know you are, but what am I?
#define while(x) if(x)
#include <mandatory_cute_tagline>
$$ doesn't buy happiness, if you don't know where to shop
$$$ not found: A)bort, R)efinance, D)eclare bankruptcy.
$1000 reward for finding this man:
'Cuse me for butting in, but I'm interrupt driven.
'e's not pinin'. 'e's bleedin' dead!!
'tis an ill wind that blows no minds.
'Tis but a flesh wound...
'tis only a fleshwound!
'\∙o·,■°∙.┌:"/∙°v■ «───── Tagline debris.
( ( (((In Stereo Where Available))) ) )
(((((((HYPNOTIC))))))((((((TAGLINE))))))
(((((YOU)))))((((ARE))))(((((FEELING)))))(((((SLEEPY)))))
((wrong && wrong) != right)
(.) <-- Grain of Salt, take as needed with above advice.
(A)bort (F)ail (R)etry (I)gnore (S)ell (G)iveaway
(A)bort (R)etry (G)et a gun and kill it.
(A)bort (R)etry (I)nfluence with large hammer
(A)bort (R)etry (T)ake an axe to it
(A)bort, (F)ail, (T)oss computer across room
(A)bort, (R)etry, (A)sk 12 Year Old?
(A)bort, (R)etry, (B)lat...
(A)bort, (R)etry, (C)all Yoda?
(A)bort, (R)etry, (D)amn Torpedos. Full Speed Ahead?
(A)bort, (R)etry, (D)etonate?
(A)bort, (R)etry, (D)ispense cyanide tablet?
(A)bort, (R)etry, (F)ail, (G)rab_Hammer
(A)bort, (R)etry, (F)ail, or (P)anic.....PPPPPPPPPPPPPPPP
(A)bort, (R)etry, (F)ake power surge?
(A)bort, (R)etry, (F)ill out unemployment application?
(A)bort, (R)etry, (F)ind someone to blame?
(A)bort, (R)etry, (G)et a beer?
(A)bort, (R)etry, (G)et second opinion?
(A)bort, (R)etry, (G)ive up?
(A)bort, (R)etry, (I)gnore, (K)ick system
(A)bort, (R)etry, (I)gnore, (O)verthrow System?
(A)bort, (R)etry, (I)gnore, (S)orry I Asked!
(A)bort, (R)etry, (I)nduce heart attack?
(A)bort, (R)etry, (K)ick the mutha!@#%?
(A)bort, (R)etry, (K)ill something?
(A)bort, (R)etry, (L)oad virus now?
(A)bort, (R)etry, (P)anic -- CPU not found.
(A)bort, (R)etry, (P)lead?
(A)bort, (R)etry, (P)ray for miracle?
(A)bort, (R)etry, (P)retend this never happened . . .
(A)bort, (R)etry, (S)can user for virus?
(A)bort, (R)etry, (S)eek Divine Intervention?
(A)bort, (R)etry, (S)ell it
(A)bort, (R)etry, (S)mack the @#$&*~ thing!
(A)bort, (R)etry, (S)ue manufacturer?
(A)bort, (R)etry, (S)witch to Windows UAE?
(A)bort, (R)etry, (T)ake down entire network?
(A)bort, (R)etry, (T)apdance?
(A)bort, (R)etry, (W)hackitonthesideofthemonitor!
(A)bort, (R)etry, (W)hip with wet noodle?
(D)inner not ready: (A)bort (R)etry (P)izza
(H)usband (I)s (L)ying (L)ike (A) (R)edneck (Y)okel!
(Ice rocks hit the hull) "Captain, we are being hailed."
(PS/2) + (OS/2) = PSOS (Pretty Sorry Overpriced Stuff)
(sniff) Is that smoke from the power supply?
(Tagline under construction)
(takeoffs == landings) ? win() : lose()
* ░ ▒ ▓ ▒ ░ <- Tribble transporting
* * * <- Tribbles δ δ δ <- Hari Krishna tribbles
* <-- Tribble ! <-- Surprised Tribble
* <-- Tribble o <-- Jean Luc Tribble
* <-Tribble ∙ <-Tribble after a close shave.
* ERROR * Unable to insert witty tagline.
* Game Over * HIGH SCORE = 6,746,895 Your score = 130
* This is a tribble. # This is a tribble on drugs.
*%^&~$%@$!9 Hey cat! <SMACK>...and stay OFF my keyboard!
*'M ST*P*D - I'd like to buy a vowel Pat, an 'O' please
*** ******* $*x ******$ ***r ***$*g***
*** ERROR *** Unable to insert witty tagline.
***** New Lemon Scented Tagline *****
***ALWAYS*** know where your towel is ! ! ! !
***THIS*TAGLINE*PROTECTED*BY*A*FORCE*FIELD***
**FLASH** Eveready Bunny arrested, charged with battery.
*I'm* keeping *THIS* tagline!
*I* didn't do it, the *computer* did it!
*NOW* is a point in time that is already gone.
*QUACK*
+[... text deleted for brevity ...]
-- CLOSED FOR TAGLINE DEVELOPMENT --
--- stolen ---
--------------------- cut here --------------------------
----------This Tagline is blank to save space-----------
-----T-A+G-L-I+N-E--+M-E-A+S-U-R+I-N-G+--G-A+U-G-E-------
-->>Pick a number from one to ten<<--
-=-=-=-=POLICE TAGLINE DO NOT CROSS=-=-=-=-
-D-evelopmental -A-djustment -D-irector (or DAD)
-|--*-- <-Tribble after a sword fight
..................... Family Photo
... I used to finish everything I started, but now I ...
.......... tagline department closed ..........
.....and that concludes today's sarcastic remark.
...and that was when they put the straight jacket on...
...And the only thing the Borg left was this Macintosh.
...and then I think I'll drive a 6" nail into your head
...and then I woke up!
...And then the fun began. - N. Bonaparte
...and then you woke up!
...and tomorrow and tomorrow creeps in this petty pace...
...and you spent how much to read these messages?
...but what I really want to do is direct.
...collector's set for $19.95. But wait, there's more!
...don't you bother calling a psychiatrist. I am one...
...fine weather for the concert here this afternoon.
...just another R.I.P in the fabric of society.
...more troubles than a centipede with fallen arches...
...only a test. Had this been an actual tagline...
.drawkcab ni deggulp draobyek ym tog ev'I kniht I
.retupmoc siht ni deppart m'I !pleH
/////////// Steal this one, you punk. ///////////
/\/\ΘΘ/\/\ (*smack*) ─────────────
10... 9... 8... 7... 6... (Bo Derek getting older).
10.0 times 0.1 is hardly ever 1.0.
1024x768x256.... Sounds like one mean woman.
1040 EZ - 1. How much did you make? 2. Send it in.
11th commandment - Covet not thy neighbor's Pentium.
11th Commandment: Thou shalt not covet neighbor's tagline
11th Commandment: Thou shalt not covet thy neighbor's tagline
12 gauge, 9 mm, .38... show 'e how WE litigate.
15¢ of every stamp is for storage charges.
186,000 mps - It's not just a good idea, it's the law!
1960 + (RND * 40) = THE Year of UNIX
1994: I resolve to make NO New Years' Resolutions.
1st Amendment Rights: use them or lose them.
1st rule of marriage: If you're right, apologize fast.
1st we shoot all the lawyers, 2nd we strangle them, 3rd..
2 + 2 = 5 for extremely large values of 2.
2 ears, 1 mouth, use in that order and you'll do fine.
2 rules for success: 1. Don't tell everything you know.
2 wrongs don't make a right, but 3 lefts do...
2 x 4 bbs - a basic board.
2+2=4 (for the time being).
24 hours in a day...24 beers in a case...coincidence?
24 Hr Chinese Restaurant = Wok around the clock.
2400 Baud makes you want to get out and push!!
2b or not 2b? What kind of question is that?
2beers or not 2beers?? I ALWAYS prefer 3 beers!
3 dreaded words when making love: Honey, I'm home
3 dreaded words: "hard disk failure."
3 kinds of people: Those who can count & those who can't.
3 out of 4 doctors recommend another doctor...
333 - Sign of the Semi-Christ
4 Basic Food Groups - Ice Cream, Pizza, Beer and Women.
4 food groups: fast, frozen, microwaved, and junk
4 out of 5 doctors agree: 1 out of 5 is an idiot
43% of all statistics are totally worthless..
43rd Law of Computing: Anything that can go wrong, will.
486/50 + Windows 3.1 = PCjr
486SX: When only the most recent mediocrity will do...
4am? Already? Oh no not again!!
4DOS finishes the job COMMAND.COM hardly even started!
4DOS Virus Scan -=Windows Found=- Delete (Y/n)
5 out of 4 people have trouble with fractions.
573 meetings and you haven't discovered fire yet?
5¼ floppy is not better than 3½ hard.
6.9 <--- A good thing ruined by a period.
62% of those polled felt polls asked trivial questions.
640k = 4480 in dog bytes.
640K ought to be enough for anybody. -Bill Gates, 1981.
666-The number of the beast, 36D-the number of the breast
668 -- the neighbor of the beast.
66mHz ain't fast enough!
69 is fine, but 77'll get me 8 more.
8 hours of debugging and my code is finally...unreadable?
8 of 10 Americans suffer from hemorrhoids. 2 enjoy them!
80% of men cheat in America, the rest in Europe.
80486: Process cash from wallet at higher speeds.
85% of all known worlds have invented jynnan tonnyx.
8th Wonder of World? One who remembers the other seven.
9 out of 10 men who tried CAMELS preferred women.
9 out of 10 serial killers own cats.
90% of any business transaction is selling yourself.
90% of being smart is knowing what you're dumb at.
90% of politicians give the other 10% a bad reputation.
93.4% of all statistics are made up. The rest are false.
9600bps and under are insults to HST'ers -Hacker's law #5
97% of Americans pay too much attention to statistics.
98% of all statistics are useless.
98% of all statistics disprove the other 98%.
:) :D :O :( :[ ;) 8) B) :> |I :P =) :S :B :] :\
:.::: ::..: ::.::. :..:: Tagline in Braille
< *><* > <-cross-eyed tribble
<%>{ 1 fish, <%>{ 2 fish, <%>{ red fish, <%>{ blue fish
<- Under construction! It's getting ßeta, ßeta and ßeta.
<-- It's simply too wonderful for words!
<-- Not Yet Available in the Romulan Empire.
<-- Registered with a Rubber Check!
<-- Registered with beads and trinkets.
<-- Tagline management will never be the same again!
<-- This registration paid for with sexual favors.
<-- Write complaints in this box, please.
<---- Follow the Arrows -----> -----> Stupid!
<-------- The information went data way -------->
<< Erro #98: Mal contato no slot. Sacuda o computador...
<< Just some more irrelevant nonsense from me. >>
<< Politically Incorrect Tagline Deleted! >>
<<---- THIS SPACE FOR SALE ---->>
<<< Tagline deleted by Natl Endowment for the Arts >>>
<=MINDLEVEL=> THIS is a configuration of units of energy.
<Ctrl><Alt><Del> to read the next message
<expletive> know it all, self-righteous, <expletive> SYSOP!
<Ghost tag>
<Insert tagline here>!
<sigh> THUD!
<Sigh> Nostalgia isn't what it used to be!
<tap> <tap> <tap> Is this thing on?
<This space unintentionally left blank>.
<This Tagline has been removed by U.S. Customs>
<ZAP!> That was *not* manual override. -- Data
> Crimea River
> Get thee down. Be thou funky.
>> BEER.CAN not found, USER.EXE not loaded <<
>>> Is e-mail Cyberspace??? <<<
>>>>>>>> Conserve - Buy powdered water. <<<<<<<<
>>>>>>>>>>>>>>> BET YOU'RE LOOKING AT THIS
<<<<<<<<<<<<<<
?pu gnikcab yb naem uoy tahw siht sI
@TOFIRST@! Don't chew on that@#~!... NO CARRIER
@TOFIRST@, please dispose of this person IMMEDIATELY!
A "bird in hand" makes brushing your teeth difficult.
A "feature" is a bug with seniority.
A "program" is used to turn data into error messages.
A .45 beats a royal flush EVERY TIME
A 10K brain attached to a 9600 baud mouth.
A B C D E F G, Eric the half a bee.
A baby is lots more fun than differential equations.
A bachelor enjoys the chase but doesn't keep the game.
A bad day fishing STILL beats a good day at work!
A bad excuse is better than no excuse.
A bad peace is even worse than a war.
A BBSer's telephone bill knows no bounds...
A bear robbed of cubs is safer than the folly of fools.
A beard signifies lice, not brains.
A belly button is for salt when you eat celery in bed.
A big enough hammer can usually fix anything.
A big hand please for the Great Prophet Zarquon...
A big mouth travels far and fast.
A bigot will not reason, a fool cannot, a slave dare not.
A billion dollars isn't what it used to be - N.B. Hunt
A billion here, a billion there, soon it is real money.
A bird in the bush can't make a mess in your hand.
A bird in the hand can be messy.
A bird in the hand is the best way to eat chicken.
A bird in the hand is worth what it will bring.
A bird in the hand's better than one overhead.
A bit of physical challenge would help draw you out.
A bleeding heart can be hell on the carpeting.
A bonded penguin is a happy penguin.
A book is the only immortality.
A book, a friend, a song, a glass, a chaste loving lass.
A brilliant smile will get you fan mail from lighthouses.
A brute kills for pleasure. A fool kills from hate.
A Buddist nudist practices yoga bare!
A bug in the code is worth two in the documentation.
A Bush On The Face Is Better Than A Bird In The Hand!
A cannibal only opens his mouth to change your feet.
A cat is always on the wrong side of a door.
A cat is an animal who never cries over spilled milk.
A Cat is easier to train than a woman.
A cat would be man's best friend, but never stoops to it.
A cat's worst enemy is a closed door.
A celebrity is a person who is known for well-knownness.
A centipede is an ant made to government specs.
A chain of lynx; a peck of birds; a hoard of squirrels...
A cheap shot is a terrible thing to waste.
A chicken is an egg's way of producing more eggs.
A child is a curly, dimpled lunatic.
A child of 5 could understand this. Fetch me a child!
A child prodigy knows not to bother with it.
A choice is always possible, even without any options.
A cigar is just a cigar.
A civilization needing toothpick instructions is not one.
A clean desk is a sign of a cluttered desk drawer.
A clean desk is the sign of a sick mind.
A clean disk is the sign of a warped drive.
A clean drive is a sign of a sick mind!
A clean, neat, and orderly desk is a sign of a sick mind.
A clean, neat, desk is the sign of a very sick mind.
A clear conscience is most often a sign of bad memory.
A closed mouth gathers no flies.
A closed mouth gathers no foot.
A closed mouth maintains a happy mind.
A committee has six or more legs and no brain.
A committee is an animal with four back legs.
A computer's attention span is as long as it's power cord
A conclusion is where you got tired of thinking.
A crappie is not a sunfish found in a toilet.
A critic knows the way but can't drive the vehicle.
A crowded elevator always smells different to a midget.
A curse has arisen from the mists of time.
A cynic smells the flowers and then looks for the casket.
A cynic's work is never done.
A dark-haired person will change your life.
A day for firm decisions!!!!! Or is it?
A day without Mail is like a day without Sunshine!
A day without sunshine is like night.
A deluge of words and drop of sense.
A Democrat's generosity is limited only by your income.
A dime saved is a dollar earned. The rest is Uncle Sam's.
A diploma proves only that you know how to find an answer
A dirty mind is a terrible thing to waste.
A dirty mind is better than no mind at all.
A Disaster Area Rep met and shot the environmentalists.
A Disaster Area spokesman later said it was "a good gig".
A dog wags its tail with its heart.
A dog's a dog 'cept when he's facing you.Then he's Mr Dog
A doll is a doll is a doll. - F. Sinatra
A dollar is a bad boss -- and dying is a bad fear.
A double positive is never negative... Yeah, right!
A drunken man's words are a sober man's thoughts.
A dry sense of humor is better than slobbering everywhere
A fail-safe system fails when it fails to fail safely.
A family reunion is an effective form of birth control.
A farm, is in fact, an immortal work of art.
A farmer is always going to make it rich the next year.
A fate worse than death: To be married alive!
A father is usually a banker provided by nature.
A feature is a bug with seniority.
A fine retreat matters as much as a stylish attack.
A flying particle will seek the nearest eye.
A flying saucer results when a nudist spills his coffee.
A fool and his money are soon elected.
A fool and his money are soon partying!
A fool and his money are soon popular.
A fool and his money is my idea of a friend!
A fool and his money is my kind of customer!
A fool and his money rarely get together to start with.
A fool and his money soon become a Sysop!
A fool and your money are soon partners.
A fool must now and then be right by chance alone.
A fool must search for a greater fool to find admiration.
A Friend In Need Always Finds Your New Phone Number.
A friend in need is a pest indeed.
A friend is a person who knows you and still likes you.
A friend is something you earn.
A generation which ignores history has no past or future.
A gentleman can disagree without being disagreeable.
A gift of flowers will soon be made to you.
A girl can be poor at history, but great on dates.
A goal is a dream with a deadline.
A goal is OK if you can also take interesting detours.
A good angle to approach any problem is the try-angle.
A good dog barks when told.
A good hacker knows all the right MOVs.
A good hot dog feeds the hand that bites it.
A good library must always be a two way street.
A good man gone wrong is usually a bad man found out.
A good marriage outlasts the first box of dental floss.
A good memory is one trained to forget the trivial.
A good organizer is the one who is careful to plan ahe
A good pun is its own reword.
A good rooster crows in any hen house.
A good scare is better than good advice.
A good tagline is often stolen.
A good tree cannot bring forth evil fruit.
A good war is less damaging than Brockian Ultra Cricket.
A great many family trees were started by grafting.
A gun gives you the body, not the bird.
A hangover is the wrath of grapes.
A Happy Heart is like Good Medicine
A hard disk is good to find.
A heavy night snowstorm is God saying: "Take today off."
A hen is an egg's way of making another egg.
A hen tomorrow is more valuable than an egg today.
A hen who lays an egg cackles as if it was an asteroid.
A hole is nothing but you can still break your neck in it
A hollow voice says, "Plugh".
A horse is a horse, of course, of course.
A horse may go freely to water, but a pencil must be lead
A hug warms the soul and places a smile in the heart.
A hundred stars do not equal the light of the one moon.
A hundred thousand lemmings can't all be wrong.
A husband is a lover with the nerve extracted.
A husband is the medicine for the ills of girlhood.
A jerk present in a group indicates a jerk in charge.
A job is nice but it interferes with my life.
A job is nice, but it interferes with my BBSing!
A journey of 1,000 miles begins with a cash advance.
A jug is carried under your coat for a dishonest reason.
A KGB keyboard has no <ESC> key!
A kind word and gun gets you more than a kind word alone.
A king's castle is his home.
A lady is a woman who makes a man behave like a gentleman
A lady is one who only shows her underwear intentionally.
A lady is one who only shows her underwear.......
A lady wearing a chastity belt is not going to a ball.
A language is just a dialect with a gun.
A lawyer's opinion is worth nothing unless paid for.
A leading authority is someone lucky who guessed right.
A leap year is never a good sheep year.
A learned fool is more foolish than an ignorant fool.
A liar isn't believed even when he speaks the truth.
A liberal is a person with no interests now at stake.
A liberal's generosity is limited only by your income.
A lie in time saves nine.
A lie is terminological inexactitude.
A lie that can be passed off as truth becomes truth.
A Little Dab'll Do Ya - Vitalis
A Little Dab'll Do Ya.
A little greed can get you a lot of stuff.
A little ignorance can go a long way.
A little knowledge is a dangerous thing.
A little truth helps the lie go down.
A living example of Artificial Intelligence.
A loaf of bread, a jug of wine and <occupant>.
A long time ago in a galaxy far far away, or was it here?
A lotus? I thought that was a Grasshopper.
A low yield atomic bomb is like being a bit pregnant.
A Macintosh a day keeps Apple Happy and Rich!
A Macintosh is not truly portable until it is airborne.
A magician wandered the beach, but no one needed him.
A mainframe: The biggest PC peripheral available.
A male rite of passage: Writing your name in the snow.
A man can dream, can't he?
A man in love mistakes a pimple for a dimple.
A man in the house is worth two on the street - Mae West.
A man is only as good as what he loves.
A man is only as young as the woman he feels.
A man should live forever, or die trying.
A man who smiles when things go wrong knows who to blame.
A man who turns green has eschewed protein.
A man without a religion is like a fish without a bicycle
A man wrapped up in himself makes a very small package
A man's a man for that.
A man's best friend is his dogma.
A man's house is his hassle.
A man's only as old as the woman he feels.
A menu, or would you like to meet the dish of the day?
A mime is a terrible thing to waste.
A mind is a terrible thing to lay off.
A mind is a terrible thing to taste.
A Mind Is A Terrible Thing To Waste.
A minister says matrimony should be enduring. It is.
A minute is 60 seconds unless it's preceded by "Just a"
A miser is hard to live with, but makes a fine ancestor.
A mistake is proof that someone tried anyhow.
A mob has many heads, but no brains.
A modest little person, with much to be modest about.
A mother is not a dust rag.
A mother of quintuplets gave spouse a separate bedroom.
A mother pampering a child is raising a serpent.
A mother-in-law is often a mother.
A motion to adjourn is always in order.
A mouse is an elephant built by the Japanese.
A mouse may be useful, but only for cat food.
A mouse: A transistorized elephant.
A mule dressed in a tuxedo is still a mule.
A nation . . . is just a society for hating foreigners
A new mother soon becomes a chief cook and bottom washer.
A newspaper is a collection of half-injustices.
A newspaper is to a book as a whore is to a lady.
A noisy exhaust to some almost amounts to a mating call.
A nose in artificial manure is not studying nature.
A nudist has no reason to fear a pickpocket.
A nudist is one who suffers from clothestrophobia.
A nudist wedding makes the best man easy to identify.
A nun is fun, a nunny is funny....
A one night stand is better than a one stand night.
A one-bit brain with a parity error.
A ounce of pretension = a pound of manure.
A pain in the butt may be a friend in need..
A Pan Galactic Gargle Blaster is equivalent to a mugging.
A paranoid is a man who knows a little of what's going on
A pen is mightier than a sword except it runs out of ink.
A penny dropped lands at your feet, quarters roll 20 yds
A Penny earned is a Penny owed (Probably to Uncle Sam)
A penny for your thoughts; $20 to act it out.
A penny saved is 2.5 grams of copper alloy.
A penny saved is 2.5 grams of zinc alloy.
A penny saved is a Congressional oversight.
A penny saved is ridiculous.
A perfect lover is one who turns into a pizza at 4:00 am.
A person does not have a sense of humor, it has you.
A person in a passion is riding a mad horse.
A person in love sometimes mistakes a pimple for a dimple
A person is a lion in his own cause.
A person never tells you anything until contradicted.
A person with two watches is never sure what time it is.
A person without a navel lives within all of us.
A person's got to know his limitations to avoid failure.
A pest: A friend in need.
A phaser is the universal communicator. ■ Worf
A phaser on stun is like a day without orange juice.
A piano is a piano is a piano. Gertrude Steinway.
A pinch of probability is worth a pound of perhaps.
A pitcher that goes to a well too often is broken first.
A plucked goose doesn't lay golden eggs.
A poet is a kind of liar who always speaks the truth.
A poet reading his verse in public has a nasty habit.
A poor excuse is better than no excuse! <g>
A pound of pluck is worth a ton of luck.
A priceless jewel!
A problem can be found for almost every solution.
A production of the digitally insane.
A professor is one who talks in someone else's sleep.
A programmer and his mind are soon parted
A prune is a plum with experience
A RAM is a terrible thing to waste.
A ratchet screwdriver fruit's life cycle is interesting.
A recession is what takes the wind out of your sales.
A red nose can be the result of sunshine or moonshine.
A reply for me? You like me, you really, really like me!
A report from the Hairdresser's Fire Development team.
A Restroom: The only place a flush beats a full house.
A return with no gosub.
A rich man's joke is always funny. (Thomas Brown)
A ring is a hole with a rim round it.
A Robin redbreast in a cage puts all heaven in a rage.
A rock ----->me<----- A hard place.
A rolling disk gathers no MOS.
A rolling stone is better than a bird in the hand.
A room temperature IQ.
A rooster clucks defiance -- but a lawyer.
A Rose by any other name... ---'--,--{@
A Rotarian was the first to call John the Baptist "Jack."
A running mate is a husband who dared to talk back
A sadist is a person who is kind to a masochist.
A school: Building with four walls and tomorrow inside.
A scientist must be absolutely like a child.
A seminar on Time Travel will be held two weeks ago.
A short cut is the longest distance between two points.
A shot in the dark = searching for a needle in hay stack.
A shower is the halfway point between bed and world.
A signature can reveal character, and sometimes a name.
A simple idea will be worded in the most complicated way.
A single fact can spoil an excellent argument.
A single fact will often spoil an interesting argument.
A slap vs a slog is like a ribbon vs an obi.
A sleeping fox counts hens in his dreams.
A small object that is accidentally dropped will hide.
A smile is the sunshine that is a part of life.
A Smith & Wesson beats four aces every time.
A Smith and Wesson beats four aces.
A social life? What board can I download THAT from?
A spoonful of sugar helps any medicine go down.
A spoonful of sugar helps the medicine go down.
A squirrel's home is really a nutcracker's suite!
A statesman shears sheep, a politician skins them.
A stitch in time would have confused Einstein.
A STOIC brings the baby; a CYNIC is where you wash it.
A table of contents has no drawers.
A tagline by any other name is not as funny.
A Tagline says more about you than cash ever can!
A teetotaller makes the worst drunkard.
A teleport with no guidance could put you anywhere.
A terrible mind is a thing to waste....
A thick head can do as much damage as a hard heart.
A thief believes that everybody steals.
A thief that robs another thief is forgiven for 100 years
A thing of beauty is in the eye of the beholder.
A Thousand points of Broccoli!
A tidal wave of avalanche proportions.
A tier of crocodiles; a squad of squid
A Tisket, A Tasket, A Condom or a Casket?
A toastmaster introduces one who needs no introduction.
A too-short mini skirt leaves a definitive end in view.
A towel has immense psychological value.
A towel is the most useful thing a hitchiker can have.
A tribble a day keeps the Klingons away.........
A true diplomat struts sitting down.
A true friend is one soul in two bodies.
A true friend is the best possession.
A true friend walks in when everyone else leaves
A true subwoofer makes the concrete shake beneath you.
A truly wise man never plays leapfrog with a unicorn.
A verbal contract isn't worth the paper it's written on.
A vivid and creative mind characterizes you.
A vote on the tally sheet is worth two in the box.
A waist is a terrible thing to mind.
A well-crafted tagline is a joy forever.
A well-written life is as rare as a well-spent one.
A whippersnapper has nothing to do with sex? Drat!
A wholesome mind is wasted potential.
A whore is a whore for the same reason some of us aren't.
A wife lasts as long as a marriage, an ex-wife for ever.
A winner makes commitments; a loser makes promises.
A wise man once said.... I don't know...
A wise person sees as much as ought, not as much can.
A wise shepherd never trusts his flock to a smiling wolf.
A wok is what you throw at a wabbit.
A woman drove me to drink -- never did stop to thank her.
A woman drove me to drink and I never even thanked her.
A woman must be a genius to create a good husband.
A woman's guess is more accurate than a man's certainty.
A word fitly spoken is like a beautiful apple of gold.
A word is worth 1/1000th of a picture.
A word to the wise is usually enough to start an argument
A worthless wise man always charms the rabble.
A writer thinks of critics as a tree feels about dogs.
A yawn is a silent shout.
A yer ago I kudnt spel progrmer now I are won.
A zygote is a gamete's way of producing more gametes.
A)bort R)etry G)et a stick and kill it.
A+iens are ea+ing mY brAin -- +i+m AT e+even.
A.I.D.S.: (A)nally (I)njected (D)eath (S)entence
AAAAA - American Association Against Acronym Abuse!!!
Aaaahhhhh-CHU! Not Virus, BBS Fever.
AAcckk!! II''mm iinn hhaallff dduupplleexx!!
Aardvark:Heavy labor, as in "It's aardvark, but pays well
AARRGHH!! A virus was chewing my FAT.
Abandon all hope, ye who enter messages here.
Abandon all hope, ye who PRESS ENTER here.
Abandon hope, all ye who <ENTER> here.
Abandon the search for truth: settle on a good fantasy.
Abdominos... sit-ups & pizza.
Ability is a good thing but stability is even better.
Abolish first marriages!
Abolish mornings.
Abort, Retry, Ignore, Fail, Nuke...
Abort, Retry, Ignore, hold Requiem Mass?
Abort, Retry, Ignore, plan a Funeral Service?
Abort, Retry, Ignore, say Kaddish?
Abort, Retry, Ignore, Valium?
Abortion is a miscarriage of justice.
Above all else - sky.
Absinthe makes the tart grow fonder.
Abstinence will never be as popular as promiscuity...
Abstinence: The re-usable contraceptive.
Absurdity: a belief inconsistent with one's own.
Accept finite disappointment, never lose infinite hope.
Accordion: A bagpipe with pleats.
Accountants work their assets off.
Accuracy: The vice of being right.
Acetone = What you do in exercise class...
Acid test? You're soaking in it...
ACK and you shall receive.
ACOUSTIC: What you play pool with.
Acronyms can, at most, be an INITIAL success!
Acting is the art of keeping the audience from coughing.
Acting without thinking is like shooting without aiming.
Actions are neither as good nor as evil as impulses.
Actions are usually right, but the reasons seldom are.
Actions DO speak louder than words.
Actions from sanity are not necessarily from feeling.
Actions speak louder than words -- but not so often.
Adam ate the apple, and our teeth still ache.
Adam to Eve: "I'll wear the plants in this family."
Adam's Rib: The original bone of contention.
Adapt to those around you..
Adding manpower to a late project makes it later
Admiral, there be whales here!
Admiration: Polite recognition of self-reflection.
Admit your mistakes.
Adolescence: prepares parents to welcome the empty nest.
Adopt an orphan program today!
Adult: One old enough to know better.
Adultery is the application of democracy to love.
Adultery - two wrong people doing the right thing.
Advanced technology is indistinguishable from magic.
Adventure is the champagne of life.
Adversity makes people wise but not rich.
Adversity reveals genius, prosperity conceals it.
Advertisement: The most truthful part of a newspaper.
Advertising is 85% confusion and 15% commission.
Advertising is legalized lying. --H. G. Wells--
Advice is an uncertain gift.
Affectation is the mark of one not sure of himself.
Afflicted with Foot In Mouth Disease.
After a snowstorm, everybody's lawn looks the same.
After all is said and done, more is said than done
After all is said and done, usually more is said.
After four decimal places, nobody gives a damn.
After they make styrofoam, what do they ship it in?
After things go from bad to worse the cycle repeats.
After this there is nothing, void, absolute nothing.
After two weeks of dieting, all I lost was two weeks.
After we pull the pin, Mr. Grenade is NOT our friend!
Against logic there is no armor like ignorance...
Against stupidity, the Gods themselves contend in vain.
Age and treachery can always overcome youth and skill.
Age fast--age slow, it's up to you.
Age is never a bar to human immaturity.
Age is not a barrier to achievement.
Age is only important if you're a cheese.
Age needn't necessarily be a bar to immaturity.
Aging is bad, but consider the alternative!
Ah yes, but TLX can do that too...
Ah, my trombone. Let me show you how it works. ■ Riker
Ah, this is a question about the past, is it?
Ahab is still chasing Moby Zmodem.
Ahh! Come on George, just this one last little feature!
Aibohphobia (n.); the fear of palindromes.
Ain't gonnaspeak Harlem'glish.
Ain't that sweet?
Ain't this a shame?
Air conditioned environment - Do not open Windows.
Air Geordis - TNG footwear
Air pollution is a mist demeanor.
Airport HotDogs $4.00, Flight Insurance $0.75, go figure.
Alaskan Eye Doctor: Optical Aleutian
Alcohol and Math don't mix... Don't drink and derive.
Alert! The Speeling Poleeses are checking your text.
Alex, I'll take "Things Only I Know" for $1000.
Aliens have invaded Earth! How else do you explain DOS?
Alimony is like buying oats for a dead horse!
Alimony is the screwing you get for the screwing you got.
All answers questioned here.
All babies speak Klingonese
All barkers are not side show hawkers.
All booster -- no payload.
All clowns are masked, all personae flow from choices.
All computers wait at the same speed.
All documents with puns will be drawn and quoted.
All else equal, fat people use more soap than thin.
All facts are negotiable. Inquire within.
All for one; one for all, except me above all.
All general statements are false, except this one.
All general statements are false.
All good things must come to an e
All great truths began as blasphemies.
All his lights are on, but nobody's home.
All hope abandon, ye who enjoy tax forms.
All hope abandon, ye who enter messages here.
All human life ends when you take a "dirt nap."
All humans are subject to decay.
All I ask is a chance to prove money can't make me happy
All I ask is to prove that money can't make me happy.
All I have to do is imagine, and I am in dreamland.
All I need to know I learned from my cat.
All I really need to know I learned in Kindergarten.
All I said was get behind me Satan. He did and he pushed.
All I want is a hot woman, cold beer and unlimited power.
All I want is more.
All in all, it's just another brick in the wall....
all is said and done, people keep saying and doing.
All jobs require at least 1 extra visit to the DIY center
All life is a conjugation of the verb "to eat".
All mathochists suffer from calculust.
All men are born equal. Some of us outgrow it.
All men are created unequal.
All of my REALLY GOOD taglines are one character too lon
All of the stars are to be found only up in the sky.
All pigs are equal, but some are more equal than others.
All power corrupts, but we need the electricity.
All probabilities are 50%. It happens or it doesn't.
All problems of Christians are ascribed to demons...
All programers are optimists.
All real programs contain errors.
All reality is aspect dependent.
All right, clever, you tell us what color it should be.
All right, I'll have the dead unjugged rabbit fish.
All rising to a great place is by a winding stair.
All rivers run into the sea, yet the sea is not full.
All rules have exceptions -- except the ones that don't.
All science is either physics or stamp collecting.
All scotch cuisine is based on a dare.
All sentences that seem true should be questioned.
All stressed out, and no one to choke ...
All taglines are busy... One will be with you shortly.
All that glitters has a high refractive index.
All that glitters is not GOLD...Just a shiny spot.
All the kookies are not in the jar.
All the sex appeal of a wet paper bag.
All the tea in china = 356,000 metric tons.
All the world's a nail to a child with a hammer.
All the world's a stage but we aren't getting an Oscar...
All the world's a stage. Where does the audience sit?
All things are difficult before they are easy.
All things evolve, nothing is extinguished.
All things in moderation - including Moderation!
All those updates, and still imperfect.
All true wisdom is discovered in tag lines.
All true wisdom is found in taglines
All true wisdom is found on tee shirts...
All wanting joy must share it, happiness was born a twin.
All warranties expire upon payment of this invoice.
All we are saying, is give peace a chance! (John & Yoko)
All wiyht. Rho sritched mg kegtops awound?
All words are pegs on which to hang ideas.
All work and no play will make you a manager.
All your future lies beneath your hat.
All's fair in love and war - What a contemptible lie.
All's well that ends well. - E.A. Poe
All's well that ends.
Alligator heads are the chief food of mutant chickens.
Almost anything is easier to get into than out of.
Alone in a bank at night is a pleasant experience.
ALT.BBS: Fatal error at F000:DEAD, dropping...(click)
Altruism is the devil's calling card.
Altzheimers is very ... ah ... umm ... I forget!
Always be sincere, even if you don't mean it.
Always be smarter than the people who hire you.
Always consider the alternative before making a choice.
Always do right: Gratify some and astonish the rest.
Always draw your curves then plot the readings.
Always first decide the sentence, then the verdict.
Always forgive your enemies, nothing else annoys them so.
Always forgive your enemies. Nothing annoys them so much.
Always format alphanumerically, then preview graphically.
Always in the right place, but at the wrong time.
ALWAYS know where your towel is ! ! ! !
Always listen to experts. Hear the impossible then do it.
Always look out for #1 and be careful not to step in #2.
Always proofread carefully to see if you any words out.
Always put your brain in gear before starting your mouth.
Always remember that a moving neutrino gathers no mass.
Always remember the past, but make waves when it matters.
Always remember to pillage before you burn.
Always remember where you came from so you can return.
Always remember you're unique - just like everyone else.
Always remember, to copy a disk is not to Xerox it.
Always sharpening his sleeping skills.
Always smile. It makes people wonder what you're up to.
Always store beer in a cool dark place.
Always take aim at the Tidy Bowl Man.
Always tell her she is beautiful, even if she isn't.
Always tell her she's pretty, especially when she isn't.
Always tell the truth -- and be ready to run like h***!
Always use your enemy's hand to catch a snake.
Always willing to share my ignorance...
Always yield to temptation, it may never return.
Alzheimer's Club: Meet the same new friend every day.
Am I ignorant or apathetic? I don't know and don't care!
Am I the Last Sane Person in America?
Amazing how much you learn after thinking you know it all
Ambition destroys its possessor.
Amen. Pass the biscuits.
America is a dream to most of the world.
America is a tune. But it must be sung in harmony.
America is the only country founded on a good ideal.
America was not discovered by Americans, shame on them.
America's 5 Most Feared Words: "Dan, I don't feel well.
America, land of opportunity for Japanese businessmen.
America: great opportunities and worst influences.
American politics: The walruses herding the oysters.
Ami - Friend. Ami Pro - Professional Friend?
Ami Dolenz her performance with a bow to the audience.
Amish newlyweds; a week later he drove her buggy.
Among economists, the real world is often a special case.
An 8080 in a 68000 environment.
An accommodating vice is better than an obstinate virtue.
An actor without buck teeth can play the Easter Bunny.
An adequate bootstrap is a contradiction in terms.
An agreeable person: One who agrees with you.
An alcoholic is an enemy who drinks as much as you do.
An alcoholic: A person who drinks more than his physician
An American at war with someone else is at peace w/itself
An appeaser feeds a crocodile, hoping to be eaten last.
An ass thinks one thing, his rider another.
An atheist has no invisible means of support.
An attacker must vanquish, a defender need only survive.
An authority is anyone who guessed right more than once.
An egotist thinks he's in the groove when he's in a rut.
An electrical engineer deals with current events.
An electrician worries about current events.
An elephant is a mouse built to Mil-spec.
An elephant: A mouse built to government specifications.
An error? Impossible! My modem is error correcting.
An ex-spurt is a has-been drip under pressure.
An experiment in Artificial Stupidity.
An honest politician: One who stays bought.
An hour of begging is NOT considered foreplay!
An idea is not responsible for fools who believe in it.
An idle mind is worth two in the bush.
An inch of dog is better than a mile of pedigree.
An inheritance is a dead giveaway...
An institution is the lengthened shadow of one man.
An Intellectual is someone whose mind watches itself.
An interesting thing about space is how dull it is.
An object at rest will be in the wrong place.
An object in motion is heading in the wrong direction.
An open mind is wonderful if matching mouth not included.
An open mind tolerates an empty one.
An opinion is what you have when you don't have any facts
An optimist invented an airplane; a pessimist a parachute
An optimist is a person without much experience.
An ounce image is worth a pound of performance.
An ounce of example is worth a ton of advice.
An ounce of hypocrisy is worth a pound of ambition.
An ounce of image is worth a pound of performance.
An over the hill astronaut requests a slower capsule.
An ulcer is what you get mountain climbing over molehills
An unbreakable toy is useful for breaking other toys.
Anarchists unite!
Anarchy is against the law.
Anarchy is never HAVING to say you're sorry.
Anarchy: Rights without Responsibilities.
ANARCHY: Such a good idea, it should be the law.
Anatomically correct beats politically correct any day !
Ancient custom has the force of law.
Ancient Greeks made dolphin-killing punishable by death.
And all I wanted was a free lunch...
And all the children are above average in our system.
And don't start sentences with a conjunction.
And God said, "I'll buy a vowel."
And God said, "Let there be light, but make it quick."
And God said: 'E = ½mv² - Ze²/r', and there was light!
And hast thou slain the Jabberwock?
And He saw that DOS is good. That's the end of Day One.
And I Used To Think Basic Was for Weenies!
And it shall be called....the Earth.
and new civilizations. To boldly split infinitives!
And now a word from Wall Street: "HELP!"
And now back to Gilligan's Island!
And now for something completely different..
And now for something completely ridiculous...
And now I'm supposed to think of a brilliant tagline!
And now, let the fun begin.
And on the seventh day, He exited from append mode.
And the Flying Fickle Finger of Fate award goes to...
And the horse you rode in on!
And the only thing the Borg left was this Commodore...
And the wheel, what about this wheel thingy?
And then Adam said, "What's a headache?"
And then we must go to a party.
And there was much rejoicing...
And they said kids had all the fun!
And they saith unto Jesus,"How the @#$! did you do that?
And this is your brain over-easy with a side of bacon.
And today will go down in history as Unknown.
And what are cat diapers called? PamPurrs?
And when fate summons even the Tsar must obey.
And why did cats decide to become domestic animals?
And you know Flipper, he lives in a world full of wonder.
And, what do you want for Christmas?...MORE RAM!
Angel Food Cake: Love Me Tender, Love Me Sweet
Angels can fly since they take themselves lightly.
Anger always drives the mouth faster than the mind.
Anger is a wind which blows out the lamp of reason.
Angling: The name given to fishing by non-fishermen.
Animal attraction: here for hunger or for love.
Animals -- the renewable resource
Another day, another challenge.
Another day, another dime. (A dollar less tax.)
Another day, another shaving accident.
Another day... Another job hopelessly botched...
Another genius thwarted by an incapable assistant.
Another good night not to sleep in a eucalyptus tree.
Another name for my list of people who can kiss my ***.
Another time...another place.
Another victory like that and we are done for -- Pyrrhus
Another world, another day, another dawn.
ANSI kicks ASCII!
Answers: $1, Correct answers: $5, Dumb looks: Free!
Antenna coupling: insect foreplay
Antenna farms benefit from propagation.
Anthem: O-oh say can you C, will our code turn out right?
Anticipate temptation, then be selective.
Antimony - against having money.
Antonym: The opposite of the word you're searching for.
ANXIETY: Nature's way of getting you up Mornings
Anxiety: your resume jammed in office copying machine.
Any certainty is a delusion.
Any day can be the beginning of a new year.
Any dumber and you'd have to be watered twice a week.
Any fool can tell the truth, it takes sense to lie well.
Any given program costs more and takes longer.
Any given program, when running correctly, is obsolete.
Any happiness you get you've got to make yourself.
Any IC protected by a fast acting fuse protects the fuse.
Any man making a pun should be drawn and quoted!
Any man who can see through women is sure missing a lot.
Any non-trivial program contains at least one bug.
Any priest or shaman is guilty until proven innocent.
Any product cut to length will be too short.
Any program will expand to fill available memory.
Any socialism involves more slavery than democracy.
Any sufficiently advanced bug will become a feature.
Any sufficiently advanced magic looks like technology
Any worker not fired with enthusiasm soon will be.
Anybody can say they'll do something, few actualize it.
Anybody can win, unless there is a second entry.
Anybody seen my money shovel? Boat's busted!
Anyone can make mistakes. Fools insist on repeating them
Anyone can walk on water, just know where the rocks are.
Anyone caught hanging from the rim will be suspended.
Anyone here from Hastromil?
Anyone moves and this message gets killed!!!!
Anyone seen my DUMBDRV.SYS file?
Anything can go wrong, don't sweat the little stuff.
Anything can work if you fiddle with it long enough.
Anything free is worth what you pay for it.
Anything good is either illegal, immoral, or fattening.
Anything I make can become a cause for my sorrow.
Anything is good if it's made of chocolate.
Anything not a constant, is not a commandment from God.
Anything not nailed down is a cat toy.
Anything simple is stated in the most complicated manner.
Anything that can go wr ... #@^% Bus Error -- Core Dumped
Anything that happens, happens.
Anything that is too stupid to be spoken can be sung.
Anything works - if you let it!
Anything worth doing is worth doing for a profit.
Anything worth doing is worth getting someone else to do
Anything Worth Doing Is Worth Overdoing.
Anything you may say will be ignored!
Anything you say can and will be used against you...
Anytime things go better, you have overlooked something.
Apathetic bloody planet, I've no sympathy at all.
Apathy Error: Don't Bother Striking Any Key.
Apathy is the glove into which evil slips its hand.
Apology is only egotism wrong side out.
Applied emotion is the key to success with happiness.
April 16th: Count your blessings - nothing else is left.
April showers I hate especially.
ARC vs ZIP: Arc Rival Compressors.
Archaeologist: one whose career lies in ruins
Archaeologists take sedimental journeys.
Archimedes had no principles!
Architecture is the art of how to waste space.
Are all your pets called Eric?
Are deaf psychiatrists better listeners?
Are dog biscuits made from Collie Flour?
Are hard disks really hard?
Are RAM chips better than EWE chips?
Are REASON and LOGIC allowed on this echo?
Are strawberries supposed to have grey fur?
Are the noises in my head bothering you?
Are there Klingons on the Starboard Bow as well?
Are those cookies made with real Girl Scouts?
Are We Having Fun Yet?
Are we supposed to be having fun yet?
Are we talking of the flat country with EEC and the fog?
Are you a good witch, or are you a bad witch?
Are you a Klingon, or is that a turtle on your head?
Are you a Proctometric Polytechnic graduate?
Are you a typical earth creature?
Are you fighting tagline withdrawal?
Are you part of the solution, or the precipitate?
Are you prepared to defend yourself?
Are you running under Windows, or just using an XT?
Are you sane? If so, am I?
Are you suggesting that coconuts migrate?
Are you sure you want this tagline?
Are you tired of empty promises? God never fails.
Are you to confuse with me facts?
Are you virus free? Be sure with URINALIS.EXE.
Are you waiting for your prey?
Arguments with furniture are rarely productive.
Aristotle, you have to be kidding...
Arkansas: Bubble-gum cards are in the Great Books series.
Army food: The spoils of war.
Around here you can name your own pay, I call mine "Fred"
Arrogant Hackers Do it for Free
ARRRRGGGGHHHH!!!...Tension breaker, had to be done.
Arsonists of the world, ignite!
Art does not reproduce the visible; it makes visible.
Art for art's sake is a philosophy of the well-fed.
Art is a lie that makes us realize the truth -- Picasso
Art is either plagiarism or revolution.
Art is I; Science is We.
Art is the demonstration that ordinary is extraordinary.
Art is vision not expression.
Art lies in concealing art.
Art thou an artist, or art thou art?
Art: The way the world ought to be.
Artery - the study of paintings.
Artery: The study of fine paintings?
Arthritis - the new math.
Arthur's accepted role was to lie squelching in the mud.
Artificial Intelligence is no match for natural stupidity
Artificial Intelligence: A Blond dyed Brunette.
Artificial Intelligence: The other guy's opinion.
Artistic ventures highlighted. Rob a museum.
Artists' models make only a bare living.
As a computer, I find your faith in technology amusing.
As a lemon I kept amused jumping in and out of gin tonics
As confused as a baby at a topless bar.
As confused as a termite in a yo-yo.
As easy as getting the pepper out of a pot of hot chili.
As far as I remember we were programmed to crash on it.
As for me, all I know is that I know nothing.
As for my car, it's guaranteed to run! (downhill)
As greasy as a truck-stop skillet.
As heavy as a bucket of hog livers.
As I learn, I know about more things I don't yet know.
As I said before, "I never repeat myself".
As I said last week, I'll be done tomorrow.
As I was going up a stair, I met a man who wasn't there.
As I was saying to Elvis the other day...
As I was saying, I hate it when people don't finish their
As it fell the petunias thought 'Oh no, not again."
As King Arthur said: Some days it all seems so feudal.
As lacking in privacy as a goldfish.
As long as I can remember, I've had amnesia.
As long as I live, I shall be, myself, no other, just me.
As long as we remain unsure, we are alive.
As mad as a mule chewing on bumblebees.
As noisy as a nickel in a dryer.
As quick as a corpse.
As seen on Who Asked For It!
As sharp as a bowl of Jello and twice as smart.
As sharp as a bowling ball and twice as smart.
As sharp as a marble and twice as smart.
As sharp as a pin head and twice as smart.
As slick as a peeled onion.
As suspicious as a rich widow.
As thick as two short planks.
As useful as teats on a boar hog.
As you stroll through life always remember: HELL SUCKS!
As Zeus said to Narcissus, "Watch yourself!"
ASCII and ye shall receivii.
ASCII no questions, I'll tell you no lies.
ASCII stupid question, get a stupid ANSI.
Aside from Velcro, time is the most mysterious substance.
Ask a silly person...get a silly answer.
Ask a stupid question and you'll get a stupid answer.
Ask not for whom the bell tolls the answer can be deadly.
Ask not for whom the bell tolls; let the machine get it.
Ask not what your computer can do for you...
Ask others for help and be in debt forever!
ASL has 15 signs for stupidity; 3 for smart.
Asphalt = Proctologist's malpractice insurance
Assassination is the extreme form of censorship.
Assembler Lesson #1: POP AX is not a heavy metal band.
Assembly line workers do it over and over.
Associate with those you can learn from.
Assumption #1: Dan Quayle is smarter than broccoli.
Assumption is the mother of all screw-ups.
Astrology is Taurus.
Astronauts are out to launch.
Astronomy... ...is looking up!
Astronomy: The anatomy and physiology of our universe.
Astrophysicans try to cure sick stars.
At 19, everything is possible; tomorrow looks friendly.
At a nude wedding, every one can see who the BEST man is!
At a sandwich shop: "Mustard's Last Stand"
At all ages you are certain you still have another year.
At least "duck" and "cover" now refers to duck hunters.
At least Congress doesn't make death worse every year.
At least I can use your argument as a bad example.
At least you can always use jour code as a bad example.
At night, I am a licensed cleavage inspector.
At the moment of meeting, the parting begins.
At times we must settle for inferior quality time.
At times, no matter your metabolism, you must breathe.
At yuletide, astronauts look for the missile toe.
AT&GETMAIL&UNPACKMAIL&READMAIL&LOADREPLY&STEALTAGLINE
Atençäo! Loja de computadores a frente! Guarde a carteira
Atheism is a non-prophet organization.
Axilla was loved by all, everyone calls him Hun.
Attack first, then get tough.
Attack long worms from the rear - that is so much safer.
Attacking primary target! Bombs away! Bombs away!
Attending physician - one who attends a dinner or party.
ATTENTION ..............Elvis has left the echo.
Attention K-Mart shoppers, today the special is...
Attractive, brilliant, clever, poised, talented, ME!
Auntie E: Hate you. Hate Kansas. Took the Dog. Dorothy.
Aural sex produces eargasms...
Australian foreplay - "Brace yourself, Sheila"
Authored "Computer Widow's Hand Book"
AUTO-DISCONNECT in .03 sec. Press any key to abort.
Autobiography: Unrivalled telling truth about others.
AUTOEROTICISM: Making it in a car.
Automated: A couple making love in a car.
Automobile mufflers don't die, they just get exhausted.
Autumn is a season followed by looking forward to spring.
Avant-Garde Narrow: a typeface for the broad-minded.
Avert misunderstanding by calm, poise, and balance.
Avoid approaching horses or restaurants from the rear.
Avoid commas, that are not necessary.
Avoid Computer virus - practice safe HEX!
Avoid fighting with the ugly, they have nothing to lose.
Avoid home accidents, joined planned parenthood.
Avoid junk mail, get an unlisted ZIP code.
Avoid Mailmen...............They Are Carriers.
Avoid making irrecovable decisions while tired or angry.
Avoid polysyllabification.
Avoid reality at all costs.
Avoid September.
Avoid sexually transmitted disease; practice monotony.
Avoid the 5 o'clock rush - leave work at noon.
Avoid The Noid.
Aw, come on, just this one last little feature...
Aw, come on, Spock, pull my finger.
Aw--give it a rest already!
Awwww... it's just a harmless little Bunny!
Aye carrumba! No Simpsons conference on this board!
Baby oil is NOT made by squeezing babies...
Baby Philosophy - If it stinks, change it.
Bach is like a jetstream -if you can get on it, you soar!
Bachelor's wives and spinster's children: always perfect.
Bachelor: A rolling stone that gathers no boss.
Bachelor: A guy who has cheated a woman out of a divorce.
Bachelor: Plays the field until the field comes in.
Bachelorhood should be taxed, such happiness is valuable.
Back when I was a boy, we carved our own ICs out of wood.
Backup not found. (P)anic, (S)uicide, (K)ill bystanders?
Backup not found. Want a gun or sleeping pills?
Backup not found: (A)bort (R)etry (P)anic
Backup not found: (A)bort (R)etry (T)hrowup
Backup not found: (S)o? (R)emain Calm (D)estroy computer.
Backup not found: Abort, Retry, Massive heart failure?
Backup? I've never had troubl**&{[} 3$$ERROR
Backups are for wimps!
Backups? We don' *NEED* no steenking baX%^~,VbKx.
Bad command or file name! Go stand in the corner.
Bad command. Bad, bad command! Sit! Stay! Staaay..
BAD cop! NO doughnut for you!
Bad Credit? No Credit? No Problem. No Money? Problem.
Bad is never good until worse happens -- Danish proverb
Bad Law 2: FELONY; F)ree E)xit L)ike O)ver N)ight Y)all
Bad luck and trouble are my only friends...
Bad officials: elected by good citizens who fail to vote.
Bad or Missing SYSOP
Bad spelers of the word, untie.
Bad taste is timeless.
Bad to the bone. I'm babababad to the bone!
Baffle them with bovine defecation.
Bag of Tricks: patrons busted at the local brothel.
BAH HUMBUG!
Baker's dozen of roses: 12 flowers, 1 hug.
Bald spot? No - solar panel for superior brain power!
Baldar of Borg: We will assimilate mass quantities!
Banging head against wall mode = OFF.
Bank error in your favor. Collect $200.
Bank Rule: To get a loan, first prove you don't need it.
Banks are never open when it might be convenient.
Baptism: A kind of damp bar mitzvah.
Barfing dogs never bite
Barium - what you do when CPR fails.
Barney and Baby Bop MUST DIE!
BARNEY MUST DIE! BARNEY MUST DIE! BARNEY MUST DIE!
Barnum was wrong .... it's more like every 30 seconds!
Barometer: Indicates what kind of weather we are having.
Baroque: When you are out of Monet.
Bartlett: small, familiar quotation by the Simpson's son.
Basic Airline Flying: Keep pointy end forward !!!
BASIC isn't; C stands for Confusing...
BASIC programmers never die, they GOSUB and don't RETURN
BASIC shampoo - DO:LATHER:RINSE:LOOP UNTIL CLEAN <> 0
BASIC: Beginners' All-purpose Symbolic Identity Crisis?
BASIC: _Best_ all-purpose symbolic instruction code.
Bastard toadflax: not the result nearsighted horny toads.
Bathing Beauty: A girl worth wading for.
Bathroom scale: Something you stand on and swear at.
Batteries not included.
Baud, James Baud. - famous British spy/modemer
BBQ Yourself!
BBS 'till you drop - carrier
BBS = Belly Button Surgery - a belly button transplant.
BBS addiction in a terminal disease.
BBS BBS BBS BBS BBS eat BBS BBS BBS BBS sleep BBS BBS BBS
BBS Tip #45: ALT-H gives you sysop access!
BBS: a method to triple your phone bill.
BBSers: the few, the unbalanced, the eccentric!
Be a friend to the earth and it will be a friend to you.
Be Alert -- what the world needs is more LERTS.
Be Alert. (we need more lerts)
Be American, Buy American - and CHARGE IT!
Be as good at receiving as you are at giving.
Be careful what you ask for, you might get it.
Be careful when playing under the anvil tree.
Be careful when slinging mud, you might lose ground.
Be careful when you're playing under the anvil tree.
Be careful, Yogi! Mr. Ranger won't LIKE that!
Be flexible, some things just take time.
Be gentle with me now...
Be good and you will be lonesome
Be ill. We could do with a little color around the place.
Be mischievous and creative, if they fit you.
Be nice on your way up you'll meet again on the way down.
Be nice to your kids. They'll choose your nursing home.
Be one of the CULTURAL ELITE: Learn how to spell potato.
Be prepared to lose once in a while.
Be quick to act, slow to enjoy.
Be reasonable ... Let's do it my way.
Be right & fear no man. Don't write & fear no woman.
Be self-reliant and your success is assured.
Be smart as a cat: Make a friend of your enemy's enemy.
Be sober, be vigilant, and stab as occasion serves...
Be spontaneous.......combust.
Be sure to use DEVICE=EXXON to screw up your environment.
Be suspicious of all native-born Esperanto speakers.
Be suspicious of all non-native-born Esperanto speakers.
Be true to your teeth, or they'll be false to you...
BE VERY, VERY FRIGHTENED ARTHUR DENT
Be vewy, vewy quiet ... I'm hunting tagwines!
Be willing to lose a battle in order to win the war.
Be willing to take on new challenges.
Be with a child today to be in his memory tomorrow.
Beam me up Scotty! This thing just ate my phaser!!!
Beam me up Scotty. This isn't the men's room.
Beam me up Scotty.... I swallowed my Phaser.
Beam me up, Scotty -- it ate my phaser.
Beam me up, Scotty, but leave the others here.
Beam me up, Scotty, This planet sucks!
Beam me up..uh..uh... Spock what's that guys name again?
Bear takes over Disneyland in Pooh D'Etat!
Beat me! Whip me! Make me return to 1200 baud!!
Beat me, whip me, make me read my messages ONLINE!!
Beat's me!!! I never read the documentation.
Beautify America--Plant a lawyer! (Deep)
Beauty faded has no second spring.
Beauty is also to be found in a day's work.
Beauty is in the eye of the beer holder...
Beauty is often in the thighs of the beholder.
Beauty is skin deep, but ugly goes straight to the bone.
Beauty seldom recommends one woman to another.
Beckhap's Law: Beauty times brains equals a constant.
Become a programmer and never see the world!!!
Bedfellows make strange politicians.
Bedpan - larger than a pie pan.
Been dazed & confused for so long I don't know what to do
Been short on oxygen one time too many.
Been there, done that, got the T-shirt.
Been through Hell?? What did you bring me??
Beep! Invalid Input. I take only cash....
Beer and women: Two of God's best gifts to mankind.
Beer will be the urination of me!
Beer! Now there's a temporary solution.
Beer. It's not just for breakfast anymore.
Beer: God's gift to the working slob.
Before advising be yourself, reassess his character.
Before the garlic press were the Dark Ages of Cooking.
Before the Krikkit wars the galaxy was a happy galaxy.
Before you act, thimk.
Beginnings and endings are truly artificial constructs.
Behaviorism is the art of pulling habits out of hats.
Behind an able man, there are always other able men.
Behind every argument is someone's ignorance.
Behind every broken man there's a woman.
Behind every great computer lies... a mess of wires!
Behind every successful man is woman with nothing to wear
Behind every successful man is an astonished Mother-InLaw
Behind every successful man stands a surprised MIL.
Being a "nice guy" doesn't cost, but it generally pays.
Being a husband is a full time job.
Being able to say NO is the root to reclaiming your life.
Being alive: Concentrating on goals, not limitations.
Being like several thousand square miles of junk mail.
Being married means making both love *AND* war.
Being old fashioned is not necessarily good or better.
Being over the hill makes it easier to run.
Being overweight just sort of snacks up on you.
Being punctual makes people think you have nothing to do.
Being superstitious brings bad luck.
Being too obvious is neither useful nor tasteful.
Ben Dover & C. Howit Feils, Attorneys at Law
Beneath every stone sleeps a scorpion.
Benign: What you are after you be eight.
Benji! Don't run out in the street! $#%!@& - NO TERRIER
Benji! The lion -- &&^*#&& NO TERRIER
Best advice for Tarzan? Don't let go of the vine.
Best diet: Eat as much as you want, but don't swallow it.
Best existing drink is the Pan Galactic Gargle Blaster.
Best file compression around! "DEL *.*" - 100% comp.
Best reason to have dreams? Dreams don't require reason.
Best seller: Schizophrenia -- Unauthorized Autobiography
Best thing about the future: it comes one day at a time.
Best way to appreciate a job: imagine yourself without it
Best way to keep your friends: don't give them away.
BETA Busters - On The Bleeding Edge of Technology!
Beta testers do it until it breaks.
Beta testing -- the bleeding edge of technology...
Beta testing is hazardous to your health.
Better a coward for a minute than dead forever.
Better is the death knell for Good Enough
Better loved and lost than never lost at all.
Better or worse, but never the same.
Better the shoulder to the wheel than the back to the A I
Better three hours too soon than a minute too late.
Better to marry a man who loves you than one you love.
Better to understand little than misunderstand a lot.
Between two evils, I always pick the one I haven't tried.
Beulah, peel me a grape.
BEWARE - Tagline Thief on this echo.
BEWARE - there's a Tagline Thief on this echo!
Beware of a tall dark man with a spoon up his nose.
Beware of all enterprises that require new clothes.
Beware of friends who are false and deceitful.
Beware of geeks bearing GIFs!
Beware of hip and rum drivers.
Beware of little expenses. A small leak can sink a ship.
Beware of low-flying butterflies.
Beware of opinions of anyone with or without any facts.
Beware of plants that eat their young
Beware of programmers who carry screwdrivers.
Beware of quantum ducks: quark, quark.
Beware of the man who won't be bothered with details.
Beware of the opinion of someone without any facts.
Beware of the person who has nothing to lose.
Beware of the Quantum Ducks -- QUARK QUARK QUARK.
Beware of the woman who does not drink.
Beware of true believers you may be duped by a false god.
Beware the granfalloon.
Beware the person who has nothing to lose. He always wins
Beware when God lets loose a thinker on this planet.
Beware! I'm armed and have PMS!
BEWARE! I'm armed, and I have an ATTITUDE!
Beware! I'm armed and have premenstrual tension.
Beware! This is a dangerous product, manuals required.
Beware. I'm armed and have suffered from PMS all my life.
BEWARE...Tagline protected by guard dogs!
Biblical Typing Method: Seek and Ye Shall Find.
Big Brother is watching.
Big or small We tax them all.
Big things come in .QWK packages.
Bigamist: An Italian fog.
Bigamist: guy who makes the same mistake twice.
Bigamist: One who makes the same mistake twice.
Bigamy: one wife too many. Monogamy: same idea.
BIGAMY: only crime where two rites make a wrong.
Bigamy: Too many wives. Monogamy: Same thing.
Biggest lie: "The game's almost over, honey..."
Bikini: a device for the visually enpaired.
Bill Clinton is the Abraham Lincoln of the gay & lesbian com
Bill Clinton was born with a silver corn cob in his WHAT?
Bill Clinton: The Milli Vanilli of presidents.
Bill Gates: For whom the belle toils! :)
Binary Choir = 1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1.
Biochemists wear designer genes.
Biography should be written by an acute enemy.
Biography: One of the terrors of death.
Biological love =/= chemical love.
Biology grows on you.
Biology is destiny.
Birds are trapped by their feet, people by their tongues.
Birds of a feather flock together.
Birthdays are significant. Without them you're dead.
Bisexuality immediately doubles your chances for a date.
Bistromathics, a new way of understanding number behavior
BIT: n.; unit by which programmers go crazy
Bitchin'!
Bits make bytes, but nibbles turn me on.
BLACK HOLE - Where God divided by zero...
Black holes are where God forgot to cancel the infinities
Black holes are where God is dividing by zero.
Black holes suck.
Black holes were created when God divided by zero.
Blackout: Electric company's general screen saver.
Blame Murphy when you dig at the wrong end of a rainbow.
Blame Saint Andreas - its all his fault.
Blame San Andreas, its all his fault!
Blaming others can become a satisfying way of life.
Bless the peacemakers their work will never end.
Blessed are the censors, for they shall inhibit the earth
Blessed are the meek, for they make great scapegoats.
Blessed are the pessimists, for they have made backups.
Blessed are the young, let them inherit the national debt
Blessed is he expecting nothing, and never disappointed.
Blessings never come in pairs; misfortunes never alone.
Block Parity: One heck of a good time.
Blond Mating Call: Oh, I'm so drunk [giggle].
BLOND.COM failed. Missing CPU.
Blonde dyslexics have more nuf.
Blonde Klingons: Because it was a good day to dye!
Blonde proofreader fired at M&M factory. Tossed the Ws.
Blondes are intellagint..intell.....oh forget it.:)
Blondes rule the earth, or at least earth's politicians.
Blood is thicker than water and cheaper than beer.
Blood is thicker than water, and much more tastier.
Blood is thicker than water, and much tastier
Bloody April showers. Hate, hate hate!
Blow your mind, smoke gunpowder.
Blueberries: Peas holding their breath.
BLUES IS LIFE, JAZZ IS HAPPINESS AND RAP IS CRAP.
Bo don't know Netmail.
Bo don't know QWK mail.
Bo don't know Technical Analysis.
Boasting: Patter of little feats.
Boeing 747's are big things, terrifyingly big.
Boldly go where no man has gone before then make a U turn
Boldly going Forward because we can't find Reverse!
Boldly going forward because we simply can't find reverse
Boldly going where no modem has gone before...
Boldly start in reverse, 'cause that's the genealogy way.
Bomb #20, you're out of the bomb bay again.
Bombs don't kill people, explosions kill people.
Bonafide Buck Passer.
Boob: n. 1. Someone to squash 2. Something to squeeze.
Boost system speed by 200% - DEL C:\WINDOWS\*.*
Boot & ye shall see. Replace & all will be made clear.
Boot in the root! BAT in a FAT! Backup,backup,DAT,DAT,DAT
Boozer's Revision: A bird in the hand is dead.
Bore: A person who talks when you wish him to listen.
BORE: person who is an open book you don't want to read.
Boredom -- the desire for desires -- Leo Tolstoy
Boren's First Law: When in doubt, mumble.
Borg Assimilation is the Best Cure for the Common Man.
Borg Burgers: Have'em our way, yours is irrelevant.
Borg Empire: Equal opportunity Assimilator!!!!
BORG IDIC: Incalculable Devastation for Infinite Cubes.
Borg saying: We came. We absorbed. We left.
Borg spreadsheet: Locutus 1-2-3
Borg? Where? I don't se*(#$#..NO CARRIER
BorgBurgers: Have it our way. Your way is irrelevant.
BorgBurgers: We do it OUR way. Yours is irrelevant
BorgDOS v5.0 - Assimilate Another? [Y/n]
Borger King - We do it our way! Your way is irrelevant!
Boring!
Born a day late and like that ever since.
Born Again Pagan
Born crying, live complaining, die disappointed.
Born free and taxed to death.
Born ugly and built to last.
Boss - Late when you're early, early when you're late.
BOSS spelled backwards is Double S-O-B
Boston has great beans -- at last report!
Both oars in the water, but on the same side of the boat.
Both of his feet are firmly planted in the air.
Bowlarama: Where you can play in the gutter then split.
Boy who sleep on sex problem wake with solution in hand.
Boy, I wouldn't want to be in my shoes right now!
Boy: A noise with dirt on it.
Boys will be boys, and so will a lot of middle-aged men.
Boys will be girls -- The best of both worlds
Bra: Over the shoulder boulder holder.
Bragging will only get you embarrassed later.
Brain damage? No thanks, I have more than enough!
Brain damage? No thanks, I already have some.
Brain, like muscle, works better if regularly exercised.
Brain: The apparatus with which we think that we think.
Brain: apparatus used to think we think.
Brain: The apparatus with which we think that we think.
Braise the Lord! 325 Degrees for 30 min. Add veggies.
Branch Instruction - Advice from a distant office
Brandy and water spoils two good things. Charles Lamb
Braniff ran Windows...look where it got them.
Bravery never goes out of fashion.
Break up a relationship - buy a computer!!
Breakfast in Paris, lunch in Greece, luggage in Japan?
BREAKFAST.COM Halted...Cereal Port Not Responding
Breaking Windows isn't just for kids anymore.
Breast implant silicon should not influence brains.
Breeding rabbits is a hare raising experience.
BREKFAST.COM Halted...Cereal Port Not Responding.
Brevity is the soul of lingerie.
Bride: Woman with fine prospect of happiness behind her.
Bright as Alaska in December.
Bright idea - find a passing spaceship and get rescued.
Bring back the REPUBLIC! Let's secede!
Bring home the Bacon? HECK! I brought the PIG!
Bring me my blue soap box. I want to make a speech.
Bring out your dead!
Bring the whole family...but leave the kids at home!
British automotive engineering=getting it right +/- 1/8"
Brother Maynard! Bring on the Holy Hand Grenade!
Brought to you by The Campaign to Save the Humans.
Brownout: Electric company's general screen saver.
BTW, FWIW, IMHO, yes. OTOH, AAMOF, maybe not.
BUBBA THE WONDER MUNCHKIN
Bubble, Bubble..Am I too late to jump the ship ?
Buck? What buck? Can you describe it, please?
Budget: A method for going broke methodically.
BUFFERS=20 FILES=15 2nd down, 4th quarter, 5 yards to go!
Bug free, cheap, on time, works. Pick any two.
Bugger Letchworth, if that's your attitude.
Bugs are sons of glitches.
Bugs, like coathangers, breed if unobserved.
Build a better mousetrap and along will come better mice.
Build a better Windows, and kids will still throw rocks.
Build a system a fool can use and only fools will use it.
Build a throne with bayonets, won't sit for long.
Build a vast arena, then put a half-vast team therein.
Build by steps, whether it's friendship or opportunity.
Built like a 'frigerator with a head...
Bulldozer: One who sleeps through a political speech.
Bulletin Broads Baud Better!
Bulletin Broads have better bauds!
Bulletproof jacket: slugvest.
Bumper Sticker "Honk if I'm an Aggie"
Bumper sticker: Cover me, I'm changing lanes.
Bumper sticker: Honk if you're illiterate.
Bureaucat: A kitty who sleeps on your undies...
Bureaucracy is a giant mechanism operated by pygmies.
Bureaucracy: That place always in need of a laxative.
Bureaucrat, n.: A person who cuts red tape lengthwise.
Bureaucrats cut red tape -- lengthwise.
Bury a lawyer 12 feet under. Deep down they're nice.
Bury rod deep in mother (proofer missed lightning & earth)
Bush's record: 200K dead Iraqis, one smelly Japanese PM.
BUSH.SYS corrupted, recommend optimizing politics.
Bush/Quayle ERROR: Division by zero.
Business Card: SUE and BILL SUCKERS attorneys at law
But can a bee be said to be, Or not to be an entire bee?
But for my membership fee, I'd resign the human race.
But God told me to use a GOTO.
But Honey, you NEED VGA for Dbase management!
But I did read the docs, I just didn't understand them.
But I thought YOU did the backups...
But I wanna get my mail packet, I wanna, I wanna,I WANNA!
But it SHOULD be black/white, cut/dried, dead simple...
But Ma, Johnny has all of his doors registered!
But Officer, the sign said "Speed Zone", so I did....
But once you are real, you can't become unreal again.
But soft, what light through yonder tagline breaks?
But the plans were on display...
But we've got to have product, you see.
But what does it all mean?
But you Thaid it wath a PITH helmet!
But, if ye wish her gratefu' prayer, Gie her a haggis.
Buy a 486-33 so you can reboot faster.
Buy a double-clocked 486-50 and you can reboot faster.
Buy great books even if you don't read them.
Buy low, sell high.
Buzzard Theory: Patience, Hell - Kill Something.
Buzzard: patience my ***! - I'm going to kill something.
Buzzcuts are OUT!
By following the good, you learn to be good.
By inflection you can say more than your words do.
By the time I have money to burn, my fire will be out.
By the time we've made it, we've had it.
By the way, you're soaking in it.
By trying we can learn to endure another's adversity.
Bye ... Peter Larsen - The Former Bitman
Bye bye for now.
Bye!
BYTE ME...BYTE ME...BYTE ME...
Bytes - I got millions of 'e!
C code run. Run code run!
C code. C code run. Run code, run. PLEASE!
C program run. C program crash. C programmer quit.
C program run... Run, program, run... PLEASE...
C Programmers do it with models!
C programming means never having to say you're done.
C'est la vie.
C**a**m**o**u**f**l**a**g**e*****T**a**g**l**i**n**e*
C:> COFFEE.COM error. Contact programmer J. Valdez.
C:> COFFEE.COM missing SysOp halted
C:\> The stick shift of computing.
C:\DAMSEL.EXE x-linked with DISTRESS.COM. RESCUE? (y/n)?
C:\DOS C:\DOS\RUN RUN\DOS\RUN
C:\WIN C:\WIN\RUN Well, could ya at least walk faster?
C:\WINDOWS C:\WINDOWS\GO C:\PC\CRAWL
CA bumper sticker: Cover me, I'm changing lanes.
Cache me if you can.
Cache Me... If You Dare
Cahn's Axiom: When all else fails, read the instructions.
Calf brains: food for thought?
California is a fine place to live, if you are an orange.
California makes the best wine, New York the best whine.
California raisins murdered! Cereal killer suspected.
Call me if you need my phone number!
Call out the vice squad. Someone's mounting a disk drive
Call the AEC! My teen's room is RADIOactive!
Call this number for illiteracy help: 555-READ.
Call waiting is great if you have two friends!
Call waiting, great if you have two friends.
Call Waiting: "The mother of all inconveniences"
Call your Mother.
Calling her stupid would be an insult to stupid people.
Camelot! Camelot! Camelot! (It's only a model) Shhhh!
Camels have wet dreams too.
Can a blue man sing the whites?
Can bankers count? Eight windows and only four tellers?
Can Barbara Stanwyck less candles?
Can Betty Field invitations gracefully?
Can Blair Brown fried chicken without burning it?
Can Diana Rigg a fishing line?
Can God make a rock so big He can't lift it?
Can Harrison Ford the river?
Can I blame all of my spelling on line noise?
Can I call you 'Ms. Dos'?
Can I go back to bed now?
Can I yell "movie" in a crowded firehouse?
Can Lori Singer dance?
Can Madeline Kahn her way into a major motion picture?
Can Molly Ringwald in pond?
Can O' Worms. Open, Heat, & Eat. Ready in 15 mins.
Can Pamela Reed and write?
Can Pamela Seagall and other emotions?
Can Patty Duke it out with studio heads?
Can Rachel Ward off amorous advances?
Can Sally Field pop flies?
Can we hurry this up? I'm playing a game now.
Can we play a game now?
Can we talk?
Can you do the Picard Maneuver in a Grand Am?
Can You Guess What Thomas Crapper Invented?
Can you imagine conning eight cats into pulling a sled?
Can you imagine that?
Can you open your mind without it falling out?
Can you prove it didn't happen?
Can you see it Joker? It's written all over my face.
Can you teach an old hooker new tricks?
Can you teach new dogs old tricks?
Can you tell me how to get, how to get to Sesame Street?
Can't close PANTS.ZIP - replace floppy and try again
Can't Conceive Intelligent Thoughts Today.
Can't learn to do it well? Learn to enjoy doing it badly!
Can't see for looking.
Can't see it? It's there. I'm using stealth technology.
Can't see the wood for the trees.
Can't wait for them 100Gb, 10ns drives!
Can't you see I'm on the phone?
Can't you see the violence inherent in the system?
CANADA -- Nine months of winter, three of bad skiing.
Canadian Dos prompt= "Like,Insert Disk #1,eh"
Canadian DOS: Yer sure, eh? [oui/non]
Candy is dandy, but lick her is quicker.
Candy is dandy, but liquor is quicker.
Cannibal: guy who goes to restaurant & orders the waiter.
Cannot find REALITY.SYS. Universe halted.
Canonize Ward Christensen, Patron Saint of BBS's.
Cap'n Hook's chat line - 1-900-ARR-RRGH ($9,995.87/min)
Cap'n, th' tagline dinna say anyth'n'!
Capitalistic man exploits man; Socialism reverses this.
Captain, BBS-Zone approaching, should I raise shields?
Captain, I protest. I am NOT a merry man! - Worf
Captain, I sense a commercial coming. Troi
Captain, please! Not in front of the Klingons.
Car 54! WHERE ARE YOU!??!
Car service: If it ain't broke, we'll break it.
Care to trip the lite fantastic?
Careful planning is the key to safe and swift travel.
Carelessness does more harm than a want of knowledge.
Carpe Diem -- Make your life extraordinary!
Carpenters are just plane folks.
Cash, a poor person's credit card.
Cashiers, not nurses, should wear masks in hospitals.
Castrate - the hotel rate for actors.
Casual Sex: When a body meets a body o're a pint of rye..
Cat mystery: Why did it become a domestic animal?
CAT PROBLEMS: Drawers that make no allowance for tails.
Cat Problems: Getting tail caught in doors.
Cat Problems: Hairballs.
Cat Problems: Having to wear a license just to walk around.
Cat Problems: HEAT!
Cat Problems: Trousers that make no allowance for tails.
Cat Problems: VETS!
Cat: a nice animal, frequently mistaken for a meatloaf.
Catastrophe: an award for the cat with the nicest buns.
Catastrophes to others are everyday events to you.
Catch the Blue Wave!
Cats are like furry dilettanti, or the reverse?
Cats don't adopt people. They adopt refrigerators.
Cats teach that not everything in nature has a function.
Cats took many thousands of years to domesticate humans.
Cats, proof that eating and sleeping isn't all bad.
Cats: God's way of telling you your furniture is too nice
Cats: proof that eating and sleeping isn't all bad.
Cats: Smarter than dogs; can't find 8 to pull snow sled.
Cats: They're not so brave in your microwave.
Catscan - a hi-tech device for examining cats.
Caught cheating with shoes off; reading footnotes.
Caught smokin' in the boy's room.
Caution - School Can Interfere With Your Education!
CAUTION! The writer of this tagline has a .QWK wit!
Caution! - BUG Bashing in progress - Caution!
Caution! - Bug squashing in progress.
CAUTION! Taglines may be hazardous to your disk space!
Caution: Breathing may be hazardous to your health.
Caution: High Pressure!!! Contents are PKZIPPED!!
CAUTION: Off Medication and Dangerous
Caution: SysOp under pressure!
Caution: This tagline stops for page breaks.
Cautious silence is where prudence takes refuge.
Cavorting about like that isn't proper behavior. ■ Picard
CCITT- Can't Conceive Intelligent Thoughts Today
CD-ROM: Cash Demand-Ran Out of Money
CDA: Computer Dumb Ass
CD\shutdown\logoff\bar\beer\music\girl\car\bed\sex\sleep
Celebrate Hannibal Day. Take an elephant to lunch.
Celebrate the first day you open the windows.
Celery farmers play the stalk market.
Celery raw develops a jaw. But stewed, is quietly chewed.
Celibacy is NOT hereditary.
Celibacy isn't hereditary. Your children force it on you.
Celibacy: most unnatural of perversions.
Cemetery: (n); A marble orchard you can take for granite.
Censorship is something ██████ ████ I do ███ like!
Cereal Killer Strikes Again! Cap'n Crunch found dead...
Certe, Toto, sentio nos in Kansate non iam adesse.
Cesarean Section - a district in Rome.
Cesarean Section: A historic district in Rome.
CGA is the pallete from hell
Chain letters should be wrapped around the senders neck.
Chain tagline! Copy or bad luck will follow!
Chain Tagline: Now stolen [9] times.
Challenge is the fuel that drives the winner.
Chance makes our parents, but choice makes our friends.
Change is inevitable ... except from vending machines.
Change is inevitable...except from a vending machine.
Change your mind. Or, at least, repair it!
Character is much easier kept than recovered.
Character is the sum total of all our everyday choices.
Charity begins at home, and mostly ends where it begins.
Charm: way to get "yes" without asking a question.
Chaste makes waste.
Chastity Belt is here. Do you have the right key?
Chastity is its own punishment.
Chastity: the most unnatural of the sexual perversions.
Check the dilithium crystals, we've got a cross-echo.
Check your seatbelt. I wanna try something...
Cheer up. We all make mistakes that we regret forever.
Cheese? We don't actually *have* any cheese...<g>
Chelsea: "Dad, I want you to meet my new boyfriend, Rush
Chemistry professors never die, they just fail to react.
Chemistry professors never die, they just smell that way!
Chemists have mixed reactions...
Cherishing children is the mark of a civilized society.
Chernobyl was operating under Windows.
Chestnuts - a painful, embarrassing condition.
CHEW GUM 101 - Where Aggies learn multitasking.
Chicken heads are the chief food of captive alligators.
Chicken Little only has to be right once.
Chicken Little was right.
Chicken on the go: poultry in motion.
Chicken Sneakers: Re-bok-bok-bok!
Chief of Protocol..................Roseanne Barr-Arnold
Child birth: Having a Buick drive through your abdomen.
Child conceived in automatic becomes shiftless bastard.
Childish Game: One at which your spouse beats you.
Children and grandparents are natural allies.
Children are curly, dimpled lunatics.
Children are grotesque and no one must make another one.
Children deserve to be wanted, and feel free and safe.
Children have more need of models than of critics.
Children who eat Crayons download in Technicolor.
Children, when ignored, eventually go away.
Children: Pure love contained in soft packages.
Children: the most common sexually transmitted disease.
Chipmunks roasting on an open fire.
Chocolate coat them words. You'll be eating them later.
Choose good habits to break old ones.
Choose heaven for climate, hell for society.
Choose your friends, allow your enemies to choose you.
Choose your mentors wisely.
Choosey cats prefer Microsoft mice, 10 to 1.
Choosy modemers choose GIF
Choosy perverts choose .GIF!
Chopped Cabbage; not just a good idea, it's the slaw!
Chornologically gifted: old
Christ died for our sins, so let's not disappoint him.
Christmas shopping: It's a Jingle out there!
Christmas: It's a Jingle out there!
Chronic Sinus Problems: Paying through the nose.
Chuckle?
A cigar is just a cigar.
Cigarettes: Money to burn.
Circular Definition: see Definition, Circular.
Circular logic will only get you dizzy.
Circumlocutional moreaclasty
Cities, like cats, will reveal themselves at night.
Citing you for poor taste. The Tagline Police
Civil Servant is semantically equal to Civil Master.
Civilization is a movement, it is a voyage not a harbor.
Civilized people need love for full sexual satisfaction.
Claiming mental bankruptcy is always an easy option.
Clap ON<clap clap>Clap OFF<clap clap> NO CARRIER
Clairvoyant meeting canceled due to unforeseen events.
Clark Kent is a transvestite.
Classic: a book people praise, but never read.
Classics were written by famous dead foreigners.
Classified ad: Hot tub, seats eight, rearly used.
Classified tagline == Please enter password.
Clean mind, clean body: Take your pick.
Cleanliness is next to clean-limbed, in the dictionary.
Cleanliness is next to impossible.
Clear the decks!!, Here comes another thought!
Clever father, clever daughter; clever mother, clever son
Click ... click ... click ... damn, out of taglines!
Click...click...click...damn, out of new taglines.
Clients who pay the least complains the most.
Climate is what we expect, weather is what we get.
Climbing my family tree was fun until the nuts appeared.
CLINTON - The Courage to Quit
Clinton Borg * Inhaling is irrelevant.
Clinton has what it takes to take what you have.
Clinton may not have inhaled but Brown has never exhaled.
Clinton Program failure. I still have $1 left.
Clinton's Army- Where men HAVE to be separated from boys!
CLINTON.SYS corrupted, recommend optimizing politics.
Clinton/Gore: Divide Zero by Zero error!
Clones are people two.
Cloning is the sincerest form of flattery.
Close your eyes and press escape three times.
Closed Captioned in HEX for Programmers.
Closed eyes are not always sleeping.
Closed Hearing for Caption Impaired.....
Closing bid, ask, and total sales of stocks not traded.
Closing on ship target. Music on! Fire away!
Clothes captioned for the weather impaired.
Cloverleaf captioned for the Highway impaired.
Clowns to the left of me, jokers to the right...
Clues captioned for the mystery impaired.
cmprssd tglne
Cobol programmers are down in the dumps.
COBOL programmers understand why women hate periods.
COBOL programs are an example of artificial inelegance.
COBOL, like cancer, can be cured if deleted early.
Cocaine: God's way of telling you you make too much money
Code error...attempt to traverse chasm in two leaps.
Coed dorms promote campus unrest.
Coffee Loaded -- Operator Resumes
Coffee not found - (A)bort, (R)eheat, (T)remble?
Coffee sweetened with NO-DOZ...Programmers' fuel....
COFFEE.COM not found: A)dd more, R)eheat F)reak out.
COFFEE.EXE Missing - Insert Cup and Press Any Key
Cogito ergo spud: I think therefore I yam.
Cogito, Ergo, Hormel - I think, therefore I Spam.
Cogito, Ergo, Spud: I think therefore I yam.
Cogito, Ergo, Tutti Frutti
Cold pizza: the generic breakfast
Cole's Law: Thinly sliced cabbage.
Colic: a sheepdog that is part collie.
Collect all taglines series! TAGLINE NUMBER 8/10
Collector: Person few care to see but ask to call again.
College isn't the place to go for ideas.
College: Guarantee the quality of the product or return.
College? It was the best 7 years of my life!
Columbus HAD a fourth ship -- it sailed over the edge.
Columbus Typing Method: Discover it and land on it.
COM program murdered. "Bits everywhere" says witness.
Coma - a form of punctuation.
Coma bastante frango: faz bem `a saude !
Come and see the violence inherent in the system
Come back to Detroit, we missed you the first time!
Come back to Oakland, we missed you the first time.
Come now or you will be late.
Come on in; my day was going bad anyway.
Come, Watson, come! The game is afoot.
Comedy is the art of making people laugh without puking.
Coming events cast their shadows before.
Coming soon from Microsoft Foods: Animal Hackers
Coming Soon!! Mouse Support for Edlin!
Coming soon......Turbo Edlin !
Coming soon: Netware for the Nintendo!
Coming to a TV soon, 'Days of Our Modems'
Command interpreter missing. Insert system disk in C:
Command Not Understood. . . Now erasing Hard Drive
Committee: A body that keeps minutes and wastes hours.
Committee: A life-form with several mouths but no brain.
Common politics: Holding an office of trust for profit.
Common sense is the uncommonest sense of all...
Common sense isn't.
Commoner's Law of Ecology: Nothing ever goes away.
Communicate with Digicom Scout Plus Modems
Communication.. without it, everyone's a mushroom.
Communism is like one big phone company.
Communism will work when love, not greed, inspires it.
Communists do it without class.
Company coming? House a mess? Display old Get Well cards.
Compaq: If they can't spell can their systems be good?
Compiling...Linking...Dialing Copyright Lawyer...
Complaints provoke insolence and more complaints.
Complaints? Write them here legibly [] <-
Complex problems have easy to understand wrong answers.
Complexity isn't the answer - it's the problem.
Compliments of the Itty Bitty Machine Company.
CompuCrumb SPUDModem Detected; System hanging up now...
Compulsive shopper: someone with a debt wish.
Compuphobia: Fear of being without electronic games.
Computations which yield 0 are probably all for naught.
Compute, compute, compute! That's all you want from me!
Computer artist dies: .GIF at eleven!
Computer Lie #1: You'll never use all that disk space.
Computer not found! Please notify tagline!
Computer protected by Pit Bull with AIDS.
Computer Science -- solving today's problems tomorrow.
Computer Science is embarrassed by the computer.
Computer Virus - a way to reach out and touch someone.
Computer, get my brain care specialist on the line.
Computer, microwave decks 5-10 until piping hot. BEEP!
Computer: a device designed to drive human beings insane.
Computers also eliminate spare time.
Computers are not intelligent. They only think they are.
Computers are OUR business, our ONLY business
Computers are unreliable, but humans are more unreliable.
Computers byte and run.
Computers don't make mistakes, but foolish people do.
Computers don't mind being used by strangers.
Computers eliminate spare time
Computers Make Very Fast, Very Accurate Mistakes..
Computers will never replace Human stupidity.
Computing is one of the terminal diseases.
Computing power increases as the square of the cost.
CON is the opposite of PRO - i.e. Congress and Progress
Condense soup, not books!
Conferencing is addictive!
Confession is good for the soul, but bad for your career.
Confidence is contagious. So is lack of confidence.
Confidence is the feeling you had before you knew better.
Confirmation of the past is often the greatest surprise.
Confucious say too damn much!
Confucius say....Ring on her finger = Ring in your nose
Confucius say: Man with hand in pocket is having a ball.
Confucius say: Show-off always shown up in showdown.
Confused? Call Counselor Troi, 1-900-NCC-1701, $1.95/min.
Confusion not only reigns...it pours!
Congenital - friendly.
Congenital: Adjective synonymous to "friendly."
CONgress (n) - Opposite of PROgress
Congress finds more profit in supporting tobacco than you
Congress hammers out budget; we get nailed.
Congress is the FBI - Federal Bureaucracy of Inaction.
Congress now practices safe checks.
Congress: a life form with 1070 feet and no brain.
Congressional Bank -- checks, no balances
CONNECT 300?!? Help! I'm in s l o w m o t i o n !!
Conrad's Conundrum: Technology don't transfer.
Conscience is what hurts when everything else feels good.
Conscience: the inner voice warning somebody is looking.
CONSERVE HUNTERS; HARVEST ONE TODAY!
Conserve water. Ban salted peanuts.
Consider ignorance as the cause rather than arrogance.
Consistency is the last refuge of the unimaginative.
Constant change is here to stay.
Constants aren't; variables don't.
Constipated Elderly Couple: "Ibm if ubm."
Constipated engineers work it out with a slide rule.
Constipated? Try QWKDump for fast relief!
Constrict - to build a rickety building.
Consult a real expert - Call your mother!
Consult with a real expert - Call your mother.
Contains no user-serviceable parts.
Content has been cleared through Star Fleet Headquarters,
Contents may settle during shipping.
Contents of this tagline may have settled during shipment
Contentsoftaglinemaysettleduringshipping.
Contraceptives: to be used on all conceivable occasions.
Contributes to the population problem.
Control Data: don't let it control you.
Conviction: What few criminals get nowadays.
Convictions are more dangerous enemies of truth than lies
Copper wire: created by two lawyers arguing over a penny.
Copywight 1991 Elmer Fudd. All wights wesewved
Corporations don't care about people as much as money.
Correct me if I'm wrong ... everybody else does.
Correct me if I'm wrong... at your own risk.
Corrugated iron is really groovy.
Corruption. The most infallible symptom of liberty.
Could someone please explain the rules to the barbarians?
Couldn't be more appropriate.
Couldn't have sid it better myself.
Couldn't repair the brakes, so I made your horn louder.
Counsellor Troi, will you please reformat Data!!
Country music causes severe trigger-finger itch.
Couples without children know how you should raise yours.
Courage is fear that has said its prayers.
Courage is your greatest present need.
Courage: fear extinguisher.
Courteous And Efficient Self-Service.
Courtroom Apparel: Class-action Suit
Cover line on SELF magazine: Be An Optimist In Two Weeks
Cover me, I'm going in...
Cow's breath attracts mosquitoes and tsetse flies!
Cowabunga, dude!
Coward: One who in thinks with his legs.
CPAV Warning: (S)top (C)ontinue (B)urn infected disk
CPAV: Inferior virus detection pack detect del y/n?
cpelling shecker seems to be fine now
CPU - Random number generator
CPU time flies when you're having fun.
CPU to VIDEO: "I'm just waiting for the bus."
CPU: Makes brain farts visible.
Crashed? I wasn't even driving.
CRC: Cash Real Critical.
Cream rises to the top...so does scum.
Create your own opportunity: Blackmail a senior executive
Creativity demands curiosity in the search for knowledge.
Creditors have much better memories than debtors.
Crewman @TOFIRST@, step on that rock! <BOOM>
Crime does not pay...as well as politics.
Crime must pay; the politicians are seeking reelection.
Crime wouldn't pay if the Government ran it!
Criminal lawyer. Isn't that redundant?
Criminal: The poor guy who gets caught.
Crippleware? Market It Yourself!
Critical error: (S)hout, (S)mash, (B)uy a mac.
Criticism comes easier than craftsmanship.
Cross ball points with coat hangers so they multiply.
Cross giraffe wiht ostrich, really stick your neck out.
Cross Lassie with cantaloupe and get a meloncollie baby.
Cross mosquito with rabbit, get a bug's bunny.
Cross oyster with owl, get pearls of wisdom.
Cross-country skiing is great in small countries.
Cry "havoc!" and let slip the dogs of email.
CS>Click click click damn, out of taglines!
Cult: A group without enough people to make a minority.
Curds are whey out.
Curiosity didn't kill the cat. I got 'im with the mower!
Curiosity killed the cat. What the heck they got 9 lives.
Curly; " Oooh, short wave?" Moe: "No, permanent."
Curmudgeons are cantankerous and churlish.
Cursor's flashing but there's no response.
CURSOR: What you become when your system crashes
CURVED UNIVERSE THEORY: What goes around comes around!
Custom is the law of fools.
Cut my pizza in six slices, please; I can't eat eight.
Cute rots the intellect.
CYA: means you either say goodbye or kiss it goodbye.
Cyberspace forever and ever and ever.
Cynic: Through rose-colored glasses with a jaundiced eye.
Cynicism is intellectual dandyism.
D'Artagnan - The Chivalrous Musketeer!
D.A.M.N.: Naked Men Against Dyslexia
D.A.M.N.: Naked Mothers Against Dyslexia
Dachshund: Half a dog high by a dog and a half long.
Daddy! Let me push a(*$#!@# NO CARRIER
Daddy, what does "FORMATTING DRIVE C:" mean?
Daddy, what does 'Formatting C:' mean?
Daddy, what does 'read error in FAT' mean?"
Daddy, what does FORMATTING DRIVE C mean?
Daddy, What does this {BEEP!} red button do?
Daddy, why doesn't this magnet pick up this floppy?
Dain bramaged.
Daisy, Daisy, give me your answer true.
Dam und blazt! Ze Germancodepage iz svitchedin agen ...
Dammit Bones, I'm a captain, not a doctor!
Dammit Jim, I'm a doctor, not a tagline writer.
Dammit no! Don't pick on the pho^$ L%æ#!░╗
DAMN RIGHT IT WAS!"
Damn the baud rate, full speed ahead.
Damn the documentation! Full speed ahead!
Damn this hobby is expensive!
Damn touchscreen, has anyone see my braille tagline?
Damn your "Once more for old times sake."
Damn! Outta Antimatter. I told Geordi $50 wasn't enough!
Dan Quayle asks: "Are Cheerios are bagel or donut seeds?"
Dan Quayle has all the charisma of a speed bump.
Dan Quayle has the charisma of a speed bump....
Dan Quayle library burned, both books lost.
Dan Quayle: the EDLIN of vice-presidents.
Dan Quayle: Role model to all invertebrates.
Dan Quayle: the EDLIN of Vice-Presidents.
Dancing with a grass widow brings on hay fever.
Dancing with Wolves, Sleeping with beavers
Dancing: A vertical manifestation of a horizontal desire.
Dang! That's a big request!
DANGER ! Clay Pigeon Roost Zone... Covered Parking... $3
DANGER! DANGER! Computer store ahead...hide wallet.
Danger, @TOFIRST@! Off-topic messages! Danger!
DANGER. Human at keyboard.
Dangerous exercise: jumping to conclusions.
Dangerous words when skiing: "Follow me!"
Danny Glover/Kenny Rogers get the hell outta Texas!
Dare to dream - no one can take that away from you.
Darmok and Jhilad at Tanagra
Darth Vader sleeps with a Teddywookie.
Data becomes violently ill with a computer virus.
Data Data Everywhere, And Not A Byte To Eat!
Data lanes not car pool lanes.
Data, data everywhere, and not a byte to eat!
DATABASE: the info you lose when your memory crashes.
Dating: Social Anxiety.
David Duke for Attorney General
David Duke: A crazy quilt is more apropos than a sheet.
David Duke: He climbs into bed and he's in uniform.
David Duke: Same old sheet.
David Duke: Sheet for brains.
Dawn: The time when men of reason go to bed.
Day of inquiry. You will be subpoenaed.
Day-by-day a day goes by.
De los sos ojos tan fuertemientre lorando.
Dead blonde in a closet? Winner of 1987 Hide & Seek Award
Dead, huh? Well, that's one less thing. ■ Beverly
Deadwood. Nineteenth Century Earth. The Ancient West.
Dealers depend on con shows for their bread and butter.
Dear Santa, been good, want *FAST* modem!
Dear Santa, I want a copy of your list of naughty girls.
Dear Santa. Been Good. Want *FAST* Modem!
Death and taxes are both certain, but death isn't annual.
Death awaits you all with nasty, big, pointy teeth..
Death is certain, life isn't.
Death is life's way of telling you you've been fired!
Death is nature's way of recycling human beings.
Death is nature's way of telling you to slow down.
Death is proven to be 99.9% fatal to all laboratory rats
Death takes its toll. Please have exact change ready.
DEATH TO THE PURPLE PESTILENCE! B*RN*Y MUST DIE!!!
Death, life's way of saying "Keyboard time expired."
Death: Failure to fulfill one's wellness potential.
Death: Input past end of file error.
Death: The unfortunate side effect of attacking a cop.
Decadent Capitalist and proud of it!
Decide how we are valuable, not how valuable we are.
DECON Rat Poison will get rid of that mouse...
Deduct went over defence, defeat before detail.
Deep faith eliminates fear.
Deep Space Nine: The Third Coming of Star Trek!
Defeat even explained well stinks.
Defeat is worse than death since you have to live with it
DEFINE: De ting you get for breaking de law.
Degeneration - rationing degenerates.
DEL *.* Does WHAT?
DEL *.*: 100% file compression.
del Banquo.* del damnspot.*
Del dicho al hecho hay gran trecho.
deltaV=g*Isp*ln(Mr)...not just a good idea, it's the Law!
Demand a 9600 BAUD psychomodem and a telepathic protocol.
Democracy can withstand anything but militant democrats.
Democracy rests on a shared understanding of limits.
Democracy, the worst government except for all the others
Democracy: 3 wolves and a sheep voting on dinner.
Democracy: act of running a circus from the monkey cage.
Democracy: raft that won't sink, but your feet stay wet.
Democracy: system to elect rascals of your own choosing.
Democracy: the average man believes he's above average.
Democratic rule: "Confusion creates jobs."
Democrats: We've got what it takes to take what you got.
Demons are a Ghouls best Friend.
Dental X rays are toothpics...
Depart in pieces.... i.e., Split.
Department of Redundancy Department
Dermatologists give rash judgments.
Desecrate, decimate, rah. rah. rah.
Design flaws travel in groups.
Desk: A very large wastebasket with drawers.
Desperate - Position Needed. Call M. Gorbachev, Russia
Despite the high cost of living, it remains popular.
DESQview: Windex.
Dessert? I'll take a piece of cherry π.
Destiny is not a matter of chance but a matter of choice.
Destroy the Borg? Let's give them Windows.
Desufnoc Yrev Si Enilgat Siht
Detach the saucer, Data. Don't spill the tea!
Detour: The roughest distance between two points.
Detroit is Cleveland without the glitter.
DEVICE=EXOR.SYS ... Cure for demonic computers
DEVICE=EXXON.SYS may mess up your environment
DEVICE=FUBAR.SYS /E
Devote attention to good exit, not favorable entrance.
Devoted to the study of cat bathing as a martial art.
Dew is the tears which the stars weep.
Dewey, Cheatam, and Howe - Auditors
Diagonally parked in a Parallel universe.
Diamonds, but for patience, would be coal.
Diaper Service: Rock-A-Dry Baby
Diarrhea of the mouth; constipation of the ideas.
Did *I* write this drivel?
Did Aladdin really find a GEnie in a lamp?
Did Alexandra Hay the horses this morning?
Did Alice Carter things upstairs?
Did Debra Winger way to Hollywood?
Did Donna Reed cue cards on her old show?
Did Eleanor Parker own cars?
Did Elizabeth Taylor her own clothes?
Did Helen Shaver head for her last role?
Did Humpty Dumpty have major medical insurance?
Did I do that?
Did I mean what you said I think?
Did Jennifer Connelly Marvin?
Did Lee Grant acting lessons for her daughter?
Did Martin Balsam gal?
Did Meryl Streep in the last scene?
Did Mount St. Helens make Seattle Wash.?
Did my ancestors inbreed? My genes seem tight.
Did Patricia Neal before the Pope?
Did Penny Marshall a good crew for her last film?
Did Phyllis Diller pickles properly?
Did Priscilla Presley Majors for an answer?
Did Raquel Welch on her studio contracts?
Did Rosalind Cash in on her looks?
Did Rosemary DeCamp when the war was over?
Did Sandy Duncan and cover in the 1950s?
Did Sharon Stone Michael on sex?
Did Shelley Hack her way to stardom?
Did Shelley Long to be an actress?
Did Sigourney Weaver way into the Ghostbuster role?
Did Suzy Kendall a flame in her recent romance?
Did they expect us to treat them with any respect?
Did you CD-Rom suck money from my wallet?
Did you ever stop to think, and then forget to restart?
Did you expect mere proof to sway my opinion?
Did you finish your homework yet?
Did you get that, or do I HAVE to include a <GRIN>?
Did you hear about the new deli that opened in India??
Did you hear Sally Kellerman with an ax?
Did you know that clones never use mirrors?
Did you know that no-one ever reads these things?
Did you make Amy Madigan?
Did you not learn Ancient Galactic History as a child?
Did you really expect mere proof to sway my opinion?
Did you say that MNP means Modem Needs Pizza?
Did you see Lilli Palmer cards in poker?
Did you write home today?
Did your parents have any children?
Didja ever stop to think.. and forget to start again?
Didn't I see you at Milliway's?
Didn't I see you on America's Most Wanted??
Die smiling, life is too important to take seriously.
DIE! BARNEY! DIE!
Diets are for people who are thick and tired of it.
Difference between doing it and not is doing it!
Difference between Windows and a Virus? A Virus works.
Difficult? I wish it had been impossible!
Dig the well before you're thirsty.
Digital circuits are made from analog parts.
Dijon vu: the feeling you've tasted this mustard before.
Dilate - to live longer.
Dilate: What happens when you live too long.
Dilator - to delay dying.
Dime: a dollar with all the taxes taken out.
Dinner Not Ready...(A)bort (R)etry (P)izza
Dinosaurs: Mainframes replaced by Minis and Micros.
Diode: What happens to people who don't die young.
Diplomacy gets you out of what tact would have prevented.
Diplomacy gets your out of what tact would have prevented
Diplomacy is saying "nice doggy" until you find a rock.
Diplomacy is the art of letting someone have your way.
Diplomacy: Saying "Nice doggie" until you can find a rock
Diplomacy: the delicate weapon of the civilized warrior.
Diplomacy: The patriotic lying for one's country.
Disappearing Tagline! (Just hit "Enter". Try it now!)
Disappointed fisherman demands a rebait.
Disaster is the only thing I can depend on...
Disaster often rests closely to success.
Discard all facts that do not conform to theory.
DISCLAIMER - This is a non-disclaimer disclaimer.
Disclaimer!? I don't express OPINIONS, I state FACTS.
Disclaimer: Pre-coffee reply. Possible mental errors.
Disco is to music what Etch-A-Sketch is to art.
Discoveries are made by not following instructions.
Discoveries are often made by not following instructions.
Disease is the retribution of an outraged nature.
Disk drive turned to pudding ---- Command aborted.
DISK ERROR: File not found! (A)bort (R)etry (F)ake it?
Disk Failure: (C)old boot (W)arm boot (S)teel-toed boot
Disk Full - Press F1 to belch
Diskette organizer.....what's that?
Disks travel in packs.
DisneyLand: A people trap operated by a mouse.
Dittoheads for a Kindler, Gentler world!
Divers do it better under pressure.
Divers LOVE To Go Down!
DIVORCE =system("echo y| erase \wife\*.*" );
Divorce: When a lovers' spat becomes permanent.
Dizzy = round and round and round where she stops???
Do Androids Dream of Electric Sheep? Ask Data.
Do artificial plants need artificial water?
Do as I say, not as I do.
Do blondes prefer gentlemen?
Do cellular phones cause reckless dialing?
Do device drivers need a chauffeur's license?
Do Dyslexic agnostics ponder the existence of Dog?
Do dyslexic geese fly North for the winter?
Do dyslexics wonder if there really is a doG?
Do files get embarrassed being unZIPped?
Do files get embarrassed when you UNZip them?
Do fish wonder where all the toes go after Labor Day?
Do HD's sneeze when they catch a virus?
Do health nuts die of nothing?
Do I BELIEVE in the Bible?! HELL man, I've SEEN one!!!
Do I even WANT ancestors? Some I wish I could lose.
Do I have a lifestyle yet?
Do I have the party to whom I am speaking?
Do I have to pee whenever I see a sign: WET FLOOR?
Do I need a Genealogical Search Warrant to see records?
DO I need a modem for each phone line?
Do Invisible Cats Drink Evaporated Milk?
Do it tomorrow. You've made enough mistakes for one day.
DO IT! It's easier to get forgiveness than permission.
Do MILs drink goat milk? They're always butting in.
Do ministers do more than lay people?
Do molecular biologists wear designer genes?
DO NOT ADJUST YOUR MIND - the fault is with reality
Do not adjust your mind. The fault lies with reality.
Do not adjust your set. We are in control.
Do not agree to buy anything at this point.
Do not attempt to traverse a chasm in two leaps .
Do not be alarmed by anything you see or hear.
Do not believe in miracles -- rely on them.
Do not curse the darkness, check your warranty.
DO NOT CUT ALONG THE LINE
Do not cut along this line ------------------------------
Do not drop??? Ooopps!
Do not fall in love, as it will stick to your face.
Do not handicap your children by making their lives easy
Do NOT look into laser with remaining eyeball!
Do not open this tagline. No user serviceable parts.
Do not read beyond this line.
Do not remove this tag under penalty of death.
Do not remove this tagline under penalty of law.
Do not sleep in a eucalyptus tree tonight.
Do not wait for an echo when you drop a rose petal.
Do nuns really have any bad habits?
Do our stars twinkle in angst?
Do people want fire that can be fitted nasally?
Do people who believe in mental telepathy invest in AT&T?
Do Quarter Horses have only a single leg?
Do Quarter Horses have only one leg????
Do radio atheists say "Send in your money & be saved?"
Do radioactive cats have 18 half-lives?
Do something unusual today. Pay a bill.
Do students of Zen Buddhism do Om-work?
Do unions picket God for working a six day week?
Do unto others BEFORE they do unto you!
Do unto others before they undo you.
Do unto others, then split.
Do vegetarians eat animal crackers?
Do we have a party from the Falmarion Bridge Club?
Do we have a party of minor deities from Asgaard?
Do well and you will have no need for ancestors.
Do well, hear of it never. Do ill, hear of it forever.
Do what comes naturally now. Throw a tantrum.
Do what needs doing when it needs to be done.
Do what you will with this tagline, just don't bother me
Do witches run spell checkers?
Do you always breathe like that when you're thinking?
Do you believe other people exist?
Do you ever stop to think... and forget to start again?
Do you get to church early to find a seat in back row?
Do you have lysdexia?
Do you know where *your* towel is?
Do you know where your ancestors were and what they did?
Do you like for my brain or my baud?
Do you like me for my brain, or my BAUD?
Do you sleep in the nude? No, I sleep in the bed.
Do you want me to kick you?
Do you want to come back to my place, bouncy bouncy...
Do your duty in all things. You cannot do more.
Do, but also seem.
DO:choice$=INPUT$:LOOP UNTIL INSTR("Maybe",choice$)>0
DOC's??? You mean the stuff you wipe up coffee with?
DOC's??? Oh, you mean the stuff you wipe up coffee with?
DOCS! I don't need no stinking DOCS!
Docs? Last time I went, I got nasty tasting medicine.
Docs? Why would I want to look at Docs? Nurses are better
Doctor's advice: No fats, no booze, no sex. NOT!
Doctrine is the skin of truth set up and stuffed.
Documentation: The last resort.
Documentation: The worst part of programming.
Does "Bad FAT" mean disk has high cholesterol?
Does a patriot order American in a Chinese restaurant?
Does a radioactive cat have 18 half-lives?
DOES ANYBODY KNOW WHAT A 'cAPS lOCK' KEY IS?
Does anybody know what a sea gate is?
Does anyone besides me remember Burma Shave signs?
Does anyone have any suggestions????
Does anyone REALLY read these stupid taglines?
Does Barbara Bach at nude scenes?
Does Barbara Barrie bones in the backyard?
Does Claire Bloom on screen?
Does Colleen Camp on her agent's doorstep?
Does Cybill Shepherd sheep between films?
Does Diane Baker own bread?
Does Dolly Parton the left or right?
Does God believe in people?
Does history record any case where a majority was right?
Does it always smoke like that?
Does it matter, cosmically, if I don't go to work?
Does it really matter which cola I drink?
Does it take an entomologist to recognize a computer bug?
Does it worry you that you don't talk any kind of sense?
Does Jane Seymour mini-series scripts?
Does Kaki Hunter own food?
Does Kathryn Walker own dogs?
Does LIFO-suction work on a FAT table?
Does Linda Hunt things as small as she is?
Does Linda Purl sweaters between takes?
Does Samantha Eggar fans on and on?
Does Santa have Christmas .GIFs?
Does that matter at this stage?
Does the Fridge Light Really Go Out When The Door Closes?
Does The Little Mermaid wear an algebra?
Does the name Pavlov ring a bell?
Does the number 42 mean anything to you?
Does this mean I have to get naked and lie on a...
Does Winona Ryder bicycle to the studio?
Doesn't have two neurons to rub together.
Doesn't know which side the toast is buttered on.
Dog Catcher: Wealthy drunk at a singles bar.
Dog for sale: Eats anything - Is fond of children
Dogmatism: Puppyism come to its full growth.
Dogs are always loyal. They've never learned better.
Dogs come when you call. Cats have answering machines.
Dogs crawl under fences, software crawls under Windows
Dogs, proof that eating and sleeping isn't all bad.
Doing my part to preserve order in the universe
Doing nothing: no immediate risk; yet absolutely fatal.
Doing Windows in C is a pane in the glass.
Doing Windows may be dangerous to your health!
Dollars cannot buy yesterday.
Domestic happiness and faithful friends.
Don't answer the phone, even if it's me calling!
Don't argue with he who buys ink by the gallon.
Don't ask for credit, a punch in the mouth often offends.
Don't ask how we got here; how do we get out ???
Don't ask me! I was hired for my looks.
Don't ask me--I'm making this up as I go!
Don't assume malice for what stupidity can explain.
Don't be a snob. Never lie when truth is more profitable.
Don't be afraid to say "I don't know."
Don't be afraid to say "I'm sorry."
Don't be fazed by new fashions in anything.
Don't be humble. You're not that great.
Don't be made of glass.
Don't be overly suspicious where it's not warranted.
Don't be sexist. Broads hate that.
Don't be so open-minded your brains fall out!
Don't be tiresome.
Don't believe everything you hear or anything you say.
Don't bother me!
Don't bother voting, I'll take care of it.
Don't byte off more than you can multiplex.
Don't complain about weather. It will always get even.
Don't confuse mere inconveniences with real problems.
Don't crush that dwarf, hand me the pliers!
Don't devour in a day what's hard to digest in a lifetime
Don't dispute death unless you've lived through it.
Don't drink and drive.
Don't drink and park, accidents cause people
Don't drink water! Do you know what the fish DID in it?!?!
Don't eat any meat loaf but your Mom's.
Don't eat the yellow snow, that's where the Huskies go...
Don't eat the yellow snow...
Don't ever watch hot dogs or sausage being made.
Don't expect life to be fair.
Don't feed the bats tonight.
Don't fight ugly people, they have nothing to lose.
Don't find faults, discovery remedies.
Don't follow this message too closely!
Don't force it--get a bigger hammer.
Don't forget to close your eyes when reading a scary book
Don't get mad, get even.
Don't give up the ship. Give up the captain.
Don't go surfing in South Dakota for a while.
Don't gossip.
Don't happy, be worry!
Don't hate yourself in the morning. Sleep till noon.
Don't Hit A Man When He's Down. Kick Him. It's Easier.
Don't hit a man with glasses - Use a bat instead.
Don't hit me!! I'm in the Twilight Zone!!!
Don't hit me, Mr. Moderator... I'll go back on topic...
Don't interrupt.
Don't judge a book by its mini-series.
Don't judge people by their relatives.
Don't just DO something!! STAND there!!!!
Don't keep doing things that can't work.
Don't kid yourself. You ARE ugly!
Don't kiss an elephant on the lips today.
Don't knock masturbation -- it's sex with someone I love!
Don't knock President Fillmore he kept us out of VietNam.
Don't learn "tricks of the trade", learn the trade.
Don't let Deja vu happen again!
Don't let school interfere with your education
Don't let the door hit you on your way out.
Don't like the weather? Wait 15 minutes, it'll change.
Don't live in a hurry.
Don't look at me -- I don't want to get involved.
Don't look at me with that tone of voice!
Don't look at me, I'm irrelevant
Don't look back, the lemmings are gaining on you.
Don't look now, but there's someone behind you.
Don't major in minor things.
Don't make me angry! You won't like me when I'm angry..
Don't make me HURT you!
Don't marry for money, you can borrow it cheaper.
Don't monkey around with unpeeled bananas.
Don't need a new religion, haven't used up the old one.
Don't open the darkroom door; it lets all the dark out.
Don't overfeed horses or brothers-in-law.
DON'T PANIC! Resistance is USELESS!
Don't Panic. Just push the Reset button.
Don't pick up the PH#%$&**>@@*&^=NO CARRIER
Don't play "stupid" with me... I'm better at it.
Don't point that thing at me! It might be loaded!
Don't practice unsafe Hex.
Don't put more effort into things than they require.
Don't question authority; it doesn't know either.
Don't quit a fight until it's won.
Don't read insulting taglines, you IMBECILE!
Don't regulate banks. Help BCCI and Charlie Keating.
Don't reply to inappropriate messages left by SysOp.
Don't reply to inappropriate messages, let SysOp do it.
Don't rush me, I'm dawdling as fast as I can.
Don't rush me. I get paid by the hour. ■█■
Don't sell yourself short, your wisdom is worth 2 cents.
Don't shoot! I'm only the Casio player.
Don't show off every day or you stop surprising people.
Don't spread yourself too thin.
Don't start doing a documentary on us!
Don't start vast projects with half vast ideas.
Don't steal money, steal taglines.
Don't steal.....Politicians hate competition.
Don't steal..The Government hates competition.
Don't sweat it - it's only ones and zeros.
Don't sweat petty things; pet sweaty things!
Don't sweat the little stuff.
Don't take life too seriously, it's not permanent.
Don't talk about yourself, it will be done when you leave
Don't talk about yourself.
Don't tell me how the clock works, just what time it is.
Don't that make yer blue jeans brown!!!
Don't think too far beyond your next meal.
Don't torture yourself, life will do it for you.
Don't touch that!
Don't trust a man who takes the universe for granted.
Don't trust doctors, they once said you were sane.
Don't try agreeing with me, I've already changed my mind.
Don't try to have the last word. You might get it.
Don't underestimate the power of inflation.
Don't use a big word where a diminutive one will suffice.
Don't use a long word if a diminutive one will do.
Don't vote--it only encourages them!
Don't wait for your ship to come in, swim out to it.
Don't watch violent TV; don't buy the sponsors' products.
Don't worry what people think of you; they seldom do.
Don't worry, I'm fluent in weirdo.
Don't worry, I'm going to backup todam|!&%#~%
Don't worry. We're on a mission from God.
Don't you feel that your salami is on the chopping block?
Don't you hate it when life doesn't follow the manuals?
Don't you have some work to do?
Don't you know where *your* towel is?
Donate two pints of blood every year.
Don't give in to E-mail, it will only lead to the Dark Side
Dontyoujusthateitwhenpeoplestripalineofallitsspaces?
Doodad: Something you do for Dad.
Dork detected at the controls: (A)bort
DOS + Windows + ATM < OS/2 2.0
DOS 6.0 included 'uninstall.exe' for a good reason.
DOS is a boot sector virus.
DOS is just an operating system that runs Windows 3.0
DOS means never having to live hand-to-mouse
DOS never says "EXCELLENT command or filename"...
DOS Tip : Don't use DOS.
DOS Utilities? Naah, we got Houston Looting & Plunder!
DOS, Windows, and OS/2: The Three Kludges
Dos: Venerable. Windows: Vulnerable. OS/2: Viable.
DOS=HIGH Hmmm...I knew it was on something...
DOS=HIGH... Yeah, I just KNEW it must be on something!!!
Double digit class reunions: syne you're getting auld.
Double the recipe? But my oven won't go up to 700 F!
Doubt is the root of education, not faith.
Douche: Flushing a di*k cache.
Down Boy. Down!
Down is in fact the other way.
Down with categeorical imperatives!
Down with categorical imperatives.
Down with TLA's! (three letter acronyms)
DR-DOS Virus Scan -=Windows Found=- Delete (Y/n)
Dr. Kevorkian will see you now.
Dr. McCoy, I hate your #*@%ing human guts. Discussion?
Dr. Soong did not intend me to be used this way. ■ Data
Draft beer, not people.
Drama in her opinion is knowing how to fill a sweater.
Drat! Just slipped off my soapbox!
Draw your salary before spending it.
Drawing on my fine command of English, I said nothing.
Drawing on my fine command of language, I said nothing.
Dream of a pure planet.
Dreams and dedication are a powerful combination.
Dreams are composed from our successes and calamities.
Drilling for oil is boring.
Drink! for you know not whence you came, nor why.
Drive C: Error, (A)bort (R)etry (I)gnore (K)ick (S)cream
Drive carefully, why die in perfect health?
Drive defensively, buy yourself a tank.
Drive defensively. Buy a tank.
Drivers' side air bag -- Mother In-law behind the wheel..
Driving Lesson One: Shiny side up; rubber side down.
Driving with two wheels in the sand.
Drop carrier Immediately - but try not to break it.
dROp yoUr CArriER or tHE sYSop GEts iT!
Drop your carrier, we have you surrounded!
Drunk is feeling sophisticated when you can't say it.
Drunk? Not me.... I'm jober as a Sudge!
Dry Ice: A Carbon Dioxymoron.
DTP: Never have so many spent so much to do so little.
Duck that lost his job: a fired quacker.
Due to inflation, all clouds will now be lined with zinc.
Duh. . . I didn't know FORMAT C: did that!?
Dolce bellum inexpertis.
Dumb luck beats sound planning every time. Trust me.
Dumb v2.0: Upgrade from stupid.
Dunno what I'm do'n but it's fun push'n all da buttons.
Dupe dupe dupe dupe of earl dupe dupe dupe of earl dupe..
During a hijack, never ask for a kosher meal.
Dust: a protective coating for furniture.
Dwarf fortune teller escapes jail: small medium at large!
Dying can be done as easily lying down.
Dynamic linking error. Mistake is now in every file!
Dynamic linking error: Your mistake is now everywhere.
Dysfunctional computing: Apple/IBM networks.
Dyspepsia - someone who hates Pepsi.
E = mc² ± 2 dB.
E Pluribus Unix
E' melhor ser infeliz *rico* do que infeliz *pobre*
Each and everyone of you is entitled to my opinion.
Each decade goes exactly twice as fast as the one before
Each of us contains an element of insanity.
Each young doctor means a new graveyard.
Eagles fly, but weasels aren't sucked into jet engines!
Eagles may fly but weasels aren't sucked into jets.
Early to rise and ditto to bed, makes you socially dead.
Earn cash in your spare time -- blackmail your friends.
Earth = mostly harmless
Earth Destroyed by Solar Flare -- Film at eleven.
Earth is 98% full...please delete anyone you can.
Earth was interesting, and worth the money I paid for it.
Earth was not earth before her sons appeared.
Earth: A solid substance, much desired by the seasick.
Earthquakes are Earth's way of saying, WAKE UP !!!!!!!!!!
Easier to count the bricks left than the bricks missing.
Easier to denature plutonium than the evil spirit of man.
Easily amused, and laughing about it.
East credit terms available. - Satan.
Easy as pie, no fuss, no muss, no crust.
Easy for you to say.....but how does it work??
Eat any good books lately ■ Q
Eat Fugu, throw up, and see God! -Dik
Eat garlic for a near-breath experience!
Eat healthy, exercise daily, and die young anyway.
Eat healthy, exercise, die anyway....
Eat the rich - the poor are tough and stringy.
Eat when hungry, drink when thirsty, hack whenever.
Eat yogurt and get cultured
Eat, drink and be merry, for tomorrow we diet...
echo y | kill \computer\sales.men\*.*
Echo: Only thing that cheats some out of the last word.
Echoes between the ears.
Ecology: taking inventory of vanishing resources.
Ecology: Technology's nemesis.
Economist: Someone who'd marry Madonna for her money.
Economy makes men independent.
Edam is not a Dutch Cheese, it's "made" backwards.
Editing is a rewording activity.
EDLIN: proof that programmers have a sense of humor.
Edlin: Transferred to Home for Aging Utilities.
Education which is not modern, faces the organic fate.
Education, not experience, comes from reading fine print.
EDUCATION? i DON'T NEED NO STINKING EDUCATION!!!!
Educational Tagline: A is for Application; B is for Byte;
Edward Scissorhands has jock itch! Ouch!!
EEEK! There's a mouse with a long tail on the desktop!!
Eek! of Borg: All little creatures should be assimilated.
Eek! of Borg: Gee, it's swell when people are assimilated.
Eeny Meeny, Jelly Beanie, spirits are about to speak.
Efficiency is a highly developed form of laziness.
Efficiency takes time! Frugality: who can afford it?
Egad, a base tone denotes a bad age.
Eggheads unite! You have nothing to lose but your yolks.
Egotist: A person more interested in himself than me.
Einstein and Newton were relatively light weights!
Either he's dead or my watch has stopped.
EKE! A cereal mouse!
Elect me to Congress! I've never bounced a check!
Elect to Congress.
Election year economy: it don't get any better than this.
Electricians do it 'till it Hz.
Electricity was invented by rubbing cats backwards!
Electrolyte - lights used for disco dancing.
Electronic publishing: What's my lino?
Electrons: What goes around comes around.
Elevators travel in groups. Only one of them knows why.
Eliminate government waste no matter how much it costs.
Elizabeth Taylor: Its only a hubby... only a hubby... on
Elvis hasn't left the building, he's just in the john.
Elvis isn't dead, he's just shelled to DOS.
Elvis isn't dead, he's waiting for COMPSURF to finish
Elvis isn't dead. Tired of Earth, he went back to Mars!
Emergency repair procedure #1: Kick it.
Empty vessels make the most sound.
EMS: Enhanced Money Scam
En boca cerrada no entran moscas.
End rush-hour traffic now! Legalize vehicular weaponry!
Endangered Species: Teachers
Endocannibalism: The result of a really hungry cannibal.
Enema - not your Aunt from Kansas.
Energy * Where people discuss it before it runs out!
Energy derives from both the + and negative
Enforced fun is probably not what you need at this point.
Engage brain before operating fingers!
Engineers do it by calculation and design.
Engraving is, in brief terms, the art of scratch.
Enough research will tend to support any theory.
Enough research will tend to support your theory.
Enrole now at Dan Quayle's Skool of Spellen!
Enter any 12 digit prime number to continue.
Enter at your own risk.
Entropy has us outnumbered.
Entropy isn't what it used to be.
Entropy requires no maintenance.
Environmental activist: ecomaniac.
Envy is thin because it bites, but never eats.
Envy things on which a price tag cannot be put.
Envy: complete misunderstanding of another's situation.
EOF ENCOUNTERED.
Epigrams are macros, since they are executed at read time
Epistle: What apostle's are always firing off.
Epitaph on a gravestone: Cheerio, see you soon.
Equal bytes for women.
Equal opportunity annoyer...
Equality is an equal opportunity to prove unequal talents
Equality of the sexes leaves women standing on buses.
Equip Checklist: Database, disabat, doseaballs. . .
Erro #98: Mal contato no slot. Sacuda o computador...
Error - [A]bort, [R]etry, [F]ake like it's working...
ERROR -- Operator out of memory!
Error 00 - call customer service for a laugh
Error 216: Tagline out of paper.
ERROR 407: Program too idiotic.
ERROR 9:Disk Full Error/Formatting Drive C: to make space
Error failed! Press any key to resume error.
Error finding COLD BEER. Sysop not loaded.
Error finding COLDBEER.CAN Operator not loaded!
Error loading GOD.SYS (A)bort or (U)nzip BIGBANG.ZIP
Error opening CLINTON.LIE Cannot recover COUNTRY.USA
Error reading FAT Table. Try Skinny one? (Y/N).
Error reading REALITY.SYS - Universe Halted
ERROR! (A)bort, (R)etry, (I)gnore, (F)ail, (N)uke...
ERROR! A)bort R)etry G)et a gun and kill it.
ERROR! CPU not connected to the bus!
ERROR! MODERA.TOR corrupted . . . tagline overflow!
ERROR! Warm beer! Abort, Retry, B]arf?
ERROR: 2nd FAT missing. (How can I get rid of the 1st?)
Error: ALLWORK.EXE -- Jack is dull boy.
ERROR: AUDIT.COM ... Abort, Retry, Kiss ASCII goodbye?
ERROR: Boot Failure! No Drive Found! Do you want a drink?
ERROR: COLDBEER.CAN not found! USER.SYS not loaded.
Error: DRIP.COM -- unable to locate NERD.OVL
Error: General Protection Fault. Condom not installed.
Error: MONEY.COM negative integer overflow Divide by zero
Error: No Keyboard: Press F1 to Continue.
ERROR: OPERATOR IMPROPERLY CONFIGURED. PLEASE REGROUP.
ERROR: Press ENTER to return to CoffeeMate System
Error: RAM address without valid Zip Code.
ERROR: REALITY.SYS corrupted. Reboot Universe ? (Y/N)
Error: Run XLAX.COM to correct impacted data.
Error: SALARY.COM -- system interrupted. Get a job.
ERROR: TIT.COM tat.dat not found. Data exchange aborted.
ERROR: Unable to come up with a good tagline.
Error:015 - Unable to exit Windows. Try the door.
Errors show up in the duplicate while the Boss reads it.
ESDI: Extra Squished Data Inside
Estabamos mejor cuando estabamos peor...
Eternal nothingness is O.K. if you're dressed for it.
Eternity may well be composed of a very deep silence.
Ethernet: A device for catching the Ether Bunny.
Ethically challenged: crooked.
Ethics is not necessarily the handmaiden of theology.
Etiquette is not for the faint-hearted.
Etorre's Observation: The other line moves faster.
Eunuch's got their work cut out for them.
EUNUCHS -- What UNIX would be if Microsoft made it.
EUNUCHS UNITE...You have NOTHING to lose!!
Euthanasia... Isn't that near somewhere near France?
Eval Day 1,094,583,217 ■ I Support Shareware!
Evangelists do more than lay people, sometimes.
Eve had an Apple, Adam had a Wang...
Eve was the first woman to date a snake.
Even a cactus needs a little water now and then.
Even a hawk is an eagle among crows.
Even a lot of help at the wrong time adds up to nothing.
Even a noseless dog can stink.
Even a philosopher gets upset with a toothache.
Even hairless heiresses are always beautiful.
Even I'm impressed with me.
Even if you're paranoid maybe they're really after you.
Even moderation should be practiced in moderation
Even paranoids have enemies.
Even Programmers need a "bit" of love.
Even sliced VERY thin, baloney is never corned beef.
Even the blind can see money.
Even the boldest zebra fears a hungry lion.
Even the ghosts have settled down and raised families.
Even the happiest of amoebae lack sexual organs.
Even the lion has to protect himself against flies.
Even the smallest candle burns brighter in the dark.
Even the Tsar can't see his face without a reflector.
Even though they call it pasta now, it's still spaghetti.
Even weeds have needs.
Even when experts all agree, they may well be mistaken.
Even when you're running the world, you can't get off.
Even worse than raining cats & dogs is hailing taxi's.
Events of importance often result from trivial causes.
Eventually everybody has to die.... except Elvis.
Ever caught yourself reading taglines and skipping msgs?
Ever hear of a dull-back hog?
Ever hear of a low-speed chase?
Ever hear of a mediocre scientist?
Ever hear of a slow back?
Ever hear of a slow-food restaurant?
Ever hear of a wet wit?
Ever hear of a wide escape?
Ever lob a live grenade into a basket full of kittens?
Ever notice how fast Windows runs? Neither did I...
Ever notice that if the shoe fits, it isn't on sale?
Ever notice the best taglines are always someone elses?
Ever since I gave up hope, I feel much better.
Ever stop to think and forget to start again?
Ever wonder why Oprah spelled backwards is Harpo?
Eveready Bunny Arrested! Charged with Battery!
Every absurdity has a champion to defend it.
Every absurdity has its champions.
Every anarchist is a baffled dictator.
Every artist was first an amateur.
Every bicycle needs a fish.
Every child should be given the desire to learn.
Every Crowd has a silver lining: PT Barnum
Every day is starting to look like Monday ...
Every email needs a shemail.
Every exit is an entry somewhere else -- Tom Stoppard
Every government is run by liars.
Every hard-boiled egg is yellow inside.
Every huge program has a small program trying to get out.
Every human comes equipped with a brain at no extra cost.
Every idiot believes that they are Cassandra.
Every law is an infraction of liberty.
Every little BYTE helps
Every loose nut eventually rolls out to California!
Every man's work is a portrait of himself.
Every noble work is at first impossible.
Every parking lot in the galaxy reeked of impatience.
Every person constructs their own bed of nails.
Every person gets to heaven in their own way.
Every person in the galaxy had 2.4 legs and owned a hyena
Every person is the architect of their own fortune.
Every person you meet knows something you don't. Learn.
Every politician has a price, some hold bargain sales.
Every private citizen has public responsibility!!!
Every purchase has its price.
Every Silver Lining Has A Cloud.
Every solution breeds new problems.
Every sound ends in silence, but silence never dies.
Every Spam is sacred, every Spam is great.
Every time I have answers, someone changes questions.
Every time I lose weight, it finds me again!
Every time I think I know where it's at, they move it.
Every Titanic has its iceberg.
Every valuable idea offends someone.
Every why hath a wherefore.
Every woman should marry -- and no man.
Everybody is ignorant, only on different subjects.
Everybody lies about sex
Everybody likes a joker, but nobody loans him money.
Everybody must believe - I believe I'll have another beer
Everybody remember where we parked. -- Kirk
Everybody should believe: I believe I'll have a drink.
Everybody wants to go to heaven, but nobody wants to die.
Everybody's a programmer, but who's WRITTEN anything?
Everyone as they loveth, some people kiss cows.
Everyone complains of his memory, no one of his judgment.
Everyone complains of memory, no one of judgment.
Everyone has a scheme that will not work.
Everyone hates me because I'm paranoid!
Everyone is a genius at least once a year.
EVERYONE is enrolled in the School Of Hard Knocks.
Everyone is entitled to my opinion without charge.
Everyone is entitled to my opinion.
Everyone is entitled to my own opinion.
Everyone is gifted, but some open the package sooner.
Everyone is ignorant- only on different matters.
EVERYONE is weird...some of us are proud of it.
Everyone lives by selling something.
Everyone meets their Waterloo at last.
Everyone should know where his towel is.
Everyone there is either English or odd or both.
Everyone's got one and everyone's stinks but mine.
Everything bows to success, even grammar.
Everything changes except change itself.
Everything comes to he who hustles while he waits: Edison
Everything costs more and takes longer.
Everything free is usually worth exactly what it cost.
Everything goes wrong all at once.
Everything in time is birth to some and death to others.
Everything is possible, but nothing of interest is easy.
Everything is what I want, breathing is what I get.
Everything put together falls apart sooner or later.
Everything should be made as simple as necessary.
Everything starts in somebody's head as a daydream.
Everything stress it, gardening is not.
Everything that could go wrong already has or is about to
Everything that is not mandatory is forbidden.
Everything to excess!
Everything we put together falls apart sooner or later.
Everything's got a moral, if only you can find it.
Evian Mineral Water: Evian is "naive" spelled backwards!!
Evil Grin #13 <<<<<GRIN>>>>>
Evil has been dealt a serious blow, but will return.
Evil is essentially stupid.
Evolution is God's way of issuing upgrades!
Evolution is RELIGIOUS because it can't be proven!
Exactly what was I talking about anyways???
Exam is a four-letter word for torture...
Excellence is to do a common thing in an uncommon way.
Excellent day for drinking heavily. Spike water cooler.
Excellent day to have a rotten day.
Excellent time to become a missing person.
Excess is never enough.
Excitement and adventure are really wild things.
Excuse #1. My kids are locked outside.
Excuse #16. My truss snapped.
Excuse #17. My support hose popped.
Excuse #19. I'm arranging financing for a house.
Excuse #2. My kids are locked inside.
Excuse #20. I'm arranging financing for a car.
Excuse #21. I'm arranging financing for a beef roast.
Excuse #26. I'm being sent to the moon by NASA.
Excuse #27. It's Dayton's Warehouse Sale.
Excuse #28. My back aches.
Excuse #29. My stomach aches.
Excuse #3. My kids are stuck in the door.
Excuse #31. My biological clock is ticking.
Excuse #39. I have to take my mother to the doctor.
Excuse #4. I have to help my grandmother bake cookies.
Excuse #40. I have to take my minister to the doctor.
Excuse #41. I have to take my doctor to my minister.
Excuse #42. I think I left the iron on.
Excuse #43. I think I left the water on.
Excuse #44. I think I left the refrigerator on.
Excuse #48. I have to have my waistband let out.
Excuse #49. I have to have my watchband let out.
Excuse #50. I have to have my son's rock band let out.
Excuse #54. I'm having a root canal.
Excuse #55. I'm having a tax audit.
Excuse #60. I have to renew my driver's license.
Excuse #61. I have to get new license plates.
Excuse #63. I've got an urgent session with my therapist.
Excuse #66. I have to get my contact lenses fitted.
Excuse #67. I have to get my hearing aid adjusted.
Excuse #68. I have to get my big toe calibrated.
Excuse #71. 's going to be a terrible blizzard.
Excuse #73. I need to give blood.
Excuse #74. I need to give evidence.
Excuse #75. I need to give up.
Excuse #77. I'm going to my best friend's wedding.
Excuse #81. The police are at the back door. Cover me.
Excuse #82. I'm having my nails done.
Excuse #83. I'm having my colors done.
Excuse #84. I'm having my head examined.
Excuse #85. I'm going to the bank.
Excuse #86. I'm going to sleep.
Excuse #87. I'm going over the edge.
Excuse #92. I need to check into a rest home.
Excuse #93. I'm breaking in my shoes.
Excuse #94. I'm breaking up with my boyfriend.
Excuse #95. I'm breaking out.
Excuse #96. I have to pick up my dry cleaning.
Excuse #97. I have to pick out a car.
Excuse #98. I have to pick on my kids.
Excuse me for butting in, but I'm interrupt-driven.
Excuse me, can you spare a tagline?
Excuse me, could I borrow your axe, I'm feeling psychotic
Excuse me, do you mind if I squish in here?
Excuse me, I have to recharge my flamethrower.
Excuse me, your tagline's showing.
Excuse me... can you spare a tagline?
Excuse me....Do I have any more lines?
Excuse My Driving, I'm Trying to Reload!
Execute program code from Write Only Memory.
Executive ability is prominent in your make-up.
Exercise? Not me...... I'm into energy conservation.
Expect a letter from a friend who will ask a favor of you
Expenditures tend to rise to surpass all income.
Expensive imported beer is good for the sole.
Expensive silk ties attract spaghetti sauce.
Experience is a good teacher but her fees are high.
Experience is directly proportional to equipment ruined.
Experience is directly proportional to mistakes made.
Experience is the name everyone gives to their mistakes.
Experience varies directly with the equipment ruined.
Experience. You don't get it until after you need it.
Experience: what you get when you don't get what you want
EXPERT - Some unknown drip under pressure.
EXPERT: called in at the last minute to share the blame.
Expert: Ignorant about much to know all about one.
Experts claim this is all a load of dingo's kidneys.
Explain counter-clockwise to someone with a digital watch
Exploding piglets!!! My God, it's raining bacon!
Expresshole: one who uses the Express lane with > 9 items
Extravagance: something your spirit thinks is necessity.
Extremes meet -- Louis-Sebastien Mercier
exuleD 1.21 #9310 · Çópÿwïght 1948 Élmër ƒúdd. Äll wïght
Exungulate regularly!
Ezz beeg trouble for moose and squirrel..
F r o m the s l o w s p e a k e r s o f A m e r i c
F.A.R.T. Fathers Against Radical Teenagers«««
F.A.R.T.S.: Fast Acting Relief of Tummy Stress
Face it, those zeebs over there are your ancestors.
Facing the facts makes it hard to get up in the morning.
Fact of life #15: Heads bleed, walls don't.
Fact: fourteen out of every ten people like chocolate.
FACT: fourteen out of ten people like chocolate.
FACT: There are more horse's asses than there are horses!
Fact: There are n+1 zucchinis in the universe.
Facts -- attempts to explain magic through logic.
Facts are stubborn little bastards, be careful with them.
Facts are stubborn things.
Facts that do not conform to theory must be disposed of.
Facts, though interesting, are irrelevant.
Failure is seldom fatal, success is never final.
Failure: the path of least persistence.
Faint hearts never win in love nor sell life insurance.
Faith goes out through the window when beauty comes in.
Faith is believing what you know ain't so.
Faith will not die while seed catalogs are printed.
Fake memory lapse: shamnesia.
Fall seven times, stand up eight.
Fall, when trees change from Beatles to Yul Brynners.
Falling asleep at the keyboard is called a head crash.
Falling in lust is falling for make believe...
Fallopian tube - part of a television.
Fame is proof that people are gullible.
Fame: Chiefly a matter of dying at the right moment.
Familiarity breeds attempt.
Familiarity breeds contempt - and children
Family vacation: 5 bags; 4 kids; 7 thought-you-packed-its
Family Values Director.............Woody Allen
Famous last words: "Ohh, shiiiiii...."
Famous Quotes: "I don't think so, Tim." - A. Borland
FANATIC: one enthusiastic about something you're not
Fanaticism: Redoubling effort when your aim is forgotten.
Fanny Hill was an 18th century call girl without a phone.
Fantasy isn't our crutch -- it's arcane.
Far duller than a serpent's tooth to spend a quiet youth.
Farfignewton: German for "ergonomic cookie."
Farfrompoopin...German word for constipation.
Fartvergnügen..the pleasure of breaking wind
Fascinating, Jim. (Spock is that you?)
Fast Foods, Italian: pasta fazoom
Fast Foods, Japanese: hurryyaki
Fast Foods, Kosher: gefaste fish
Fast Foods, Mexican: taco pronto
Fast walk: ZIPtoe thru the tulips.
Faster Hosses, Younger Wimmen, Older Whisky, More MIPs
Fat heads, lean brains.
Fat Person: Larger than average citizen.
Fatal Error Using Mouse. Please bury/replace...
FATAL ERROR: Operator dead.
Fatal System Error:001 Power Switch Is Off
Fault lies with systems not the technologies involved.
Favors are less expensive, and friendships abound.
Fax me no questions, I'll Fax you no lies!
Fear is the tax that conscience pays to guilt.
Fear not, for I have given you authority.
Fear of crowded holiday shopping: Santa Claustrophobia
Fear of failure can paralyze your will to act.
Fear of giants - Fee-fie-pho-bia
Feather by feather the goose is plucked.
Feathers are so expensive now that DOWN is up.
Features should be discovered, not documented.
Federal authorities are investigating tagline theft.
Feed your faith and starve your doubts to death.
Feel good? Don't worry; you'll get over it!
Feel good? Liar, Liar, Pants on Fire!
Feel good? Quick, mark this date in history!
Feel lucky???? Update your software!
Feeling suicidal? Join Starfleet Security!
Feet smell, nose runs? You're built upside down.
Fer pete's sake, don't try this tagline at home!
Fer sail cheep, Windows spel chekker, wurks grate.
Fer sell cheep: IBM spel chekker. Wurks grate.
Fester - quicker.
Fetch the comfy chair!
Fett's Law: Never replicate a successful experiment.
Fetus - a character on 'Gunsmoke'.
Feudalism: It's your Count that votes.
Few of us can stand prosperity -- someone else's.
Few of us can stand prosperity. Another man's I mean.
Few people know how to be old.
Few things are as painful to us as the truth.
Few things are painful as the truth realized too late.
Few things upset my wife. Glad I'm one of them.
FF bottles of beer on the wall
Fibonacci Numbers: The mathematical explanation of life.
Fiction: It can't hold a scandal to biography.
Fiddle: Friction of a horse's tail on a cat's entrails.
FiddleFactor: x TaskTime by this to get time using GUI
FIDO - Fairly Insignificant Dork Organization
Fifty-three More Things to Do in Zero Gravity.
Fight poverty, register the ShareWare you use.
Figures don't lie, but liars can figure.
File Allocation Table Corrupt. Who CAN you trust?
File Attached. Pay Alimony/Child Support.
File corrupt. Call Eliot Ness?
File not found A)bort R)etry I)nfluence with large hammer
FILE NOT FOUND! Loading something I find interesting.
File not found. Backup not found. You want a drink?
File not found. Delete *.* and change directory? (Y/N)_
File not found. Never happens with the IRS.
File not found. Should I fake it? (Y/N)
File not found. You want I should make something up?
FILE NOT FOUND..... Should I fake it? [Y/n].........
File not found: (A)bort (R)etry (B)low up computer?
File not found: Loading something that looked similar.
Files needed: HARD.COM, WELL.EXE, MOTION.OVL
FILES=31 BUFFERS=20 FCBS=SAYWHAT BREAK=GIMME
Fine day for a good workout. Steal something heavy.
Fine day to throw a party. Throw him as far as you can.
Fine, Fine...Have your Klingon servant get some chairs!
Fingers not found - Pound head on keyboard to continue.
Fire at Will! >ZAP< THANK you Data...
Fire, Ready, Aim!
Fired from McDonald's for having a short attention span.
Firings will continue until morale improves
Firmness in politics is called obstinacy in a donkey.
First Church of Binary Science (The Digitarians)
First documented case of carpool tunnel syndrome...
First let's make sure we're talking about the same thing.
First listen to sermon, THEN eat missionary.
First the memory goes then...I forgot the rest!
First Women's Rights. NOW Blonde's rights!
First, draw the curve; then, plot the data.
First, shalt thou take out the holy pin.
Fiscally retentive: cheap
Fish & let fish.
Fisherman catches calendar: reeling in the years.
Fishing is a delusion surrounded by liars in old clothes.
Fishing rod: a hook at one end, a fool at the other.
Fitness Club Closes, Going Belly Up.
Fixation - a gas station that still repairs cars.
Fixes a flat by swapping tires.
Fjords give a lovely baroque feel to a continent.
Flamers have uncontrollable vowel movements.
Flare riders not dying riding die of sexual exhaustion.
FLASH! Eveready Bunny arrested, charged with battery.
FLASH! Pee-Wee Herman joins cast of "Different Strokes!"
Flattery is counterfeit money, circulated by vanity.
Flattery really works: As you snow, so shall you reap.
Flattery will get you nowhere....where do you want to go?
Flattery: Cologne water, to smell but not swallow.
FLATTERY: telling a person what he thinks of himself.
Flatulence - an ambulance that got flattened.
Flatus - a bus that has been flattened.
Flight School: Higher education.
Flirt with me like that again & I'll follow you anywhere.
Floppy not responding, Format HARD DRIVE instead? Y/N.
Floppy not responding, formatting hard drive instead.
Florist: A petal pusher.
Flunked 52 card pickup.
Fluoridate martinis: holes in your liver not your teeth.
FLY.COM crashed. (A)bort, (R)etry, (B)ailout
FLY.COM down. (A)bort, (R)etry, (Z)ipup?
Flying = Throwing yourself at the earth and missing
Flying is quite easy if you don't know how.
Flying is throwing yourself at the ground and missing.
Fold, Spindle & Mutilate - See if I care..
Fold, spindle and mutilate, see if I give a damn.
Folks who have no vices have few virtues.
Follow through on your victories.
Follow your heart and let your head take care of itself.
Font: an alphabet in drag.
FOOD FIGHT!!!!!!!!!1
Foolish fears drive away good fortune.
Fools rush in where fools have been before.
FOR A = 1 TO INFINITY PRINT "HELP" NEXT...
For a bug-free environment do NOT run this program.
For a good time, type FORMAT C:
For a real smoking pleasure, smoke Spotted Owl Cigars
For an air conditioned environment - Do NOT open Windows!
For any action there is an equal and opposite criticizer.
For at the end of history lies the undiscovered country.
For carnival we put masks over our masks.
For discussion only. Not to be relied upon.
For every action there is an equal and opposite criticism
For every battle honor, 1000 heroes die unknown
For every expert there is an equal and opposite expert.
For every vision there is an equal and opposite revision.
For further details, send a self-abused, stomped elephant.
For grammar, consult Dr. Dan Streetmiers book on tenses.
For many, the declension of life is: I go, you go, ego.
For once I'm at a loss for words. Mark down the date!
For real sponge cake borrow all ingredients.
For sale cheap: Write-only memory chips.
FOR SALE: 1 set of morals. Never used. Will sell cheap.
For Sale: Dehydrated H²O - $14 per quart
For sale: Hourglass for timing Windows.
For Sale: new Encyclopedia, never used! Kids know it all.
FOR SALE: One cloaked Romulan warbird ornament, $50.
For some, reality is an illusion.
For some: know God & know peace/others: no God & no peace
For something you really want, the price is always high.
For TAGLINE insert four quarters in slot |_______|
For the Snark *was* a Boojum, you see.
For the woman who has everything...here I am!
For these prices, you can't expect real quotes.
For those who like peace & quiet: a phoneless cord.
FORD = Fixed or Repaired Daily.
Ford explained that it was because he was extremely drunk
Ford Prefect usually played to lose.
Ford was irritated to be continually wakened by gunfire.
Ford's technique consisted of standing still and smiling.
Forest fires prevent bears.
Forest Lawn is nice to visit, but nobody lives there.
Forests lovely, dark & deep ... I have promises to keep.
Forget *HIM* it's time to run a *HER* for president.
Forget 0 to 60. It's 95 to 55 that counts!
Forget Ross Perot...Larry King for president!
Forget RTFM - Call the author at home.
Forget the Joneses...I can't keep up with the SIMPSONS!
Forget whales, save Jupiter for when Earth is used up.
Forget your origin, always know where you're heading.
Forgive me for shooting those who trespass against me.
Forgive your enemies but never forget their faces
Forgive your enemies, but never forget their names.
Forgotten men at the bottom of the economic pyramid.
Forgotten relatives: Father Nature
Forgotten relatives: Grandpa Moses
Forgotten relatives: Mother Time
Format all 10? Only 3 fit in the slot.
Format another (Y/N)?
FORMAT C: Failed, Transfering Virus to d: ^C^C^C^C
Fornication like this I shoulda worn a tie!
Fortune truly helps those who are of good judgment.
Foulup--anything done to correct it only makes it worse.
Found [iRiSH]: Read a nice poem? (Y/N)
Fountains mingle with the river, rivers with the ocean.
Four food groups: Fast, Frozen, Instant and Microwavable!
Four out of five herrings that smoke get bagels.
fputs("Encrypt with any key to continue ", stdout);
fputs("Smash any key to continue ", stdout);
France? I would have loved it -- without the French.
Frankly my dear, I don't give a download. -Rhett Sysop.
Frankly, my dear, I don't give a DRAM. - Hextt Butler
Fraud(n): A telephone number starting with "1-900"
Freak: Nature modifying an existing program.
Free downloads!! Press ALT-H for access!
Free radical - an extremist who has escaped from jail.
Free the bound periodicals!
Free! Take one!
Freedom begins when you tell Mrs Grundy to go fly a kite.
Freedom is a hard-bought thing - A gift no man can give.
Freedom of religion is also freedom FROM religion. . .
Freedom of the press is guaranteed to those who own one.
French Fries are MURDER!!!! - Mr. Potato Head
Frenulum - hangs inside a clock and goes 'Tick-Tock'.
FREQ: RESUME for a top notch C/ASM programmer!
Freud is the father of psychoanalysis. It has no mother.
Friction is a drag.
Friday the 13th XXIV: Jason Takes The Enterprise
Friend: Anyone who has the same enemies you have.
Friendly fire - ISN'T !
Friendly fire ain't.
Friends come and go, but relatives tend to accumulate.
Friends come and go, enemies accumulate!
Friends don't let friends drive drunk.
Friends don't let friends drive Fords.
Friends don't let friends use PRODIGY.
Friends don't let friends vote democrat!
Friends Make Friends read docs.
Friends may come and go, but enemies tend to accumulate.
Friends, Romans, countrymen, lend me your taglines!
Friends: People who dislike the same people we do.
Friendship: taxing and arduous form of leisure activity.
Friendships are not always preserved in alcohol.
Friendships shouldn't pass in the night.
Frisbyterian: When you die your soul goes up on the roof.
Frog: Time's fun when you're havin' flies!
Frogs are smart... they EAT what bugs them.
From every mountainside, let freedom ring.
From hi-tech romance novel: "ZSoft touch of her hand..."
From listening comes wisdom, from speaking, repentance.
From now on, I think for myself. Okay? Huh?
From the creative workshops of Soong, Inc.
From the Desk of the Happy Hacker...
From the duck side of the loon....
FROOMB!
Frosty - 225lbs or 45 gallons on a warm day...
Frugality: who can afford it?
Fudd of Borg: Pwepawe to be assimiwated. Huh huh huh hut!
Fugitive from a tagline factory.
Fun is like life insurance. It costs more as you age.
Fun with Greek #4: Fee, φ, fo, fum!
Fun, fun, fun, til her daddy takes her dildo away!
Funeral: Time to say nice things about a dead person.
Funny how life imitates LSD.
Funny thing.... harder I work, luckier I get.
Future looks spotty. You will spill soup in late evening.
G.I. Series - baseball game for soldiers.
G.I. Series: A military baseball game.
G=Guns, PG=Plenty of Guns, PG-13=More than 12 guns...
Gal with no arms or legs in butter dish? Pat.
Galactic Intelligence Test #1. Avoid contact with humans.
Gallium - a measure of liquid.
Gambling: fast way to throw money away.
Garbage in, Gospel out.
Gather 'round like cattle and ye shall be herd.
Gee, I should have had another Cold Frosty Bud -Socrates.
Gee, I want a hula hoop.
Gee, I wonder what this key does.
Gee, Mr. Wizard! Aren't nuclear reactors dangerous?
Gee, Toto, I don't think we're in Windows anymore.
Gee, Ward, weren't you kind of hard on Beaver last night.
Gee... What's that ticking in the corner.
Gen. Custer, can I be excused for this afternoon?
Gene Police!....YOU!! Out of the pool, NOW!!
Gene Police: "Hey YOU! Get out of this pool."
Gene splicing - sewing a rip in your Levys
Genealogical fishing is done just for the halibut.
Genealogists believe they can always trace an ancestor.
Genealogists do it in the library.
Genealogy = A DNA square-dance in the Thighlight Zone
Genealogy. Tracing descent from someone who didn't.
Genealogy: It's all relative in the end anyway.
Genealogy: Looking for bones in the closet.
Genealogy: tracing us back to the same brother & sister.
GENEALOGY: The Theory of Relativity.
Genealogy: chasing your own tale.
General Brain Failure. (A)bort, (R)etry, (I)gnore, (O)h.
General Stupidity Error Reading Drive C: Erasing all junk
Generation after Yuppies? Bellyuppies.
Generosity and perfection are your everlasting goals.
Generosity is inborn; altruism is a learned perversity.
Generosity should begin at home not overseas.
Genetic engineering: heir styling.
Genetics: Why you look like your father, or should.
Genitalia is NOT an Italian airline.
Genius: One who can do anything except earn a living.
Gentlemen prefer bonds. (Andrew Mellon)
Gentlemen: Start your debuggers...
GEO works while WIN dozes.
George Armstrong Custer - Inventor of the Arrow shirt
George Orwell was an optimist.
Georgia is on my mind.
Geraldo Rivera: Genetic experiment gone bad?
German for 3 blondes in a convertible: Farfromthinkin
German for constipation: Farfrompoopin'.
German word for constipation.....Farfrompoopin!!
Get a bigger gun, buddy, 'cuz I'm not dead yet.
Get a life!
Get a new lease on life, do you have the security deposit
Get a ROBONAP: Will sleep for you while you're online.
Get acquainted with the habit you want to shed.
Get it done.
Get it? Got it? GOOD!
Get married..you can't blame everything on government.
Get me some coffee and then ask me in ten minutes.
Get me to a party with people I can relate to.
Get nowhere: Sit on your butt feeling sorry for yourself.
Get off your ASCII.
Get past the gates, & you'll find we're heavily armed.
Get ROBOnap: Will sleep for you while you're online.
Get someone else to break the shrink wrap.
Get the facts first... then panic.
Get your exercise as a pallbearer for exercising friends.
Get your grubby hands off my tagline! I stole it first!
Get your hands off my tagline! I stole it first!
Get your mind out of the gutter and join me in the sewer.
GET YOUR OWN TAGLINE !!
Get your priorities straight.
Getting a second chance is never a certainty.
Getting desperate, aren't we?
Getting tired yet?
Getting what you want begets wanting more.
Gezundteit has a loose beginning.
Ghosts are merely unsubstantiated roomers.
Gibb's Law: Infinity is one lawyer waiting for another.
Gigabyte: Congressional Budget
Gigabytes, more desirable than Mosquitobytes.
Giggle, snort, damn!.... the beer came out my nose!
GIGO - Garbage in / Garbage out
Gimme a BrontoBurger without so much Rat in it.
Gimme a minute, my shorts are too tight.
Girl who douche with vinegar walk round with sour puss.
Girl who rides bicycle peddles ass all over town.
Girlfriend wants a whale because they have 10ft tongues.
Girls no marry basketball players--dribble before shoot.
Girls...he's all yours.
Git yer luvverly tagloines 'ere! Foiver each!
Give "The gift that keeps on giving" -- A female kitten.
Give 100% and you'll never have to second guess yourself.
Give a gift that keeps on giving -- A female kitten.
Give a man a free hand and he'll run it all over you.
Give a man an inch and he'll park a car in it.
Give a man an inch, and he thinks he's a ruler.
Give a small boy a hammer and everything needs pounding.
Give a speculator an inch and he'll build a condo.
Give a woman an inch and she'll park a car in it.
Give congress a free hand and they put it in your pocket.
Give it hell on beta testing, have a hit when released.
Give me librium or give me meth.
Give me patience . RIGHT NOW.
Give me spam or give me death
Give me the luxuries, and to hell with the necessities.
Give people a second chance, but not a third.
Give Terry Moore to do.
Give the gift that keeps on giving; a female kitten.
Give the man a cigar.
Give them all they want, and all they will want is more.
Give us a grin, little robot, give us a little chuckle.
Give your child mental blocks for Christmas.
GIVE: Support the helpless victims of computer error.
GivingCongresspower&moneyislikegivingateenagerbeer&carkey
Glory may be fleeting, but obscurity is forever.
Gnaw the bone which has fallen to thy lot.
Go ahead, back up to the RAM disk. I dare you.
Go ahead, moderate my day - PUNK!
Go ahead, ruin my day.
Go Ahead.. We're cleared for weird.
Go ahead...MAKE MY DOWNLOAD!!!
Go and catch a falling star...
Go away or I'll taunt you a second time!
Go away, son. You bother me.
Go Hawaiian: Give your gal a lei.
Go on, stand by your man, I don't want him!
Go play in traffic, will ya?
Go soak your head, Puny Human!
Go to a nude beach. Keep abreast of developments.
Go to hell is the only answer a snooper's question rates.
Goals are dreams with deadlines.
God bless ye merry merchants let us make the Yuletide PAY
God created anchovies, Satan put them on pizza.
God created man first, a rough draft, then a masterpiece.
God created people. Samuel Colt made them all equal.
God dislikes money -- look who he gives it to.
God gave burdens shoulders also.
God gives the nuts, but He does not crack them.
God has always been hard on the poor.
God heals, but always someone else wants a fee.
God is a comic playing to an audience afraid to laugh.
God is real (unless He has an imaginary non-zero part).
God is real, unless declared integer
God is subtle but he is not malicious.
God isn't dead, he just couldn't find a parking place.
God left the receiver off the hook; time is running out.
God made everything out of nothing, but it shows through.
God made the first garden, Cain the first city.
God made whiskey to keep the Irish from ruling the world!
God made whiskey to keep the Irish from ruling the world.
God never imposes a duty without giving time to do it.
God said, Let Newton be! and all was light.
God told me it's none of your business - Jimmy Swaggart
God would agree with me, if He had all the facts.
Going tagless has been a freeing experience!
Going the speed of light is bad for your age.
Going to fly? Walk, you'll get there faster!
Gold digger marries prince with palace aforethought.
Gold's Law: If the shoe fits, it's ugly.
Golden Rule: she who has the gold makes the rules.
Goldfish don't like Jell-O.
Goldfish shoals nibbling at my toes, fun, fun, fun...
Golf is a good walk spoiled. - Mark Twain
Golf separates the men from the poise.
Golf--The game for those who don't get enough frustration
Golf: only game players get teed off before starting.
Golfer: A person who hits and lies.
Golfers are happiest when they're feeling below par.
Golfers love to play a round.
Golly, Yogi, I don't think Mr. Ranger's gonna like this.
Gonads: The Thinking Man's Tools
Gone Chopin; Have Liszt; Bach in a minuet.
Gone crazy, be back later. Leave a message.
Good advice is an insult that should be forgiven.
Good advice is given when too old to set a bad example.
Good architecture takes on a life of its own.
Good cooking takes time.
Good day for a change of scene. Repaper the bedroom wall.
Good day for flying but bad day for landings....
Good day for overcoming obstacles. Try a steeplechase.
Good day to let down old friends who need help.
Good fortune at times seems to favor the stupid.
Good girls get Heaven; Bad girls, the world.
Good grief, is this the interior of a flying saucer?
Good habits are as easy to form as bad ones.
Good health will be yours for a long time.
Good is not good enough where better is expected.
Good luck is a lazy man's estimate of a worker's success.
Good manners are made up of petty sacrifices.
Good manners are the lubricant of social intercourse.
Good memories are what your heart carries in its pockets.
Good morning!" is an opinion, not a greeting.
Good Morning, Life Form! Are you sitting comfortably?
Good news from afar can bring you a welcome visitor.
Good news: Ten weeks from Friday may be a pretty good day
Good night, Mrs. Calabash, wherever you are.
Good printers do it without wrinkling the sheets.
Good publicity or Bad, publicity is PUBLICITY!
Good sense is easier to have than use.
Good taste is the flower of good sense.
Good things come to those who wait: Windows User Handbook
Good wine is a good familiar creature if it be well used.
Good, if brief; twice good. Bad, if short, isn't so bad.
Goodbye artificial Universe, hello real one.
Goodbye Earthman, hope the lifestyle comes together.
Goodness has NOTHING to do with it.....
Goodness if the only investment that never fails.
Goodwill: ability to say no in a computer store.
Gossip: Admitting you have nothing to say.
Got any new leather goods?
Got arrested for going 14400 in a 2400 zone.
Got Kleptomania? Take something for it!
Got kleptomania? Be sure to take something for it.
Gotcha!
Gotta go..... it's getting deep, and my boots leak.
Gotta hide the phone bill from my wife.
Gotta run... the cat's caught in the printer again!
Government by the elderly...GERONTOCRACY!
Government Cut Backs - A mythconception.
Government expands to absorb revenue and then some more.
Government expands to absorb revenue--and then some.
Government is the problem, not the solution.
Government should spend our money like it was their own.
Government Spending - OUCH! That's *my* pocketbook!
Government: group that does violence to the rest of us.
Government: nothing they say should be believed.
Govt: Separate church/state; taxpayer/money.
Grab 'em by the short hair, get a sex harrassment suit!
Grade curves encourage mediocrity.
Graffaxi: unsolicited comments received on fax machine.
Graffiti has changed deface of the nation.
Grammar! What big teeth you have!
Grand Prize Drawing. To see if you won type (ALT-H)!
Grandchildren: Your gift for not killing your kids!
Grandparents: reliable baby-sitting.
Grant me the strength to ignore ignorance
Graphic Artist seeks Boss with vision impairment.
Graphics may save 1,000 words, but use 10 megabytes.
Grass is always greener before you smoke it.
Gratitude is merely the secret hope of further favors.
Graveyards are full of the indispensable.
Gravidity - what keeps you from floating off the planet.
Gravity always wins.
Gravity brings me down.
Gravity is a myth, the Earth sucks.
Gravity isn't MY fault! I voted for Velcro.
Gravity isn't my fault. Hey, I voted for velcro.
Gravity sucks!
Gravity: Not just a good idea, it's the law.
Gravity? No, no. It's the devil keeping us down
Great men and women are not always idiots.
Great minds may at times think alike, if at all.
Great taglines tempt me into becoming a kleptomaniac.
Greed is good, greed works.
Greetings from Hell....wish you were here.
grep..grep..grep... (Frog w/UNIX stuck in throat)
Grin amber it.
Grippe: A suitcase for carrying flu medicines.
Groan!
Groin - to increase in size.
Groom: Man with a fine prospect of happiness behind him...
Groop I implore the, my foonting turingdromes.
Gross anatomy - a really ugly person.
Gross!
Groucho Mucias!
Ground Beef -- A cow with no legs.
Ground yourself, THEN hug your motherboard!
Grow you own dope, plant a politician!
Grow your own dope ...Plant a politician
Growing old is mandatory, growing up is optional.
GST = Going South Tax...
Guarantee clauses are voided by payment of the invoice.
Guess who's coming to dinner. -- Chekov
GUI? FUI!
Guilt trip: driving to the florist shop.
Guinan's secret power: her hat is a solar panel.
Gun control is a firm grip on a .44 magnum
Gun Control is being able to hit your target.
Gun Control means using 2 hands
GUN CONTROL.......The ability to hit what you aim at!
Gun Control: Being able to hit your target.
Gun Control: Keep muzzle pointed at target.
Guns don't cause crime any more than flies cause garbage!
Guns don't kill people off-line readers do.
Guns don't kill people; it's these little hard things!
GUTS is: Telling the moderator he's off topic.
Guy with no arms or legs and still rings doorbell? Dick.
Guy with no arms or legs hanging on the wall? Art.
Guy with no arms or legs in front of the door? Matt.
Guy with no arms or legs lying under a car? Jack.
Gypsies, Thieves, Cutthroats, Administrators.
Gêmeo tenta suicídio e mata irmäo por engano!
H y! Wh r did my " " k y go?
Had a head crash.
HaHaHa! Yuk, Yuk. Snort. Harumph.
Hail, hail, rock and roll.
Hailing frequencies open, Captain.
Hairy fishnuts, anyone?
Half a loaf is surely much better than no vacation at all
Half Moon tonight -- its better than no Moon at all.
Half the lies they tell about me aren't true!
Halftoning is a gray area.
Halt and catch fire.
Hammertoe - occurs to clumsy carpenters.
Hams do it with frequency, till their GIGAHERTZ.
Han Wavel consists of luxury hotels carved by erosion.
Hand me that ax, Eugene. I'm about to do some hacking...
Hand me the HOLY HAND GRENADE!
Handcrafted from the finest ASCII
Handle with care: Disabled tagline.
Handle with care: Elderly tagline.
Handshake - How computers get friendly.
Handwritten on a condom machine; "This gum tastes funny."
Hang up your logic over there.
Hangnail - a coat hook.
Hangnail: A place to hang your coat and hat upon entering
HANGOVER: the wrath of grapes.
Happiness can't buy money!
Happiness is a computer with a sense of humor.
Happiness is a positive cash flow.
Happiness is a twit filter...
Happiness is a warm modem....
Happiness is an inside job.
Happiness is being furry.
Happiness is finding special characters
Happiness is mandatory....Are you happy?
Happiness is no laughing matter.
Happiness is your favorite program moving to Windows
Happiness is: Accidently hitting the reset button!
Happiness, like misery, is usually self-inflicted.
Happiness: a combination of good health and a bad memory.
Happiness: A sensation arising from misery of others.
Happiness: Lubbock, TX, in the rearview mirror.
Happiness: Seeing your MIL's picture on a milk carton
Happy as a hog eating cow manure -- well lick my lips!
Happy couple: A deaf husband and a blind wife.
Happy is the child whose father died rich.
Happy Mails To You.
Happy motoring!
Happy Thanksgiving! Don't drink too much Turkey...
Happy Trails To You Until We Modem Again.
Happy Trails to you, until we meet again.
Hard disks never die...they just grind away.
Hard Drive - Baseball, Golf and Football, oh, Computers.
Hard Drive Backed Up? Try Hex-Lax!
Hard Drive: What golfers wish for.
Hard where? Soft where?
Hard work has a future payoff. Laziness pays off now.
Hard work never killed anyone, but why chance it?
Hardware Independent: Won't work with ANY hardware.
Hardware: The part you kick.
Hardware: The parts of a computer that can be kicked.
Hardware: This you kick. Software: This you corrupt.
Hari Karaoke: Ritual disembowelment after you sing...
Hark, what mail from yonder modem breaks?
Has a few wait states.
Has a one-way ticket on the Disoriented Express.
Has a slow clock.
Has all her bricks, but no cement holding them together.
hAS ANYONE SEEN MY cAPSLOCK KEY?
Has anyone seen my sanity?
Has Faye Dunaway with her acting career?
Has it floored in neutral.
Has Robert Redford, the presidential memoirs?
Has signs on both ears saying "Space for Rent".
Hasten slowly -- Suetonius
Hasten to laugh at everything, or later you may weep.
Have a NICE day.
Have a nice DOS .......
Have an affair. It will break up the monogamy.
Have Gun - Will Lobby
Have Pam Dawber makeup before the next scene.
Have some Vegan Rhino's cutlet.
Have stock? Will broker.
Have the boy sent to the bridge. - Picard
Have the computer beep me, when it is ready.
Have Tongue Will Babble
Have Tongue Will Grovel
Have tree, will climb - just as all my ancestors did.
Have we seen this kind of thing before?
Have you a clock? I'm meant to be saving the universe.
Have you any Grey Poupon?
Have you considered suing your brains for non-support?
Have you ever read the instructions on toothpicks?
Have you ever wished you could download a pizza?
Have you had a significant new idea of your own lately?
Have you hugged your computer today?
Have You Hugged Your SysOp Today??
Have you hugged your Teleray today?
Have you much experience of computers?
Have you pushed a Ford lately?
Have you seen my mind? It wandered again...
Have you stole your Tagline today?
Have you...Have you held one to your ear?
Having a great time. Food, wine, a little personal abuse.
Having trouble wrapping words around your concept?
Hawaii is as American as apple poi.
Hawaii shorts: What a wallet has after a vacation there.
He (God) seems to have an inordinate fondness for beetles
He agreed with the sign, "Fine for parking."
He ain't heavy; he's a Shareware Reviewer.
He became a seer because he was such a lousy alchemist.
He bellows like a cow standing on her tit.
He big man, have -many- pigs.
He cannot rule the great who cannot rule the small.
He compresses the most words into the smallest ideas.
He could have made it if it not for Sunday afternoons.
He could sense too the thrill of being a tree.
He does the work of 3 Men...Moe, Larry & Curly
He hadn't realized that life speaks with a voice to you.
He has all the charm of a dirty Christmas card.
He has too many lice to feel an itch.
He hasn't a single redeeming vice.
He is a deeply superficial person.
He is a self-made man, and worships his creator.
He is a sheep in sheep's clothing.
He is diagonally parked in a parallel universe.
He is no lawyer who cannot take two sides.
He is not only dull within, but causes dullness without.
He is the most sensible looking man talking nonsense.
He is truly wise who gains wisdom from another's mishap.
He isn't chicken, but they're naming salads after him.
He isn't dead; He's electroencephalographically challenged
He knew where his towel was.
He knows not his own strength that hath not met adversity
He lifted himself up by his own bootstraps.
He lived a good life, he had a good time. Amen.
He looked like something a farmer would scare birds with.
He said he'd come, you've waited, he has 8 min left.
He says a thousand pleasant things, but never "Adieu."
He spent his last shilling on a purse.
He started slow, then tapered off...
He that can have patience can have what he will.
He that deeply desires honor, is not usually worthy of it
He that hath ears to hear, let him hear.
He uses slugs to call Dial-A-Prayer.
He waited for the end, not realizing it had been and gone
He walks as if balancing the family tree on his nose.
He walks down Lover's Lane holding his own hand.
He wanted her and didn't care who knew it.
He was a bold man that first ate an oyster.
He was roughly humanoid in appearance.
He was so crooked you could use him to pull corks with.
He was tall and he gangled.
He wasn't his mother's favorite, and he was an only child
He who always plows a straight furrow is in a rut.
He who attacks my ideas attacks democracy itself.
He who boasts of an open mind may only have a vacant one.
He who dies with the most of anything, is still dead.
He who dies with the most taglines wins!
He who dies with the most toys...is still DEAD!
He who does nothing never knows when he is done.
He who falls in love with himself will have no rivals.
He who fights & runs away will live to fight another day.
He who fishes for compliments can expect to be handed a
He who fishes for compliments can expect to get a line.
He who fishes in other man's well often catch crabs.
He who has a shady past knows that nice guys finish last.
He who has no fire in himself cannot warm others.
He who hesitates at the wrong time is lunch for a shark.
He who hesitates is honked at.
He who hesitates is last.
He who hesitates is left.
He who hesitates is lunch !
He who hesitates is several miles from the next exit.
He who hesitates is sometimes saved.
He who hesitates too long, must change his underwear.
He who is henpecked may lend an ear to other chicks.
He who laughs last didn't get the joke.
He who laughs last is a little slow on the uptake.
He who laughs last probably didn't understand the joke.
He who laughs last probably doesn't understand the joke.
He who laughs last probably made a backup
He who laughs last... had to have it explained.
He who laughs, lasts.
He who plants trees loves others he will never know.
He who plays with self pull a boner.
He who talks too much commits a sin.
He who wakes up finding himself a success, hasn't slept.
He who wonders discovers that this in itself is wonder.
He will be missed...
He would call it the right result, who would know?
He would have laughed out loud, but he didn't have room.
He wouldn't recognize subtlety if it hit them on the head
He's a chicken, I tell you!
He's a chip right off the old shoulder.
He's a few french fries short of a Happy Meal.
He's a few fries short of a Happy Meal.
He's a few revisions behind.
He's a few sandwiches short of a picnic.
He's a few volts below threshold.
He's a few yards short of the hole.
He's a potato Jim!, Let's gouge out all of his eyes!
He's alive, Jim. Should I shoot him again?
He's an example of Spontaneous Para-casual Phenomenon.
He's been described as 'pussy whipped'. How is this done?
He's dead Jim...... Grab his wallet Spock!
He's dead, Jim. Kick him if you don't believe me
He's dead, Jim. I'll get the tricorder, you get his money
He's got a few tiles missing from his space shuttle.
He's got a magnet! Everybody BACKUP!
He's in, but he's out to lunch.
He's just a politician trying to save both his faces...
He's not a lousy pilot, he's gravitationally challenged.
He's not dead, Jim, he's just metabolically challenged.
He's spending a year dead for tax reasons.
He's such a good speaker, even a cough sounds read.
He's tan, he's rested. Nixon in '92!
Head: Device for finding chandeliers in the dark.
Headline: Breast implants seized by marshalls
Heads I win, tails you lose.
Heads will roll.
Health is the slowest possible rate at which one can die.
Healthy Trekkers work out at the He's Dead Gym.
Heard melodies are sweet, but those unheard are sweeter.
Heartburn is the Justice Of Pizza in this area.
Hearts will never be practical 'til they're unbreakable.
Heaven allows glimpses only to those at a distance.
Heaven doesn't want me and hell is afraid I'll take over.
Heaven has no rage like love to hatred turned.
Heavens to Mergatroid!!! Exit stage right------->
HEBREW - the **MANLY** beer!
Heck Butler: 'Frankly my dear, I don't give a darn!'
Heck's Angels: Born to be Mild.
Heh... I'm sure *someone* does.
Heigh-Ho, Heigh-Ho, it's modeming we'll go...
Heisenberg may have been right.
Hell hath no fury like a demon scorched. - C. Mather
Hell hath no fury like a pacifist.
Hell hath no fury like the lawyer of a woman scorned.
Hell is kept warm with profane burners
Hell with Pascal and C. I am a QuickBasic Snob.
Hell, Heaven or Hoboken by Christmas.
HELLO HELlo HEllo Hello hello...echoes pretty good, eh?
Hello Mastercard?...... Do you take Visa?
Hello pension! goodbye tension.
Hello, good evening and welcome, to BLACKMAIL!
Hello, I am part number │║▐║│║│█│║▌│║▌││
Hello, it's me again.
Hello, operator? Give me the number for 911!
Hello... hello... Is there anybody in there?
Hello....Incontinence Hotline....Can you Hold?
Help !!! I have lost my ANY key!
Help a swallow land at Capistrano.
Help a swallow to land at Capistrano.
Help Desk: If you hear nothing, you did your job right.
Help eradicate and abolish redundancy.
Help keep your Congressmen out of politics.
Help me look, Please? I've lost my damned innocence again
Help me make it through the night...
Help me quick! Someone must have turned reality back on.
Help me, I'm stuck in here! - A Tagline.
Help stamp out and abolish redundancy!
Help stamp out vandalism, or I'll break all your windows.
Help stamp out Windows in your lifetime!
Help stamp out, eliminate and abolish redundancy!
Help! I'm parked diagonally in a parallel universe.
HELP! I'm trapped in this computer!
Help! Trapped in .QWK. Please unzip me.
HELP! HELP!, I'm slowly going MAAAAAAAAAAAD!!!!
Help! I can't find the "ANY" key.
Help! I have tagophobia!
Help! I'm a prisoner in a Tag Line Factory!
Help! I'm being abused by an end user!
Help! I'm being held prisoner by this BBS!
Help! I've fallen and can't reach my beer.
Help! I've fallen and I can't reach my coffee cup!
Help! I've formatted, and I can't boot up!
HELP! Protect America's children, soil, and water today.
Help! The paranoids are after me!
Help, Help! I'm being repressed!
Help, I'm modeming! And I can't hang up!
Help, I've fallen and can't reach the beer.
HELP,TAGLINE WANTED...SEE THE WORLD...FREE ACCOMMODATION
Help. I'm trapped at 0D1C:01DA.
Hep me, I'm white and I can't git down!
Her chore: Clean House; His chore: Fill Ice Cube Tray.
Her erogenous zones start four miles from her actual body
Her last birthday cake looked like a prairie fire!
Here I run, to steal the secret of the sun.
Here I sit with a worm on my tongue! (Baited Breath!)
Here I sit, in a tizzy; all my favorite boards are busy
Here is further away than you think.
Here Tag! C'mon Tag! Good Tag. Good boy!
Here today, dawn tomorrow.
Here we operate at a 90° angle to reality
Here's a quarter. Call someone who cares.
Here's looking at you, kid.
Hero-worship: Idol gossip.
Hero: Ordinary person in extraordinary situation.
Hex Dump" - Where Witches put used Curses?
Hex Dump: Place for witches to get rid of used curses.
Hex Dump: Where witches put used curses.
Hey ..... who took the cork off my lunch?
Hey buddy, could you spare a few bits?
HEY hey YOU you GET OFFA MY CLOUD!
Hey look, it's Kermit The Fag in drag!!!
Hey look, there's someone in the rain, what a jerk!
Hey man, you can't prove nothing. I was at home.
Hey Odo, got any more of that Jell-O in the 'fridge?
Hey Santa, how much for your list of naughty girls?
Hey! Don't chew on that ^?=%&`*@#~!... NO CARRIER
Hey! Don't pick up the pho╪╙µôµ╪*Ñ8>ƒ
Hey! I see you're wearing one of my tagline originals.
Hey! Some fat guy stole my milk and cookies!
Hey! This ain't my body! It belongs to Willard Scott!
Hey! Was that thunder I heard @ÿΣ▐£¼*╬╣F/▌&┬êú,
Hey! Where's the tagline I left here a minute ago?
Hey, darlin', how about a little QWKie?
Hey, dude! Whod'a thunk it?
Hey, Earthman, what's eating you?
Hey, is that really a piece of fairy cake?
Hey, Rocky, watch me pull a rabbit out of my hat.
Hey, some fat guy stole my milk and cookies.
Hey, what does this RESET butto
Hey, what's that beeping noise? Where's that smoke coming from?
Hey, where's the Page Sysop command in Blue Wave?
Hey. Don't pick up that pho╫»╗Æßë╜├╥τ NO CARRIER.
HHG field staff cannot accept favors unless they want to.
HHG is definitive, reality is frequently inaccurate.
HHG, better selling than Big Bang Theory - Personal View.
HHG, more popular than Life Begins at Five Hundred Fifty.
HHeellpp!! II''mm ssttuucckk iinn hhaallff dduupplleexx!!
Hhhe who hhhessitates is lllost.
Hi! I'm a tagline virus! Steal me & join in the fun!
Hi! I'm from the government. I'm here to help myself.
Hi, hello, how are you?
Hi, I'm Chip. Micro Chip. Eight-o-three-eighty-six!
Hi, I'm from the Government. I'm here to help.
Hi, Mr. Rex! I'm Barney! I love you. You love m- *CHOMP!*
Hi, my name is Rover, I'll paint your car yellow free.
Hi-Ho Hi-Ho, its off to the Home I go!
Hi-Ho Hi-Ho, its off to the institution I go!
Hick: Looks both ways before crossing a one-way street.
Hide when you bite your nails, or everyone will wonder.
High message: 943432. Message you last read: 59
Him STRONG, like bull - SMART, like tractor...
Hindsight is an exact science.
Hindsight is the most exact of the sciences.
Hippocratic oath - swearing by hippos.
Hire a ghost writer if the spirit doesn't move you.
Hire a teenager while they still know it all.
Hire teenagers while they still know everything.
Hire the morally handicapped
Hirsute - not to be confused with his suit (feminist term
His face was filled with broken commandments.
His head whistles in a cross wind.
His mother should have thrown him away and kept the stork
His source code is missing a few lines.
His wife wanted climbing roses, but he wanted axes.
Historian: an unsuccessful novelist.
History books which contain no lies are extremely dull.
History doesn't repeat itself. Historians do.
History is a lie commonly agreed upon. - Neitzche
History is a lot of old stuff.
History is a set of lies agreed upon.
History is being polluted.
History is made at night.
History is written by the survivors.
History repeats itself because nobody listens.
History repeats itself; that's what's wrong with history.
History was gathering itself to deliver another blow.
History would be a wonderful thing; if only it were true.
Hit and run means never having to say you're sorry.
Hiya, Doc! What's cookin'? - Data
Hm..what's this red button fo║╜»░╖╝NO CARRIER.
Hmm! Sounds wonderful!
Hmmm, When is the last time the Tooth Fairy visited you?
Hmmmmm.... never tried an atomic bomb before.
Ho Hum
Hobo: A person who builds palaces and lives in shacks.
Hold it! One false move and the C drive gets it!!
Hold it! There has been a major scientific break-in!
Hold on - wait, maybe the answer's looking for you.
Hold the pickles, hold the lettuce. - Henry VIII
Hollywood is like Picasso's bathroom.
Hollywood: A trip through a sewer in a glass bottom boat.
Holy Razorblades, Batman. That was a close shave.
Home Computing: Acquire more goodies than the next guy $$
Home is where you can scratch any place it itches!
Home SCUD demo: Blow up a balloon and let it go.
Home where the buffalo roam? A messy house.
Home, to a young boy, is merely a filling station.
Homework time limit exceeded. Auto logon in effect!
Honest Ma, I got it from a toilet seat...
Honest Politician: One who stays bought.
Honest teacher. A virus really DID eat my homework!
Honest, officer, we were all in the back seat singing!
Honesty is next to poverty.
Honesty pays, but not enough for some.
Honesty pays, but not enough to satisfy some people.
Honesty's the best policy but insanity a better defense.
Honesty: Fear of being caught.
Honey in the mouth and knives in the heart.
Honey, if you shave your legs tonight I'm off the BBS!
Honeymoon - the time between I do and you'd better.
HONK if you have never seen an UZI fired from a Truck !
Honk if you like obscene gestures!
Honk if you love peace and quiet.
Honor would be better served if I were your mate.
Hookworm - most popular bait fishing worm.
Hooptioulsy dragle me with crinkly bindlewurdles.
Hope you can walk on water, you are on thin ice right now
Horn busted! Watch for "sign language"....
Hors d'oeuvres-- a ham sandwich cut into forty pieces.
Horseman: "I've fallen and can't giddyup."
Hospital: A workshop for the repair of faulty humans.
Hospitals: Places where the run down wind up.
Hot air sometimes thaws out a cold reception.
Hot glass looks exactly the same as cold glass.
Hot Water Heaters - Hot water needs heating?
Hotel: A place you give good dollars for bad quarters.
House Chex... no snap, crackle OR pop... they BOUNCE !
Housework can kill you if done right.
Housing & Urban Development........Leona Helmsley
How 'bout that car for heavy drinkers, the VW Passout...
How about what's yellow and dangerous?
How can I miss you if you won't go away?
How can I prove I am not crazy to people who are?
How can we eat?
How can you tell the dance from the dancer?
How come all the buttons keep flying off my shirt?
How come I get all the hard questions?
How come men got nipples?
How come pizza gets to your house faster than the police?
How come they call 'em APARTments when they're attached?
How come this jacket they gave me doesn't have sleeves?
How come wrong numbers are never busy?
How could anything alter reality for $9.95?
How did I get here, and WHO are YOU???
How did I get round from eating square meals.
How did I get so round just from eating square meals?
How dieth the wise man? As the fool.
How do bees get to school? They ride the school buzz.
How do blonde braincells die? Alone.
How do frogs die? They Ker-mit suicide!
How do frogs die? Ker-mit suicide
How do girls get minks? - The same way minks get minks.
How do I love thee? Let me count the ways!
How do I set my laser printer to "stun?"
How do I use this hard drive head cleaner?
How do these taglines work again?
How do they get teflon to stick to the pans?
How do you chew the eraser off of your text editor ??
How do you cure a woman of Nymphomania? Marry her!
How do you get an Aggie out of a tree? Wave at him.
How do you keep an idiot in suspense? TELL YOU LATER!!!
How do you know it's summer in Seattle? The rain's warmer
How do you make a hormone? Don't pay her...
How do you make Windows faster? Throw it harder!
How do you save a drowning lawyer? Throw him a rock.
How do you spell relief?
How do you stop a woman from having sex? Marry her.
How do you Telemate you've been fooling around?
How does a blonde high-5? Smacks herself in the forehead.
How does a blonde part her hair? (spread thighs)
How does Michael Jackson pick his nose? From a catalog!
How else could I afford to have my face dropped?
How many babies can a motherboard have?
How many Borg does it take to screw in a lightbulb? All of them.
How many candidates does it take to screw up an election?
How many lawyer jokes? 3, the rest are true stories.
How many of you believe in telekinesis? Raise MY hands.
How many priests are needed for a Boston Mass?
How many programmers does it take to change a lightbulb?
How many roads must a man walk down?
How many taglines does that make now?
How many times do you need to be tolled anyway?
How much can I get away with and still go to heaven?
How much deeper would the ocean be without sponges?
How much memory have you got? One brain, one memory.
How much wood did Peter Piper pick... no, wait...
How much work could a network net if a network could net
How reliable? How shallow is the ocean, how cold the sun?
How time flies, when you are in a heap of problems.
How time flies, when you have a heap of problems.
How to kill dissent? Kill the dissenters.
How to kill gossip? Kill the gossip.
How to make a long story short: Forget the punch line.
How to make Kleenex dance? Blow a little boogie in it.
How to spell embarrassment? F-E-L-F-L-A-T-A-M-A-F-A-C-E
How to stay cool #1: Establish priorities.
How to stay cool #2: Exit or wait.
How to stay cool #3: Verbalize, don't criticize.
How to stay cool #4: Keep it short.
How to stay cool #5: Stay in the present.
How to stay cool #6: Put it in writing.
How to stay cool #7: Restore good feelings.
How to tell when a lawyer is lying? His lips are moving.
How we spend our days is how we spend our lives.
How wise are they that are but fools in love.
How wonderful opera would be if there were no singers.
How ya gonna do it? IBM Blue it!
How you describe a cow after an abortion? -De-calf-inated
How you look depends on where you go.
How you look depends on who is looking.
How'm I flyin'? Dial 1-800-BORG-YOU. -Borg
How's this for diplomacy? Shoot them all! --Kirk
How...did you do that? No idea. Not a clue.
Howe's Law: Everyone has a scheme that will not work.
Howmuchworkcouldanetworknetifanetworkcouldnetwork?
Hug your kids at home and belt 'em in the car.
Hug: A roundabout way of expressing affection.
Hugh today, Borg tomorrow...
Human Being: An ingenious assembly of portable plumbing.
Human body: can't pat one's back or kick one's own butt.
Humanity prefers comfort over truth.
Humankind cannot bear very much reality.
Humans act rationally when all options are exhausted.
Humans are animals in search of the ultimate orgasm.
Humans sin by both omission as well as commission.
Humans: only creatures that let their children come back.
Humans: The species that should have never been...
Humble pie is always hard to swallow with your pride.
Humility is no substitute for a good personality.
Hummingbirds never remember the words to songs.
Humor always plays very close to the hot fire of truth.
Humpty Dumpty DOS - Just a shell of himself.
Humpty Dumpty Jumped!
Humpty Dumpty was PUSHED!
Hungarian food is OK if you like dog tartare.
Hunting is no fun when the rabbit has the gun.
Husband and wife plan fight. TIFF at 11.
Husbands are like fires; they go out if left alone
Hydrophobia - fear of fire hydrants.
Hypochondriacs are really sick people.
Hypocrisy is the type of homage vice pays to virtue.
Hypothetical questions get hypothetical answers.
I *AM* RELAXED!!! - Worf
I *did* read the docs; that's why I'm confused!
I accept responsibility..I just don't do anything!
I accept responsibility... I just don't do anything!
I aim my warning shots to center of body mass!
I ain't broke, but I'm badly bent.
I almost forgot! It's absolutely VITAL to always se
I almost saw Elvis, but the headstone fell on me.
I almost stole a tagline! I'm so ashamed!
I almost stole another tagline. I'm so ashamed.
I always did like climbing trees, is this genetic?
I always laugh at the wrong time. At my own funeral....
I always take off my mittens when I type--don't you?
I am a deeply superficial person.
I am a man more sinned against than sinning. - King Lear.
I am a mental tourist, My mind wanders!
I am a misanthrope. What the hell's YOUR problem?
I am afraid that is beyond my design parameters. ■ Data
I am against sects on TV
I am Al Bundy of Borg: We will *not* assimilate!
I am always exact and precise (more or less).
I am as nervous as a tree on the Lassie show about that.
I am as poor as Job, but not so patient. - Shake.
I am Barney of Borg: We will hug you & squeeze you & love you!
I am Bubba of Borg...Y'all are fixin' to be assimilated.
I am Cat of Borg. We will assimilate your shiny things.
I am committed -- or should be.
I am Ernest of Borgnine. Prepare to be assassinated.
I am Homer of Borg. Prepare to be assi.....Ooooh, donuts...
I am immortal. I have inside me blood of kings!
I am in particularly scintillating form at the moment.
I am in total control, but don't tell my wife.
I am in total control, but please don't tell my wife.
I am just sick and tired of being sick and tired.
I am Locutus of Borg, Do you have any Grey Poupon?
I am Locutus of Borg. I demand Earl Grey tea - for 10000.
I am looking for a meaningful overnight relationship.
I am Mac of Borg: Prepare your money to be assimilated.
I am McMahon of BORG... You may already be assimilated!
I am NOT 45. I'm 19 with 25 years of experience!
I am not a dictator. It's just I have a grumpy face.
I am not an alien from space reconnoitering this world.
I am not an animal! I am what I am, but not an animal.
I am not arguing with you, I'm telling you.
I AM NOT Paranoid! Which of my enemies said I was?
I am NOT Paranoid! And why are you always watching me??
I am NOT picking my nose! I'm pointing at my brain.
I am not sincere, even when I say I am not.
I am NOT under the affluence of incohol!
I am not young enough to know everything.
I am perfectly sane, and so am I.
I am programmed in multiple pleasuring techniques.
I am serious, it's just the universe I'm not sure about.
I am the chosen one, and I choose to go shopping - Buffy
I am the terror that posts in the night!
I am the walrus. You're not.
I am tolerant of your fruitcake like beliefs.
I am torn between conflicting apathies.
I am waiting for Windows v4.0!
I am what I am and that's all that I am.
I am what I am, and I'm hungry.
I am who I pretend to be at that point in time and space.
I am Zsa Zsa of Borg. Prepare to be assimilated, dahling.
I am, of course, any thinking woman's everyday fantasy.
I am.....
I appeal to a small group of very confused people.
I asked about buses, but the man looked at a calendar.
I base my fashion choices on what doesn't itch.
I base my fashion taste on what doesn't itch.
I BBS because no one can read my handwriting!
I be nibble, you be quick, he jump over the joystick.
I believe I will take this opportunity to remove my ears.
I believe in moderation - but only if there's plenty...
I believe in The Divine Right of Sysops.
I believe we're under attack, but I'm not too sure.
I believe we're under attack. - Col. Travis
I blow my nose at you, you donkey bottom biter!
I booted my computer. Broke my damn toe!
I bought dehydrated water...but I don't know what to add.
I bought powdered water, now I don't know what to add.
I breathe - therefore I shop.
I call my computer "Hole in the Desk"
I call things as I see them; if not then I make them up.
I came for a week and got stuck for 15 years.
I came. I saw. I charged it.
I came...I saw...I had NO idea what was going on...
I came; I saw; I screwed up.
I can assure you that size will not be a problem. ■ Worf
I can be decisive, I think.
I can keep a secret. It's the people I tell that can't.
I can keep this up as long as you can!!!
I can only assume that this is not first-class.
I can read this. And I did!
I can resist anything but temptation.
I can resist everything/anything except temptation.
I can see clearly now... the brain is gone...
I can SPELL, I just can't TYPE worth a hoot !
I can walk on water, but I stagger on alcohol.
I can write better taglines than this!
I can't - He can - what the hell, I'll let him do it.
I can't afford a new T.V. Maybe I'll just get arrested.
I can't be fired....... slaves have to be sold.
I can't be over the hill...every day is an uphill battle!
I can't be overdrawn, I still have checks.
I can't be stupid, I completed third grade.
I can't believe I ate the whole thing!
I can't believe I responded to this!
I can't believe I wrote that whole thing.
I can't believe my computer's on fire.
I can't believe this garbage!
I can't complain... but sometimes I still do.
I can't decide whether to make a decision or not.
I can't even think -straight-!
I can't remember where I parked my hard disk.
I can't see you, so don't pretend you're there.
I can't survive doing 55. Oh, unless it's megahertz.
I can't use Windows. The cat ate my mouse.
I can't watch Kelly Lynch her next leading man.
I can't, Doctor. I might hurt you. ■ Worf
I cna ytpe 300 wrods pre mniuet!!!
I come from Alabama with a QWK packet on my knee...
I come in peace. Take me to your Lizard.
I come unbundled.
I consider cake and ice-cream my just desserts.
I could be arguing in my spare time.
I could enjoy the day more if it started later.
I could have more fun in a cat litter pan.
I could have more fun in a cat litter.
I couldn't be having any more fun if I was twins!
I dated Betty Crocker, She was Moist and Easy!!!!
I design coastlines. I got an award for Norway.
I despise the pleasure of pleasing people whom I despise.
I despise WINDOWS!
I did read the docs, that's why I'm confused!
I didn't believe in reincarnation the last time either.
I didn't cheat, I just changed the Rules!!
I didn't choose to be here, I don't want to get involved.
I didn't even get a chance to thank him...
I didn't get the documentation for the manuals.
I didn't know it was impossible when I did it.
I didn't write this; a very complex macro did.
I distinctly remember forgetting that.
I DO have a clue... hold on 'til I recall where I put it.
I DO have a clue; wait while I remember where I put it..
I do hope you will win, the prizes are so nice.
I do know a few things about anatomy, Jean-Luc. ■ Beverly
I do not pretend to know what the ignorant are sure of.
I DO NOT...I do not yell. -- Worf
I do whatever my Rice Krispies tell me to do.
I don' gotta show you no steenking tag line.
I don't believe in miracles, I rely on them.
I don't care about your life, and don't send me the bill.
I don't care if it's kinky, Untie my chicken!!!
I don't do taglines.
I don't do windows, but OS/2 does.
I don't drink before noon....it's noon somewhere.
I don't eat snails - I only eat fast food
I don't get it.
I don't have a life, I have a BBS.
I don't have a solution but I do admire the problem.
I don't have the time for a hobby. I have a computer.
I don't have to look up my family tree. I'm the sap.
I don't have ulcers. I give them.
I don't just tempt fate - I give it the finger.
I don't know about ignorance and apathy. Who cares?
I don't know about you, but I'm touched.
I don't know how much more she'll take of this, Captain.
I don't know much about panda bears, Number One. ■ Picard
I don't know what it is, but it's in great condition.
I don't know, what do you think?
I don't like broccoli either.
I don't like principles. A prejudice is more honest.
I don't like the look of that planet at all.
I don't need a warranty. I'll just take it back..
I don't need to convince them... just confuse them.
I don't normally drink, but I'm not normally normal.
I don't recall running for this office...
I don't steal taglines -- I replicate them.
I don't steal...I reverse engineer!
I don't think Mr. Ranger is going to like this, Yogi.
I don't think so... Homie don't play that!
I Don't Think We're In Kansas Anymore Toto
I don't understand half of what I know about this stuff..
I don't want it now, I want it RIGHT now!
I don't want to be immortal. I just don't want to die.
I don't want to be right--I want to know if I am right.
I don't want to be there when it's time for me to die.
I don't want to go to heaven with a headache.
I don't want to HAVE to enter a tagline on every message!
I don't want to think. I just want to be...
I don't drink anymore, now I just freeze my beer & eat it
I drink therefore I am ... O-}
I drink to make other people more interesting <hic>!
I either want less corruption, a chance to participate.
I envy people who can do a backwards somersault.
I envy people who can travel with one piece of luggage.
I envy people who speak foreign languages easily.
I envy people with good posture.
I envy soldiers who live to tell about it.
I fear explanations explanatory of things explained.
I fear needing explanations of things explained.
I fear you must blame your own perverse urges. ■ Picard
I feel better than James Brown... how do you feel?
I feel I need to be beautiful. Am I?
I feel like a fugitive from the law of averages
I feel more like I do now than I did a while ago.
I feel much better since I gave up hope.
I figured out what I was doing right, it doesn't anymore.
I finally got it all together, but forgot where I put it.
I find push buttons very depressing......
I forgive my enemies, but only after they've been hanged.
I forgot what memory is for.
I fought the lawn and the lawn won...
I gave my view of the universe, and it committed suicide.
I gave up on my wife and married my computer.
I get by with a little help from my friends.
I get mail, therefore I exist.
I get stranger things than you free with my cereal.
I give up. Push me that hollow log and I'll climb in.
I got arrested for going 14400 in a 2400 zone.
I got it all together, then forgot where I put it.
I got lost in thought. I was in unfamiliar territory.
I got lost in thought. It was unfamiliar territory.
I got moderated before I got to do anything wrong!!!
I got my act together and forgot where I put it!
I got real close to seeing Elvis, but my shovel broke.
I got tunnel carpal syndrome dunking donuts.
I got yanked back into the world as a bunch of petunias.
I gpt a toucj typ)inf coirse fur Chrustmes!
I guess it all depends on your reference system...
I had a cat once. It tasted like chicken.
I had a dislocated funny bone <OUCH> but it's better now.
I had a handle on life, but it broke.
I Had A Life Once, Now I Have A Computer
I had a terrible nightmare...I was normal.
I had a thought, and I lost it.. nothing new.
I had my head x-rayed today. Nothing there.
I had quite a run today. Ice Cream truck was going FAST!
I hate it when my screen gets all GUI!
I hate it when that happens!!
I hate making predictions; especially about the future!
I hate taglines that get cut off before the end of a sent
I hate those meeses to pieces........
I Hate To Repeat Gossip, So I'll Only Say This Once.
I hated this tagline so I killed it.
I have 2 watchdogs.... Timex and Rolex.
I have 12,105 taglines. How many do you have?
I have a 9600bps modem and 1.5bps fingers.
I have a code in my node.
I have a collect call from Mars, do you accept?
I have a firm grip on reality. Now I can strangle it.
I have a great memory...it's just a little short.
I have a mind like a steel...thing...y'know... a doohicky
I have a mind like a steel...uh...thingamajig...
I have a new "User Surly" computer...
I have a PhD in D&B, and minored in BS.
I have a photographic memory -- I only remember pictures.
I have a photographic memory - it just never developed.
I have a pornographic memory
I have a really good memory, except it's short.
I have a reputation to defend, you see that, don't you?
I have a rock garden. Last week three of them died.
I have a speech impediment -- my foot.
I have a teflon brain - nothing sticks to it anymore...
I have a thousand glaciers ready to roll over Africa.
I have a very special service for rich people.
I have a vitally important role serving as a bad example.
I have an intense desire to return to the womb, anybody's
I have charts and graphs that prove I'm right.
I have detected disturbances in the wash.
I have had a day of extreme telephonic exhaustion.
I have had just about all I can take of myself.
I have lost my mind, but it must be backed-up somewhere.
I have no idea what I'm doing, but I'm doing it well.
I have no mouth and I must scream.
I have often regretted my speech, never my silence.
I have PMS and a Klingon Bird of Prey. Any questions?
I have seen the evidence. I want DIFFERENT evidence..
I have seen the future, it is just an extended present.
I have seen the truth and it is a lie.
I have seen the truth and it makes no sense.
I have something BETTER than chocolate. ■ Riker
I have the simplest of tastes. The best is satisfactory.
I Have To Stop Now, My Fingers Are Getting Hoarse!
I have to think twice before I give it a second thought.
I haven't got time for this.
I haven't lost my mind - it's backed up somewhere on tape
I haven't lost my mind. It must be backed up somewhere.
I haven't lost my mind. It's backed up on Tape somewhere
I haven't lost the weight, it's right here behind me.
I haven't seen a good new tagline in ages.
I heard Linda Blair a most shocking story!
I heard Margot Kidder director the other day.
I hit the CTRL key but I'm still not in control!
I hope I'm never out when my ship comes in.
I hope my kids don't read these messages!
I hope my wife doesn't read these messages!
I hope Thelma Ritter mom before she died.
I hope you're satisfied!
I hoping your as confusedly as I am about these things.
I improve on misquotation.
I insist on the importance of using committee structure.
I just bought a cured ham. Wonder what it had?
I Just can not resist a little fun along the way. :-)
I just escaped the twilight zone and fell into the Ozone.
I just found the last bug.
I just got my Telephone bill. Buy stock!
I just got stopped by the LAPD and boy am I beat.
I just injured a groin muscle....and it wasn't mine.
I just love the smell of Napalm in the morning!
I just play here.
I just read some light fiction: My income-tax return.
I just say these things; I have no idea what they MEAN
I just steal 'em, I don't explain 'em.
I just steal them, I don't write them.
I just tested out my pit bull. Ever heard a mime scream?
I just took an IQ test. The results were negative.
I just want to be a lover not a red eyed screaming ghoul.
I just want to be able to keep what I already have
I just work here.
I keep forgetting that rules are only for nice people
I keep forgetting which is AC and which is DC.....
I keep my .BAT files in C:\BELFRY.
I keep my BAT files in D:\BELFRY
I keep telling him there is only one g in crzjgrdwldiwdc.
I kinda like the feel of a couple extra feet in my bed.
I know a bank where the wild thyme blows...
I know a bigamist who got that way using "New Math".
I know a girl who gives BED & BREAKFAST a new meaning!
I know a good tag line when I steal one.
I know it all. I just can't remember it all.
I know it said press any key, but that one turned it off.
I know it's true... I saw it on TV!
I know nothing, I see nothing, I didn't wake up yet.
I know so little, but I know it fluently.
I know the answer, as long as you ask the right question.
I know this is the fish of the day--but what day?
I know why so many squirrels live in my family tree.
I know you are but what am I?
I left my in Rio. And my watch, my camera, my ring...
I Left My Leg in Jaglan Beta.
I left my tart in Aunt Fran's Crisco.
I let my mind wander once...it never came back.
I like Boolean logic. NOT!
I like children... if they're properly cooked.
I like my QWK OFFLINE reader!
I like my species the way it is.
I like the 486 tower. Does it come in red?
I like the head, interesting bone structure.
I like to leave messages *before* the beep.
I like to reminisce with people I don't know.
I like work. I can sit and look at it for hours.
I liked the comment about close and comfortable...
I live in a state of Virtual insanity...
I live one day at a time, but I'm one day behind
I looked up my family tree and found out I was the sap.
I lost a button hole today.
I LOVE call waiting. Really love call waitæ½├Σáφ[åë╖°
I love happy faces. Don't you?
I love humanity but hate people. Edna St. Vincent Millay
I love humanity... it's people I can't stand.
I love kids. Properly prepared they're delicious.
I love mankind... it's PEOPLE I can't stand!
I love standards, there are so many of them!
I love the stars too fondly to be fearful of the night.
i m nat n ilitrit prsun...
I made wine out of raisins; wouldn't wait for it to age.
I May Be Fat, But You're Ugly And I Can Diet
I may be old, but I'm not DEAD!
I may be slow, but I'm expensive.
I may be stupid, that still makes me smarter than you.
I may be wierd, but around here, no one will notice.
I may forgive -- but I never FORGET!
I may have my faults, but being wrong ain't one of them.
I may have settled in shipping.
I may not always be perfect, but I'm always me.
I may not be perfect, but I am all I got.
I may not be totally perfect, but some parts are OK.
I meant to do that!
I met a subliminal advertising exec but only for a second
I miss the dinosaurs.
I modem down, but dey grew back.
I multitask... I read in the bathroom.
I must have a mind like a steel sieve!
I must have slipped a disk - my pack hurts.
I mustanottagottalotta sleep last night.
I need a drink...where's the SPACE BAR?
I need someone bad ... are you really bad?
I never could get the hang of Thursdays.
I never knew lasers could be printed.
I never lie when I have sand in my boots!
I never loved another person the way I loved myself.
I never met a chocolate I didn't like.
I never met a temptation I didn't like...
I never nake misteakes.
I never read Taglines! Do you?
I never rise above the noise and confusion.
I object to sex on television. I keep falling off.
I often daydream about my inability to fantasize.
I only counted 100 dalmatians...!!!
I only drink 'til she's cute.
I only drink when I'm alone or with someone.
I Only Open My Mouth To Change My Feet
I only wrote the thing, I don't have to understand it.
I ought to copyright this tagline.
I owe, I owe, it's off to work I go!
I owe, I owe, so off to work I go.
I parked my harddisk - and got a ticket!
I passed my ethics course. I cheated, of course...
I plan to live forever... so far, so good.
I played poker w/ tarot cards-got a flush & 5 people died
I prefer my oysters fried. Then I know my oysters died.
I prefer the company of equals. - Riker
I prefer to call it the Prime Suggestion - Kirk
I prefer wicked over foolish. The wicked sometimes rest.
I program, therefore I am.
I promise not to let it happen again - until next time.
I puff out my chest and GROWL at reality!
I put spot remover on my dog....Spot's gone!
I quite drinking, smoking, and sex until I got bored.
I realized the world was mad and built an asylum for it.
I refuse a battle of wits with an unarmed person.
I remember the words. I just don't understand them.
I remember when Saturns were rockets, not cars.
I resemble that last remark....
I respect faith, but doubt is what gets you an education.
I said BetaZOID! Not Beta TESTER!! - Troi
I saved civilization. I knew it was something like that.
I saw a light at the end of the tunnel - it was a train.
I saw a subliminal advertising executive for a second.
I saw Elvis. He sat between me and Bigfoot on the UFO.
I saw Madeleine Stowe away three plates of spaghetti!
I saw that! And I'm telling your mother!
I saw the whole thing! What happened, anyway?!?
I seam to have inaddvertintly deleeted the spel cheker.
I see a red door & I want to paint it black.
I see no humor here, I can only laugh at the thought.
I see no HUMOR here.
I see you are performing up to your standards.
I see you did the minimum for the maximum.
I see you have the machine that goes «BING»...
I see.... and UNIX is an operating system, is it?
I seem to be having difficulty with my lifestyle.
I seem to be having problems with my lifestyle.
I seem to be hearing the sound of idle hands clapping.
I seem to have lost my carrier. Have you seen it?
I sense a deep dejectedness in your diodes.
I sense a power surge coming on.
I sense... *SLAP* Not while we're on the bridge, Will!
I sentence you to hang by the neck until you cheer up.
I shall taunt you a second time.
I shot an arrow into the air, and it got stuck.
I shot an arrow into the air....and it stuck.
I shouted "Olé!" every time one was gored...
I sighed as a lover, I obeyed as a child.
I slit my throat on the cutting edge of technology.
I smell a rat. Did you bake it or fry it?
I smell memory leakage. Someone here is dozing.
I speak of the computer that is to come after me.
I spent a month in Abilene one weekend.
I spent a month in Dallas one weekend
I spent a week in Philadelphia one night.
I spilled spot remover on my dog. He's gone now.
I spilled spot remover on my dog; now he's gone.
I started out with nothing & still have most of it left.
I still haven't found what I'm looking for.
I still miss my ex, but my aim's getting better.
I still miss my ex-wife - but my aim is improving.
I stole this tagline from someone else!
I stuck in Limbo with Nothing to do...
I succeed him; no one could replace him. - T. Jefferson.
I suppose there's no point in trying to bury it?
I sure wish I knew what I was doing.
I sure wish women would put the toilet seat back up!
I TAUGHT MY DUCK TO SAY ".QWK .QWK"
I teleported home one night with Ron and Sid and Meg.
I tell them there's no problems...Only Solutions...
I thank whatever gods may be for my unconquerable soul.
I think ... therefore I am obviously overqualified.
I think fish is nice, but then I think that rain is wet.
I think I got it made & they throw something else at me.
I think I preferred it when they were shooting."
I think I think, therefore I think I am. I think.
I think I'm diagonally parked in a parallel universe.
I think I'm gonna hurl...
I think I've got a headache, what do you think you have?
I think it needs more juice.
I think my learning curve has turned into a circle.
I think my learning curve is a circle.
I think my mouse is pregnant. . .
I think of politicians as a dog thinks of trees.
I think someone's Crayola box is a few colors short...
I think that I shall never see a printer save a tree.
I think that I'll stand up-wind, if you don't mind.
I think that I'm the friendliest guy in my zipcode.
I think the word you are looking for is AAAARRRRRGGGHH!
I think this is a tagline, isn't it?
I think this is getting needlessly messianic.
I think we can do better than this.
I think you ought to know I'm feeling very depressed.
I think you should buy me a drink before my train goes.
I think, therefore I am (or am I?).
I think, therefore I am overqualified.
I think, therefore I am, I think...
I think, therefore I thwim.
I think, therefore I'm overqualified !!!
I think, therefore, I am single.
I think, therefore I can't be a computer.
I think........therefore I am overqualified.
I thought about being Born Again, but my mother refused.
I thought Allyn Ann Mclerie were with the IRA.
I thought DEL *.* -really- deleted the files!
I thought I was a wit, and I was half right.
I thought I was mistaken but I was mistaken.
I thought I was wrong once, but I was mistaken.
I thought you were a wit... and I was half right.
I took up gardening as a hobby, but I only grew tired.
I tremble when I reflect that God is just.
I tried OS/2 once, but I didn't inhale.
I tried snorting coke...and almost DROWNED!
I tried switching to gum but couldn't keep it lit...
I tried the rest but bought the best!!!!
I tried to be sensible once. Wasted two minutes!
I tried to contain myself, but I escaped.
I tried to drown my problems but they can swim.
I tried to drown my problems, but found they can swim!
I try to impress someone and always end on the short end.
I typed Format COM1: and killed a telephone operator!
I tàld yo1%@"Neverªtouch ╙he flop°y disk s√rface!"
I understand the answers, but all the questions throw me.
I use coke. Cherry, preferably, but Classic will do.
I use windows...on my car, on my house, but not on my.
I used OUTLINE, but I didn't inhale.
I used to be an origin line until I got fired...
I used to be indecisive - Now I'm not so sure!
I used to be indecisive, but now I'm not so sure.
I used to be normal, then I got my computer...
I used to have a handle on life, and then it broke.
I used to have a handle on life, then DOS closed it...
I used to have a handle on life, then it broke.
I used to have a life, then I died.
I used to have a life, then I got an HAST!
I used to have a life, then I got married.
I used to have a tagline but it was stolen. :-(
I used to have an open mind but my brain kept falling out
I used to have money in the bank, now I call BBS'es.
I used to have that "Call Wasted" stuff.
I used to read books. Now I read .qwk files.
I used to be Snow White, but then I drifted. -Mae West
I used to watch TV, then I bought a modem.
I usually have peanut butter with my printer jams.
I vote for the evil of lessers....
I voted for the lesser of two weevils.
I vow to consider your idea fairly, before I reject it.
I wanna get STONED!
I want a warm bed and a kind word - and unlimited power.
I want everything; do you have it??
I want my MTV!
I want to be a procrastinator, but I kept putting it off.
I want to live with a synonym girl.
I want to tell you about Texas Radio & The Big Beat...
I want you to tell me I've been dreaming the last 5 years
I was a fool way before you were born.
I was asleep, did I miss anything?
I was born agnostic and I'll diagnostic.
I was changed into a tadpole. I knew about metamorphosis
I was cleaning my keyboard. It discharged by accident.
I was going to procrastinate, but I put it off.
I was here & you were gone, now you're here & I'm gone!
I was just getting used to yesterday when tomorrow came.
I was just stopped by the LAPD and boy, am I beat !
I was justified in using deadly farce.
I was married by a Judge...A jury might have let me off!!
I was on a roll, until I slipped on the butter.
I was once arrested for walking in someone else's sleep.
I was received very badly, for a variety of reasons.
I was sane once... I didn't like it.
I was somewhat of a celebrity at the time.
I was the kid next door's imaginary friend
I was trying to daydream, but my mind kept wandering.
I was up all night trying to round off infinity.
I wasn't born in Texas, but got here as fast as I could.
I wasn't kissing her, I was whispering in her mouth.
I watch TV because that's about all you can do with it.
I wear the pants in my family and my wife said so!!
I went mad for awhile, did me no end of good.
I will defend to the death your right to agree with me.
I will fight for your right to your wrong opinion.
I will leave that one alone.
I WILL procrastinate, if I can just get started!
I will rend thee in the gobberwarts, see if I don't."
I wish Adam had died with all his ribs in his body.
I wish I could come up with an original tagline.
I wish I didn't delete SLMR's taglines !
I wish I had a lower IQ so I could enjoy your company.
I wish I had a snappy Trek Tagline to put here...
I wish I was more like I think I am.
I wish life had a scroll-back buffer.
I wish life had scroll back - with cut and paste.
I wish Noah had swatted those two flies!
I wish programs would do what I think I tell 'em
I won't tell anyone if you won't.
I won't use Windows, I won't use Windows, I won't....
I would ask that you stop fiddling with my ears. ■ Data
I would have suffered a lot more if I'd been understood.
I would if I could but I can't so I won't.
I would like to know what you like. What turns you on?
I would like to start from scratch. Where is scratch?
I would strongly oppose apathy, if I cared.
I wouldn't touch the Metric System with a 3.048m pole!
I wouldn't trust him farther than I could spit a rat.
I wouldn't trust myself farther than I could spit a rat.
I wrote my own benchmark, my machine is now 500MHz
I yam Popeye of Borg. Prepares to be askimilgrated.
I [] My Dog. I [] My Cat. I [£] My Keyboard.
I! am! Kirk! of! Borg!: You! will! be! overacted!
I'd change the world if they gave me the source code.
I'd far rather be happy than right any day.
I'd give my right arm to be ambidextrous
I'd give you a piece of my mind, but I can't spare any.
I'd have written sooner but I thought I owed you money.
I'd Kill Flipper for a Tuna Sandwich.
I'd like a brain on drugs with a side order of bacon
I'd like to live like a poor person with lots of money.
I'd notice the difference.
I'd rather be young and stupid if I had the choice.
I'd rather push a Chevy than drive a Ford!
I'd really like to lay one across your teeth. ■ Beverly
I'd shake your hand,but there's no telling where it's been
I'd think twice about using this tagline.
I'll admit it. I'm a tagline junkie.
I'll be Bach. - Johann Sebastian Schwarzenegger
I'll Be Back!
I'll byte your bits if you'll nybble my words
I'll get a round Tuit one of these days.
I'll get my thinking cap on for this one!
I'll gladly pay you Friday for a hamburger today...
I'll have 2 brains on drugs with a side of bacon and juice
I'll have some Vegan Rhino's cutlet.
I'll have the Turtle Soup, and make it snappy.
I'll have twelve pieces of pie, and a diet Pepsi.
I'll have what the gentleman on the floor is having.
I'll let you see the prizes in a minute.
I'll need plenty of ale, and fresh horses for my men!
I'll pay you Wednesday for a burger on Tuesday.
I'll play fair if I get to make the rules.
I'LL SHOUT IF I WANT!
I'll show you my tagline if you'll show me yours.
I'll take "Things Only I Know" for $200.
I'll take my tabby rare, please.
I'll tell you what's the matter! This parrot is dead!
I'll worry about it tomorrow.
I'm a 5¼" drive, she has a 3½" drive, it'd never work
I'm a consultant -- would I lie to you?
I'm a doctor, Jim, not your love slave.
I'm a fragment of your imagination....
I'm a hero with coward's legs.
I'm a Lumberjack and I'm OK!
I'm a modem addict and it's all your fault!
I'm a natural blonde, please speak slowly.
I'm a non-conformist like everyone else.
I'm a person of letters... unread collection notices.
I'm a personality prototype, you can tell, can't you?
I'm a pilot. I pick it up here and pile it there.
I'm a programmer, I don't do COBOL.
I'm a sex object. I mention sex, she Objects!
I'm a tagline. When I grow up I wanna be a novel.
I'm a thinker, I think, but I may be wrong.
I'm absolutely, positively, most certainly, almost sure!
I'm afraid I've been stuck with write only memory
I'm afraid this is going to be a little unnerving.
I'm all ears, which makes it hard to buy pants.
I'm all spare parts.
I'm always good... but not TOO good...
I'm always in trouble, but it's sooooooo much fun!
I'm always late. My ancestors arrived on the Juneflower.
I'm always willing to share my ignorance...
I'm an absolute, off-the-wall fanatical moderate.
I'm an amateur crastinator. Some day I'll turn pro.
I'm an antisolipsist: Everybody exists except me
I'm an incorrigible punster--so don't incorrige me!
I'm an influential person - gravitationally speaking.
I'm an OS/2 developer...I don't NEED a life!
I'm as happy as a pig in mud!
I'm as innocent as a new-laid egg.
I'm as pure as the driven slush.
I'm at the corner of WALK and DON'T WALK.
I'm awake- I'm dressed-what MORE do you want from me?
I'm bad to the bone.....
I'm basically honest - I don't lie until I have to.
I'm bloody sick of standing here every day. ■ O'Brien
I'm Broad-Minded. I hardly think of anything else.
I'm broke. Send me money.
I'm building a de-caffinated coffee table
I'm busier than a one-eyed cat watching two mouseholes.
I'm busy now. Do you mind if I ignore you later?
I'm buying some Brillo & knitting myself a new car.
I'm dangerous when I know what I'm doing.
I'm doing this for your own good.
I'm driving down the right lane in a left offramp world.
I'm easy to please as long as I get my way.
I'm easy, but I ain't cheap.
I'm efficient. I finished my 2-week diet in three days.
I'm enjoying an out-of-clothes experience.
I'm fascinated by the way memory diffuses fact.
I'm fat. You're ugly. I can diet.
I'm feeling argumentative. Please contradict me.
I'm feeling better since my theftostomy for taglinitis.
I'm flexible..just don't change anything.
I'm FLYING! I'm FLYING! >>THUD<<
I'm from TEXAS. What Country are you from?
I'm from the government. I'm here to help you.
I'm full of BBS!
I'm getting tired. Please press ESC.
I'm giving you an opportunity because the prizes are nice
I'm happiest when someone else is doing the cooking.
I'm happy to be here. I'm happy to be anywhere at my age.
I'm Having A Ball Doing Nothing At All
I'm having an out of money experience.
I'm heavily armed, easily irritated, and off my medication!
I'm human: nothing human smells strange to me.
I'm immortal...so far.
I'm in a phone booth at the corner of Walk and Don't Walk
I'm in great shape, for the shape I'm in...
I'm in shape ... round's a shape isn't it?
I'm in shape ... spinning's a shape, isn't it?
I'm in the computer business, I make Out-Of-Order signs.
I'm incredibly jealous, but still glad for you.
I'm just another blankity-blank BLANK.
I'm just confused....I USED to be amazed!
I'm just doodlin' my life away...
I'm just here for moral support. Ignore the gun.
I'm just looking at her name tag, Honest.
I'm just needling you about the thread.
I'm just trying out this tagline. It's not registered yet
I'm leaving my body to science fiction.
I'm like a bad TSR; I keep popping up!
I'm looking for clues at the scene of the crime.
I'm looking for the house on Della Street.
I'm looking for Zmodem, dear!
I'm losin' it! - Geordi
I'm lost somewhere in the ozone again.
I'm making this up as I go along.
I'm married to a Computer Widow!
I'm miserable without you, it's like having you here.
I'm modem him and modem her. I'm the best!
I'm mooning you now...you just can't see me.
I'm more humble than you are!
I'm no stranger, just a friend you haven't met...
I'm not a complete idiot──several parts are missing.
I'm not a computer nerd; merely a Computer Jock.
I'm not a D.J., but I play one on the radio.
I'm not a lawyer, I'm an honest man....
I'm not an expert in personal relationships.
I'm not arrogant, I'm RIGHT!
I'm not arrogant... I'm just BETTER than you!
I'm not asz think asz you drunk I am, Ossifer!
I'm not bald -- just folically challenged.
I'm not breaking the rules, just testing the elasticity.
I'm not broke -- just financially challenged.
I'm not confused, I'm just well-mixed.
I'm not crazy, I just don't give a &*$#.
I'm not dead -- just biologically challenged.
I'm not dead. I'm electroencephelographically challenged.
I'm not dead; I'm "metabolically challenged."
I'm not dozing, I'm just waiting for system boot...
I'm not driving fast, I'm flying low.
I'm not easy!! But hey!! I'll negotiate...
I'm not easy, nor cheap..but I CAN be bought!
I'm not everything I want to be, but at least I'm not you
I'm not fat -- I'm just fluffy!
I'm not fat! - just gravitationally challenged.
I'm not just one of your snuggle-girls, Will. ■ Troi
I'm not lost . . . I'm "Locationally Challenged"!
I'm not messy, I just ran out of STACK space.
I'm not nearly as think as you confused I am.
I'm not nearly as think as you drunk I am.
I'm not nearly as think as you dumb I am!
I'm not OK, you're not OK, and that's OK.
I'm not old... just "chronologically challenged".
I'm not opinionated. I'm just always right.
I'm not paranoid! Which of my enemies told you this?
I'm not rude, I'm "attitudinally challenged".
I'm not schizophrenic, I'm multi-faceted.
I'm not schizophrenic. It's this guy beside me!
I'm not Shareware... I'm Married.
I'm not short--just vertically challenged
I'm not sloppy, I'm organizationally challenged.
I'm not super man. But I am very dense.
I'm not tense, just terribly A*L*E*R*T.
I'm not young enough to know everything!!
I'm not..no I am..no, I'm NOT indecisive. Am I?
I'm ok, it's the world that's screwed up.
I'm on a seafood diet. I see food and I eat it.
I'm on the Brute Squad. No, you ARE the Brute Squad.
I'm on the trailing edge of technology.
I'm only happy when I worry about stuff.
I'm part of the 57% that did not vote for Clinton!!
I'm perfect by necessity, it isn't honest to be modest.
I'm pink; therefore I'm spam.
I'm Proud To Be An Expert Tagline Thief!!!
I'm right 90% of the time--why quibble over the other 3%?
I'm running out of snappy comments.
I'm saving my money for when they get Phaser Printers!
I'm saying nothing and I'm saying it -- John Cage
I'm setting my phaser on 'tickle'.
I'm so BAD! I even steal my own TagLines!!
I'm so bored, I'm starting to miss my husband.
I'm so horny even the crack of Dawn isn't safe!
I'm so unlucky - even M&M's melt in my hands!
I'm solidly behind whichever side eventually wins.
I'm soooo confused!
I'm sorry my Karma just stepped on your dogma.
I'm sorry, I'm not allowed to argue unless you've paid.
I'm sorry, this tagline is not an apology!
I'm sorry, this tagline is not in service. Please delete.
I'm sorry..All taglines are busy now..Please hold.....
I'm spending a year dead, for tax purposes.
I'm still an atheist, thank God -- Luis Buñuel
I'm strong to the finish 'cause I eats me spinach!
I'm stuck somewhere between lost and found.
I'm suffering from post self-realization depression.
I'm sure it's clearly explained in the MANUAL.
I'm sure it's clearly explained in the Zmodem DOC's.
I'm sure we can talk things out like uncivilized people.
I'm terribly sorry, but I'm afraid you're just a mirage.
I'm the most normal person I know.
I'm the NRA, and if I can't vote twice, I'll shoot you.
I'm the only one who knows what he's talking about!
I'm too old to run wild. Now I just walk wild.
I'm too skeptical to deny the possibility of anything...
I'm too stupid to know what I'm involved in.
I'm totally unprepared for everyday life.
I'm trying to find myself. Anyone seen me lately?
I'm trying to find myself. Has anyone seen me lately?
I'm trying to teach the cavemen to play scrabble.
I'm trying to think but nothing happens.
I'm user friendly, I don't byte -- I snap.
I'm very very happy to be home. Or somewhere like it.
I'm wearing boxer shorts & I know how to use them.
I'm weird, but around here its barely noticeable.
I'm with you all the way, at least until the cops arrive.
I'm working on it......
I'm working on my 2nd $million... Gave up on the 1st.
I'm working on my 4th million - the first three failed!
I'm writing a book. I've got the page numbers done.
I'm writing an unauthorized autobiography.
I've already told you more than I know.
I've always regarded nature as the clothing of God.
I've been a little ANSI all day.
I've been lurking for months and nobody has moderated me!
I've been out pursuing a path of alternate reality...
I've been run over by my own train of thought.
I've been tied to the whipping post.
I've crashed, and I can't boot up!!!!
I've done you before, haven't I?
I've escaped from the mad house of reality....
I've fallen...but I'll be back...Arnold Schwarzeneger
I've finally got this ficts, fics, fixd ...
I've given up reading books. It takes my mind off myself.
I've go to go.... it's beer:30!
I've got 20/20 hindsight.
I've got 256K of RAM, so why can't I run Windows?
I've got a BEER attitude.
I've got a mind like a... a... what's that thing called?
I've got a terrible pain in the diodes down my left side.
I've got too many hands on my time.
I've got wet socks in my weather bureau.
I've had BETA days ... and nights.
I've join the great unwashed masses- the water is OFF!
I've just been created. I'm new to the universe
I've never been drunk in my life, that I can remember.
I've never liked morticians, all they want is my body.
I've seen better conversations in alphabet soup.
I've seen the future, and it's a re-run...
I've told you a million times, don't exaggerate.
I've upped MY standards. Now, up YOURS!
I've used Basic so long, my brain has gonesub permanently
I/O I/O IT'S WRITE TO DISK I GO I/O I/O.
IBM at times means (I)ncredibly (B)otched (M)achines.
IBM glassware: crystal Blue persuasion.
IBM Marketing, well, it's IBM Marketing!
IBM stands for "Inferior But Marketable"
IBM: When you care enough to spend the very most.
IBM: Immensely Big Manufacturer.
IBM: International Buck Makers.
IBM? Incredibly Boring Manuals!
Ice cream cones weren't sex symbols until Madonna.
Ice not found, pour straight to continue.
Ice-Cream Vendor: We Scoop to Conquer
Ideals kill politicians, and politicians kill ideals.
Ideas are like children, your own are wonderful
Ideas may be whole- left- right- or no-brained.
Identify chromosomes: Take down their genes and look.
Idiot (id-ee-it) n.-> One who disagrees with me.
Idiotocracy -- form of government used in the US
Idiots are harmless; idiots in power aren't.
Idling is most joyful when there is plenty of work to do.
If "R" is Reverse, how come "D" is FORWARD?
if (dog_age >) num_tricks = MAXTRICKS;
if (program == crippleware) bit-bucket(program).
IF (quackslike(X)==DUCK) return DUCK;
if (stone != rolling) moss++;
If 4 bits = a nibble; 8 = a byte, doesn't 16 = a mouthful
If A = B and B = C, then A = C, except where void.
If a chicken coop had four doors it'd be a sedan.
If a city doesn't meet EPA standards, shut it down!
If a computer cable has one end, then it has another.
If a Duck eats, then swims, Does it get cramps?
If a gay man wrote this, would it be a FAGLINE?
If a Genie grants me 3 wishes, I'll wish for more wishes.
If a man understands 1 woman he should let it go at that.
If a picture is worth a thousand words, get SVGA.
If a problem has a single neck, it is a simple solution.
If a program is useful, it will have to be changed.
If a program is useless, it will have to be documented.
If a program works, quit while you're ahead.
If a string has one end, then it has another end.
If a stud cat gets fixed, its broken...
If all else fails, lower your standards.
If all else fails, read the directions.
If all else fails, you're off the hook.
If all papers were smart enough, they would be currency.
If an experiment works, something has gone wrong.
If anything can go worng, it will.
If anyone approaches with intent of doing you good, run.
If anything *CAN'T* go wrong, it will...
If anything can go wrong, it will.
If at 1st you don't succeed, call it Ver. 1
If at first you DO succeed, try not to look astonished.
If at first you don't exceed, try, try again.
If At First You Don't Succeed Ignore The Docs...
If at first you don't succeed, call it Ver. 1.0
If at first you don't succeed, change the rules.
If at first you don't succeed, destroy all evidence.
If at first you don't succeed, don't be foolish, give up.
If at first you don't succeed, fall back and punt.
If at first you don't succeed, forget skydiving.
If at first you don't succeed, Format C:
If at first you don't succeed, get a bigger hammer.
If at first you don't succeed, give up.
If at first you don't succeed, go home.
If at first you don't succeed, join the club.
If at first you don't succeed, put out another version.
If at first you don't succeed, re-format.
If at first you don't succeed, redefine success.
If at first you don't succeed, skydiving is not for you.
If at first you don't succeed, switch to shortstop
If at first you don't succeed, that means you're average.
If at First you don't succeed, try Second National...
If at first you don't succeed, try skydiving ...
If at first you don't succeed, try something else.
If at first you don't succeed, try the reset button.
If at first you don't succeed, welcome to the club.
If at first you don't succeed, you can always emulate me.
If at first you don't succeed, you're doing about average
If at first you don't succeed; Blame everyone else.
If at first you doubt, doubt again.
If at first you never succeed, never try Russian roulette
If cats have kittens, do bats have bittens?
If Chekov owned a computer, would it be a Wax?
If cigarettes are outlawed, only outlaws will cough.
If Clinton allow gays in Military, Generals get new AIDS.
If Corn Oil is made from corn, what's Baby Oil made from?
If crash occurs when using this program, discontinue use.
IF dazzle<>'brilliance' THEN;SET V baffle='bullshit';END
If Derek had a trunk like an elephant, how would he smell
If dolphins are so smart, why did Flipper work for TV?
If DOS was an airline, would you purchase a ticket?
If entropy is increasing, where is it all coming from?
If everybody knows such-and-such, then it just ain't so.
If everyone is thinking alike,then someone isn't thinking
If everyone thinks alike then somebody isn't thinking.
If evolution is outlawed, only outlaws will evolve.
If excess is injurious, how come I want more?
IF EXIST \FRONTDOOR\SALES.MAN GOTO :GET_PISTOL
If F1 doesn't work, try ATDT911 for more help.
If facts do not conform to the theory, dispose of them.
If flies couldn't fly, would they be called walks?
If flossing is a pain in the rear, you're doing it wrong.
If gals are sugar & spice, how come they smell like that?
If God had meant for us to be naked, we would be so born.
If God is all knowing, can He understand DSZ docs?
If God is Love, and Love is Blind, is Ray Charles God?
If God is perfect, why do discontinuous functions exist?
If God lived on earth, people would break his windows.
If God wanted us to vote, he'd have given us candidates.
If golf, the proof is in the putting.
If guns were outlawed, how would Liberals collect taxes?
If he had another brain, it would be lonely.
If he were at the Last Supper, he'd worry about calories.
If Hugh Downs a quart of vodka will he be standing later?
If humans don't exercise the lips, the mouths freeze up.
If humans have orgasms, do the Borg have Borgasms?
If I annoyed you, please format my hard disk.
If I annoyed you...Good!
If I asked where we were, would I regret it?
If I backup my hard drive, will I hear secret messages?
If I can't take it with me, I ain't goin'.
If I can't win with blind luck, then I can't win.
If I can't win your heart, may I download your files?
If I could be respected and not have to be respectable.
If I could light this thing I'd send up smoke signals.
If I could, I would, but I can't, so I won't...
If I didn't know any better, I'd be happy right now.
If I die, I forgive you, if I recover, we shall see.
If I don't enforce it, who will know good from evil?
If I feel like exercise, I lie down until it passes.
If I find out who made the 640K "barrier" I'll RAM him!
If I got the wrong number, why did you answer the phone?
If I had a hammer...
If I had another personality, would I be using this one?
IF I had to do it over again, it would be without TV.
If I had two dead mousies, I'd give you one.
If I have no mouth but I must scream what should I do?
If I invested in GM, it would be busted to Corporal.
If I look confused, it's because I'm thinking.
If I promise to miss you, will you go away?
If I save the whales, where will I keep them?
If I save time, when do I get it back ?
If I think I am right, I am right until proven wrong..
If I throw a cat out of a car window, is it kitty litter?
If I want your opinion I'll beat it from you
If I wanted your opinion I would give it to you.
If I wanted your opinion I'd ask your computer.
If I was trying to get THERE, I wouldn't start from here!
If I was two faced, would I be wearing this one?
If I were here more often, I wouldn't be gone so much.
If I were really two-faced, would I be wearing this one?
If I were you, who'd be me?
If I'd miss you when you're gone - would you leave now?
If I'm in trouble at school, I'm in more trouble at home.
If I'm right 90% of the time, ignore the other 3%!
If IBMs have bugs, do Apples have worms?
If idiots could fly, this would be an airport.
If ignorance is bliss, why aren't more people happy?
If ignorance isn't bliss, I don't know what is!
If ignorance was a survival skill, I'd live forever
If is is is not & is not is is is is not is?
If it ain't broke, always try to fix it anyway.
If it ain't broke, don't fix it
If it ain't broke, give ME a shot at it!
If it ain't broke, try installing something else.
If it ain't broken, don't fix it.
If it ain't cooked, don't serve it.
If it appeals to everyone, evangelists will target it.
If it breaks make it bigger, if it sticks out chrome it.
If it breaks, it needed replacing anyway.
If it doesn't work, blame someone else.
If it doesn't work, change the documentation.
If it doesn't work, it's physics.
If it feels good, do it -- to excess.
If it feels right, you're doing it wrong.
If it has TITS or TIRES, you'll have trouble with it.
If it hasn't happened by lunchtime, make it happen.
If it is not there, it does not exist.
If it is not there, it must be here, or it doesn't exist.
If it isn't broken, don't fix it.
If it isn't true, at least it is a happy invention.
If it isn't worth finishing, why start at all?
If it jams -- force it.
If it looks right, it probably isn't. - Murphy
If it moves so SLOW, why is it called Rush Hour?
If it quacks like a duck....
If it screams, it's best not to eat it.
If it screams, it's not food.
If it stinks, it's chemistry.
If it was a coincidence, then my name is not Agrajag!
If it was bad, it will be back.
If it was easy, they'd send someone else.
If it wasn't for bad luck, I'd have no luck at all.
If it wasn't for our lungs there wouldn't room for smog.
If it wasn't for the last minute, nothing would get done.
If it weren't for flashbacks I'd have no memory at all.
If it works perfectly, there's something wrong.
If it works the first time, quit testing it.
If it works, Don't fix it: Unless you are a consultant.
If it works, it must be obsolete.
If it works, rip it apart and find out why!
If it's bug free then it's time to make some changes..
If it's good, it goes away, if it's bad, it happens.
If it's green or it wiggles, it's biology
If it's more than you need, it's greed.
If it's not on fire, it's a software problem.
If it's not true, it's quite easily found.
If it's not worth doing, it's not worth doing well.
If it's really tourist season, why can't we shoot them?
If it's so damned simple, why can't we figure it out?
If it's stupid and works, then it ain't stupid!
If it's tourist season, where do I get a license?
If it's Tourist Season, why can't we shoot 'em ???
If Jesus was Jewish, why did he have a Mexican name?
If law school is so hard, why so many lawyers?
If laws are outlawed, only outlaws will have laws.
If life is a highway... What's the Queensway?
If life is just a bowl of cherries, throwing pits is OK.
If life only had a scroll-back buffer with cut & paste.
If life's a stage, I want better lighting!
If love is blind, lingerie makes great braille.
If love is blind, why is lingerie so popular?
If marriage is outlawed, only outlaws will have in-laws.
If men could get pregnant, abortion would be a sacrament!
If money is the root of all evil, I want to be vile!
If money is the root of all evil, I've been uprooted.
If money talks, Being a SysOp is pretty quiet!
If money talks, I must be a mute.
If Mother Nature were smart she'd have leaves fall up.
If my car was running OS/2 I'd be there already...
If my disk crashes do I require autoexec insurance?
If NASA is so smart, why do they count backwards?
If no one sees you eat chocolate, it has no calories.
If nobody measures up, it's time to check your yardstick.
If nobody uses it, there's a reason.
If not %1="sense", goto "non-sense."
If not cruel or unusual, it's not much of a punishment.
If not the problem, are you part of the solution?
If Old MacDonald had a computer, it uses EIE I/O.
If one is a greyhound, why try to look like a pekingese?
If only AT&T knew what I was do=2+OX:+4+b+o NO CARRIER
If only Einstein had a 486DX-33...
If only women came with pulldown menus and online help!
If opportunity doesn't knock, build a door.
If our behavior is strict, we do not need fun!
IF outgo > income THEN upkeep = downfall
If pants still on by 2nd scene, wrong script. Mel Gibson
If people listened to themselves, they would shut up.
If Picard ever proposed to a lass he'd say..."Engage!"
If picketing didn't exist some kids would never exercise.
If Piggy and Kermit had kids... Pigpoles or froglets?
If plugging it in doesn't help, turn it on.
If Q was female, would he be called O?
If Q were castrated, would he become O?
If rabbits feet are so lucky, what happened to the rabbit
If reading this on a BBS, press ALT-H for an IQ test ...
If reality wants to reach me, it knows where I am.
If screw ups were dollars, I'd be a millionaire!
If sex were fast food, you'd have an arch over your head.
If she won't live forever, why give her a diamond?
If sh** rolls down hill then I got hit by a boulder!
If speed scares you, try Micro$oft Windows.
If speed scares you, use MickeySoft Windows!
If speed scares you, use Windows.
IF stone(rotation) > 1 THEN moss(propagation) = 0
If stupidity had survival value, he would live forever.
If super glue is so great why doesn't it have any taste?
If the Alamo had a back door, there wouldn't be a Texas!
If the answer is Clinton, the question had to be stupid.
If the cops throw a net over me, am I legally in seine?
If the door is Baroque, jiggle the Handel!
If the family skeleton must remain, make it dance.
If the future is uncertain, do something about it.
If the GOOD die young, I wonder why I am still here.
If the majority rules, Americans must all be lawyers.
If the people lead, the leaders will follow.
If the price is a dream then support is a nightmare.
If the shoe fits, it's not government issue.
If the shoe fits, put it in your mouth.
If the truth is hard to swallow, take smaller bites.
If the world is a ß test, we must be the bugs.
If the world wanted me enough it would call back. It did.
If the world were logical, Men would ride side-saddle.
If the world's a stage and we're actors, who's my agent?
If there is an obvious solution it is always obvious.
If there is no God, who pops up the next Kleenex?
If there was a nuclear bombing, would I be alive to care?
If there was an ugly museum, you'd be the prize exhibit.
If there were no golf balls, how would we measure hail?
If there's one thing I can't stand, it's intolerance.
If they didn't vote, the wrong lizard might get in.
If thine enemy offend thee, giveth his kid a drum.
If things get better with age, I'm nearing magnificence.
If things improve with age, I'm nearly magnificent.
If things were left to chance, they'd be better.
If this is a battle, then you have already lost.
If this is a survey, please ignore all the above answers
If this is timesharing, give me my share right now.
If this were a real tagline, it would be funny. It isn't.
If this were a tagline, it would be stolen already.
If this were an actual life, there would be manuals.
If this were an actual tag line it would be funny.
If thou is a artist, how does one grasp your art?
If three people say you are an ass, put on a bridle.
If two wrongs don't make a right, try three.
If U look close enough, the truth is hidden in the words.
If vegetarians eat vegetables, what do humanitarians eat?
If voting could change things, it would be illegal.
If we can't fix it - its broken!
If we don't succeed, we run the risk of failure.
If we have our own "why of life, we can bear any "how".
If we learn from losing, we become winners in the end.
If we left the bones out it wouldn't be crunchy.
If we weren't all crazy we would go insane.
If winning isn't important then why keep score?
If wishes were horses, horses would ride.
If wishes were money, beggars would be choosers.
If worst comes to worst, you *CAN* turn most things off.
If you always postpone pleasure you will never have it.
If you are afraid of being lonely, don't try to be right.
If you aren't part of a solution, you are a precipitate.
If you believe in free speech, can I use your phone?
If you believe THAT, I have a BRIDGE for sale...
If you believe this message you will believe anything.
If you believe your own demagoguery, you have a problem.
If you bow at all, bow low.
If you break your leg, don't come running to me!
If you can read this then you are too CLOSE!
If you can read this, you're irrelevant. -Borg
If you can remember the 60's, you weren't there.
If you can touch it and you can see it, it's real.
IF YOU CAN'T BE GOOD, BE GOOD AT IT!
If you can't beat 'em, get the hell out of there!
If you can't beat em', mod em'.
If you can't bite, don't try to show your teeth.
If you can't convince them, confuse them.
If you can't dazzle with dexterity, feed them a crock.
If you can't enjoy yourself, enjoy someone else...
If you can't fix it, sell it as a feature.
If you can't laugh at yourself, make fun of other people.
If you can't laugh at yourself, try laughing at others.
If you can't learn to do it well, enjoy doing it badly.
If you can't make it good, make it big.
If you can't make it work, make a statistic of it.
If you can't say something nice, don't say anything.
If you can't say something nice, sit by me!
If you can't speak softly, just use the stick.
If you can't stand the heat, stay out of the kitchen.
If you can't stay healthy, find a sickness you like.
If you can't win fair, win foul.
If you cannot catch a bird of paradise, grab a wet hen.
If you cheat, you'll eventually punish yourself.
If you continually give you will continually have.
If you did it and lived, you probably did it right.
If you do drink and drive you might as well smoke too.
If you do nothing, how do you know when you're finished?
If you don't bet, you can't win.
If you don't care where you are, then you ain't lost.
If you don't care where you are, then you can't get lost.
If you don't eat garlic, they'll never smell it on you.
If you don't fall down, you're not trying.
If you don't like yourself, you can't like other people.
If you don't pay the exorcist are you REPOSSESSED?
If you don't think women are explosive, drop one!!!
If you don't try, you cannot fail.
If you drink and drive, you might as well smoke also.
If you drink, don't drive. Don't even putt.
If you ever have an idea, go with it.
If you expect nothing, you won't be disappointed.
If you explain so that nobody misunderstands, some will.
If you fatten everyone around you, you look thinner.
If you find it, it is always in the last place you look.
If you go after Moby Dick, take along the tartar sauce.
If you got half your wishes, you'd double your troubles.
If you got it flaunt it! If you haven't, rent it!
If you have any idea why I do this, keep it to yourself.
If you have ignorance and confidence then success follows
If You Have Nothing To Do, Don't Do It Here
If you have to take me apart, then I, for one, won't go.
If you have yard statues, it tells people you're a jerk.
If you hear an ONION RING, answer it!
If you kiss and make up, fight with the opposite sex.
If you knew what Mona Lisa knew, you'd smile too.
If you knew what you're talking about, you'd be dangerous
If you know the spelling of a word, you will err anyway.
If you learn from mistakes, you will learn a lot today.
If you lie to the computer, it will get you in the end.
If you like this one, wait until you hear my next story.
If you listen to fools, the mob rules.
If you make a mistake, fix it to the best of your ability
If you mess with a thing long enough, it'll break.
if you mess with it long enough, you will break it!
If you need a calculator, its too complex.
If you need n items of product you will have n-1 in stock
If you NEED to count your money, you're not really rich.
If you Pascal on the road, go C him and his dog Spot.
If you play with anything long enough it will break.
If you pull the wings off a fly, does it become a walk?
If you push something hard enough, it will fall over.
If you really need an officer in a hurry, take a nap.
If you remember the 60s, you didn't do drugs.
If you risk nothing, then you risk everything.
If you rush, you'll pass more than you catch up with.
If you saw a heat wave, would you wave back?
If you search for the unknown, expect to be surprised.
If you shoot a mime, should you use a silencer?
If you smoke after sex, then you're doing it too fast.
If you steala this tagline I breaka your keyboard!
If you stomp gripes, do you get whine?
If you suspect a man, don't employ him.
If you take away the fuel, in time the flames will die.
If you talk in your sleep, don't mention my name.
If you think education is expensive, try ignorance.
If you think it's going to rain, it will.
If you think nobody cares, miss a couple of payments.
If you throw mud, you will have dirty hands.
If you try to be too sharp, you will cut yourself.
If you try to please everybody, nobody will like it.
IF you wait long enough it will go away, and come back.
If you wait, it will go away.
If you want her to show emotion, cut up her credit cards.
If you want my advice, pay me.
If you want someone to keep a secret, keep it yourself.
If you want the last word with a woman, apologize.
If you want to dance, don't be afraid of toe stepping.
If you want to hide your face, walk naked.
If you wish to succeed, consult three old people.
If you would keep a secret from an enemy, tell nobody.
If you'll leave a message at the boop...
If you'll regret it in the morning, sleep late...
If you're 1 in 1 million, there's 2500 of you.
If you're a hacker, quit smoking.
If you're against abortion, don't have one
If you're feeling good, don't worry. You'll get over it.
If you're gonna kill me... please use kindness.
If you're looking for me, I just left.
If you're looking to steal a tagline, go somewhere else.
If you're not confused, you're not thinking clearly.
If you're not vulnerable, you can't be intimate.
If you're reading this, your computer got a virus!
If you're really a police dog, where's your badge?
If you're so smart, why aren't you rich?
If you're strong enough, there *are* no precedents.
If you're too old to learn, you were born so.
If your attack is going well, then it's an ambush..
If your duck goes "Qwk Qwk Qwk...", it's mail.
If your feet smell and your nose runs, you're upside down
If your mind goes blank, remember to turn down the sound.
If your sergeant can see you, so can the enemy.
If your ship doesn't come in, swim out to it!
If your tagline does not fit in a single line, simply typ
If your work speaks for itself, don't interrupt.
If youth only had a chance or old age any brains.
if(crash) grab_ankles();kiss_xxx_goodbye()
if(ThisDay()!=MyDay)DosSleep(ulTillNextDay);
IfABearFartsInTheWoods&NoOneHearsDoesItMakeASound?
Iffen it ain't broke, don't fix it.
Iffen it ain't cooked, don't serve it.
Ifyoucanreadthis,youspendtoomuchtimefiguringouttaglines.
Ignorance and dogmatism are lovers growing hand-in-hand.
Ignorance is temporary; stupid is forever.
Ignorance is the mother of superstition.
Ignorance or Apathy? I don't know, and I don't care!
Ignore previous fortune cookie.
Ignore previous Tagline.
Ignore your health and it will go away.
ILink, where we redefine 'normal' to suit us !
Illegal aliens are an American problem. Ask any Indian.
Illiterate? Write for free brochure...
Illustrate your sermons! Wear Far Side ties.
Imagination is more important than knowledge.
Imagination is the highest kite on can fly.
Imagination is the one weapon in the war against reality.
Imagination without learning is having wings but no feet.
Imagine an incredibly clever tagline in this space.....
Imagine I have a Kill-O-Zap blaster pistol in my hand.
Imagine the silence if everyone said only what they know.
Imagine you have this bath, it's ebony, it's conical.
Imelda Marcos: "If the shoe fits, buy it."
Imitation is the sincerest form of plagiarism.
Immanual doesn't pun -- he Kant.
Immanuel Kant ..... but Kubla Khan
Immature artists imitate. Mature artists steal.
Immorality will continue until beatings improve.
Impeach Clinton! and her husband too!
Impiety....Your irreverence toward my deity.
Important messages develop errors in the mail.
Impossible to foolproof--fools are so ingenious
Imprisoned in .QWK file! Send the ZIP army!
Improve mail delivery... mail the mailmen their pay!
In a family argument, if you are right apologize at once.
In a fight between you and the world, back the world.
In a nuclear war, all men will be cremated equal.
In America sex is obsession, everywhere else it is fact.
In an nuclear war, all men will be cremated equal
In Canada, even the female impersonators are women.
In case it crossed your mind, I am completely sane.
In case of atomic attack, prayer in schools will be OK.
In case of doubt, make it sound convincing
In Case of Explosion, Log off Promptly.
In case of fire, yell "FIRE!"
In Chicago it is important to vote early and often.
In data, the figure most obviously correct, is an error.
In DOS we trust.
In economics, the majority is almost always wrong.
In England there are 60 religions and 1 sauce.
In fact, I DON'T put my pants on one leg at a time
In fashion be a reed in the wind.
In gambling and life if you don't play, you never win.
In God we trust, all others we monitor.
In God we trust, you pay in gold.
In God we trust: All others we voice verify.
In God we trust; all others pay CASH!
In heaven all the interesting people are missing.
In human history, most leaders prove to be good bleeders.
In it's former life, my computer was a Cray...
In Leningrad freezing point is called melting point.
In life, as in football...hit the line hard. -T.Roosevelt
In major discrepancies, it is reality that is wrong.
In making decisions, recall that the trend is a friend.
In principle I am against principles -- Tristan Tzara
In principles be a rock in the stream.
In San Francisco, everyone seems a space traveler.
In space travel, you see, the numbers are awful.
In space, lemmings have to shoot themselves.
In space, no one can hear you rip a stinky...
In spite of the cost of living, it's still popular.
In Texas we have an response for grievances -- Colt .45
In the backwaters of the galaxy lies a small yellow sun.
In the country of the blind, the one-eyed man is king.
In the demolition derby of life, I'm in a Pinto.
In the end gravity always wins. - Dolly Parton.
In the fight between you and the world, back the world.
In The Great Snowstorm Of Life, I End Up With The Slush.
In the long run, we're all dead.
In the name of King Arthur, open the door!
In this world a man must either be anvil or hammer.
In time you will be able to tell what a diskette is...
In war and life, either fight to win or don't fight.
In war there is no substitute for victory.
In which level of metalanguage are you now speaking?
Incest gets you involved with relatives.
Incidentally, what does teleport mean?
Include me out -- Sam Goldwyn
Include this in your CONFIG.SYS File: BUGS=OFF
Income is something you cannot live without or within.
Incoming fire has the right of way.
Incongruous - Where laws are made.
Incorrigible punster -- do not incorrige.
Indecision is the key to flexibility.
Indecision is the only key to flexibility.
Indeed, Captain Picard, you have found him. ■ Spock
Indiscriminate study bloats the mind.
Individualists UNITE! Dyslexics UNTIE!
Individualists, UNITE!
IneedsignificantlymoreroominthislineforwhatIwanttosay.
Infinite: bigger than the biggest thing, and then some.
Infinity is a self-canceling thought form.
Infinity is a self-cancelling thought form.
Infinity is one lawyer waiting for another..
Infinity is so big, bigness itself looks really titchy.
Inflatable love tagline - blow here---------------->▀
Inflation has gone up about a dollar a quart.
Inflation is a result of legalized counterfeiting.
Inflation is when the buck doesn't stop anywhere.
Information is hard to get. Using it is even harder.
Ingrown toenails are caused by unsafe sox!
Innocent as a newborn alligator!
Innuendo can be fun.
Innuendo: an Italian suppository.
Inquiring Minds Couldn't Care Less!
Inquiring minds think they already know.
Inquiring minds think they know.
Inquiring minds want to know.
Insanity is hereditary; you get it from your children.
Insanity is just a state of mind.
Insanity runs in my family; in fact, it nearly gallops!
Insanity, perfect rational adjustment to an insane world.
Insert diskette in Drive C. Press [ENTER] to continue...
Insert Wallet In Drive A: And Press <Enter>.
Inside large problems small problems wait to get out.
Inside, of course, was where outside was.
Insomnia isn't anything to lose sleep over.
Insomnia cure = Monday morning.
Inspected by #4
Install failed. Transfering virus to C:...
Instant Human: Just add caffeine, alcohol, and nicotine.
Instant Human: just add coffee.
Instant Idiot -- Just Add Alcohol
Instinct is intelligence incapable of self-consciousness.
Insufficient disk space, abandon all hope here and now.
Intel's new G.A.G. chip is made with sillycone.
Intellectual: one who can tell you more than he knows
Interchangeable parts won't.
Intermission chatter: show buzz.
International Priority for this message please ...
Internet, our highway system of the future.
Internist - a doctor that spends all his time indoors.
Intriguing. I did not know humans were so capable.
Invalid command! Strike any user to continue.
Invalid COMMAND.COM, System Disobeying
Invertebrates make no bones about it.
Invest in negotiable blondes ...
Invoking another's self-interest gives you more leverage
Iraq has won the toss... and elected to receive.
Iraq shot down 38 Patriot Missiles with their SCUDS.
Iraqi Bingo B-52..F-16..A-10..F-18..F-117..B-2
Iraqnaphobia? Nothing a little RAID can't fix...
Iron sharpens iron; scholar, the scholar.
Irony: Giving Father a billfold for Christmas.
Irregular verbs are on sale in the bargain basement.
Irregularity: Someone who comes to work late.
Irritable TV addict: grouch potato.
IRS Motto: Big or small we TAX them all.
IRS' motto: You make it, we take it.
IRS: How much did you make last year? Send it in.
Is "Lord of the Flies" about the invention of the zipper?
Is "Sue" a noun or a verb?
Is a clam REALLY all that happy?
Is a computer language with goto's totally Wirth-less?
Is a hippie haircut an example of the lunatic fringe?
Is a hologram an image without substance?
Is a Jamaican terminal a Rastafarian?
Is a PC a symbol of Immaculate Contraption?
Is a proofreader a blooper snooper?
Is a prostate operation called a "lowbotomy?"
Is a root canal more fun than a poke in the eye?
Is a WATCH OUT FOR CHILDREN sign a birth control ad?
Is Acid Rain manna for old Hippies?
Is Australia really down under, or are we upside down?
Is Demi Moore or less than a great actress?
Is electronic mail just micro chip chat?
Is Ellen Barkin up the wrong tree?
Is Ellen Burstyn at the seams?
Is Erin Gray?
Is everybody happy? - Machiavelli
Is evil a child of the nature or nurture of the beast?
Is he Irish? I thought I heard Raymond Burr.
Is Helen Reddy?
Is HAST faster than the Concord?
Is Husain or not?
Is it 'Flow Control' or 'lortnoC wolF'
Is it a bigger crime to rob a bank or to open one?
Is it MY fifteen minutes yet?
Is it OK to yell 'MOVIE' in a crowded firehouse?
Is it progress if a cannibal uses a knife and fork?
Is it snowing yet?
Is it still paranoia if they ARE out to get me???
Is it time for lunch yet?
Is it true love or fiscal attraction?
Is it weird in here, or is it me?
Is Jane Fonda Ted Turner?
Is Koo Stark naked?
Is Lenin's tomb a Communist plot?
Is Lesley-Anne Down on casting rolls anymore?
Is Loretta Young anymore?
Is Lynne Moody or has she learned to smile?
Is Mae West or East of good taste?
Is Mare Winningham and eggs as a door prize?
Is Merle Haggard from being on the road?
Is Merle Oberon stage left or right?
Is my tagline off topic?
Is Olivia Hussey enough in her latest role?
Is OS/2 only half an operating system?
Is relativism the only absolute?
Is roughing it cutting a filet mignon with a dull knife?
Is Sarah Miles away on location?
Is Sean Young and lovely?
Is sex dirty? Only if it's done right.
Is sex in a cornfield, PORN on the cob?
Is Sheree North of the Mason-Dixon Line?
Is someone trying to tell you something?
Is that a beard, or are you eating a muskrat?
Is that the law around here, an I for an i?
Is that you singing or does the dog want in?
Is that you singing or my hard drive whining?
Is that you singing, or does the cat want in?
Is there a lawyer in the house? -=]BLAM![=- Any more?
Is there any last service you would like me to perform?
Is there any tea on this spaceship?
Is there anybody left who says "hello" -- and means it?
Is there life before coffee?
Is this another CHICKEN joke???
Is this as much fun as you can have with your clothes on?
Is this bullshit or fertilizer?
Is this drive really moving with my head parked?
Is this Heaven... No. Smell, its Iowa.
Is this really happening?
Is this the 5 minute argument, or the full half-hour?
Is this the bottom line?
Is this where the tagline goes?
Is this yours? Your dog left it on my lawn ...
Is wetter REALLY better?
Isn't banning gays from the Military ethnic cleansing?
Isn't it about time you backed up your system?
Isn't it nice that egotists don't talk about other people
Isn't love strange?
Isn't the best defense always a good attack? -- Ovid
Isn't there a statute of limitations on stupidity?
It *IS* documented, look under "For Internal Use Only."
It ain't no use to sit and wonder why, babe...
It ain't over 'til it's over.
It ain't over 'til Roseanne Barr sings.
It ain't over 'til the fat lady sings....
It all hinges on your definition of 'a good time'.
It always rains right after I wax philosophical.
It can't be full...I STILL HAVE SUBDIRECTORIES !
It depends on which end he tries to light...
It did WHAT? No, it's not supposed to do that.
It doesn't have to make sense! It just has to work!
It doesn't help to curse the darkness.
It doesn't matter if you win, it's the point spread.
It doesn't work, but it looks pretty.
It give me a headache to think down to your level.
It give me a headache to think to your level.
It has been discovered: research causes cancer in rats.
It has many other uses as well. Allow me. ■ Worf
It is a farewell gift from the dolphins.
It is a Federal offense to copy this tagline.
It is a great ability to be able to conceal one's ability
It is a poor judge who cannot award a prize.
It is a rather pleasant experience to be alone in a ban
It is a rather pleasant to be alone in a bank at night.
It is a sin peculiar to people to hate their victims.
It is always easier to destroy than to create.
It is always the wrong time of the month.
It is bad luck to be superstitious.
It Is Better To Anger A Dragon Than A Woman.
It is better to be brief than boring.
It is better to burn out than to fade away.
It is better to copulate seldom rather than never.
It is better to copulate than never.
It is better to kiss an avocado than to kiss an aardvark.
It is better to know useless things than nothing.
It is better to praise others, to win more favors.
It is better to wear out than to rust out.
It is better to copulate than never.
It is dangerous to confuse children with angels.
It is double pleasure to deceive the deceiver.
It is easier to admire hard work if you don't do it.
It is easier to catch flies with honey than with vinegar.
It is easier to get forgiveness than permission.
It is easier to run down a hill than up one.
It is easy to be wise after the event.
It is easy to propose impossible remedies.
It is fatal to live too long.
It is Fortune, not wisdom that rules man's life.
It is hard to believe that even his friends like him.
It is hard to discern when enough is enough + / = / - .
It is hard to fly with eagles when you work with turkeys.
It is hard to tap into the phone system from the Plieades
It is harder to forgive someone for being right.
It is hereditary in my family to have no children.
It is immoral to allow a fool to keep his money.
It is important not to act your age as you get older.
It is in changing that things find repose -- Heraclitus
It is meaningless to speak of domesticating a child.
It is not enough to succeed. Others must fail.
It is not only fine feathers that make fine birds.
It is possible to smell after you stop breathing.
It is so much better to live rich than to die rich.
It is the wise bird who builds his nest in a tree.
It is well known that careless talk costs lives.
It is when you take for yourself that you truly take.
It is, after all, only a moment in the infinity of time.
It isn't a dance, it's a fertility rite with lyrics.
It isn't easy being a cop.
It isn't easy being a genius.
It isn't easy being green.
It isn't really mine 'til I've modified it!
It looks like an optical illusion, but it isn't.
It matters not if you win or lose, it is what I do.
It may be Fool proof -- but not damnfool proof!
It may be GUI, but you still can't eat it!
It must be inordinately taxing to be such a bimbo.
It must be inordinately taxing to be such a bozo.
It must be the moon.
It never pays to argue with a mule, woman or a Sysop.
It never rains but it pours.
It really bothers me when people cut me o
It runs in the blood like wooden legs.
It said "Insert disk #3", but only two will fit!
It sounds like you enjoy looking forward to yesterday.
It stinks more every time you run over a skunk
It takes a long word to retard spoilage.
It takes about 10 years to get used to how old you are.
It takes two to make a bargain.
It takes two to Tango.
It usually takes weeks to prepare an impromptu speech.
It was a Dark and Stormy Byte....
It was a dark and stormy night...
It was a night like this, 40 million years ago.
It was an old face, thin and distinguished, not unkind.
It was decided to build three ships, three arks in space.
It was deja vu all over again
It was fine up to the bit about the teacup.
It was going to be a noisy show.
It was so cold, I almost got married.
It was supposed to be so easy.
It wasn't broke 'til I fixed it a little...
It wasn't exactly a divorce--I was traded.
It will be done on time, if I can find the time.
It won't be like this when I get my CRAY!
It works better if you plug it in *AND THEN* turn it on.
It works better when you turn the brightness up.
It works fine except when I am in Windows.
It works for me.
It's *your* baby. Don't call me if the fit hits the shan!
It's 11:56 pm. Do you know where your modem is?
It's 4AM and I'm all out of pithy things to say.
It's a beautiful day in the neighborhood.
It's a bypass. You've got to build bypasses.
It's a dog-eat-dog world and I'm wearing Milk Bone Undies
It's a dog-eat-dog world, don't wear MilkBone underwear.
It's a fine line between fishing & standing still.
It's a good thing we don't get all the gov't we pay for.
It's a joke, Bobby, so laugh like the rest of us!
It's a knick-nack, Paddywack. Give the frog a loan.
It's a mistake to try to understand machines.
It's a Mr. Death, he's come about the reaping???
It's a nice Park Overall.
It's a P.C. Cake.
It's a poor cook who cannot lick his own fingers.
It's a poor sort of memory that only works backwards.
It's a poor workman who blames his tools.
It's a pretty short runway, but it's reeeeaaaaaal wide!
It's a simple choice: Life, Death, or Los Angeles.
It's a small world, but I wouldn't want to paint it!
It's a tragedy that no man becomes like his mother.
It's all a matter of taste.
It's always darkest right before you step on the cat.
It's always darkest right before you step on the dog!
It's always something.
It's amazing how mature wisdom resembles being tired.
It's an ill wind that blows as you leave the hairdresser
It's as bad as you think and they are out to get you.
It's as if the pages of his mind are stapled together.
It's azure thing.
It's bad luck to be superstitious.
It's been lovely, but I have to scream now....
It's been nice meeting you, and nicer to see you leave.
It's better than a DuckTales episode!
It's better the world wonder why you *AREN'T* President.
It's better to be rich and healthy than poor and sick.
It's bleeding seabird, bleeding albatross flavour
It's certainly not my fault, I barely touched it.
It's clever, but is it art?
It's déjà vu all over again.
It's easier to curse the candle than light the darkness.
It's easier to get forgiveness than permission.....
It's easier to love all humanity than some neighbors.
It's easy to make a friend, hard to make a stranger.
It's Ensign Pencil. He's lead, Jim.
It's Ensign Pillsbury... He's bread, Jim!
It's getting deep. Where *did* I put those boots?
It's hard to be humble when you're having so much fun.
It's hard to be humble when you're perfect.
It's hard to believe it, but some teens are humans.
It's hard to keep your head when your neck's on the line
It's It. That's that. So what?
It's just life.
It's just the brain we want to buy.
It's love that makes the world go round.
It's morally wrong to let a sucker keep his money.
It's more than a reader. It's a message base mangler!
It's my country, so when do *I* get to run it???
It's my personal idea because I stole it first.
It's my turn to sleep in the middle
It's never too late to have a happy childhood.
It's nice that people who love L.A. live there.
It's nice to be liked just the way you are.
It's nobody's business, not even mine.
It's not a bug, it's a hidden and seldom used feature.
It's not a bug, it's an undocumented feature.
It's not a person, damnit! It's a Borg!
It's not a sin to be rich... it's a miracle!
It's not a virus ..... it's just Windows 3.1!
It's not an optical illusion, it just looks like one.
It's not crippled, it's functionally challenged!
It's not Crippleware - It's "Functionally Challenged"
It's not easy having an overbearing parent! - Troi
It's not GEEK - it's SOCIALLY CHALLENGED, dammit!
It's not hard to meet expenses, they're everywhere.
It's not how fast IT runs, it's how fast YOU run.
It's not how much an item costs, it's how much you save.
It's not how much it costs, it's how much you save.
It's not if you win or lose. It's placing the blame.
It's not in the manual !!!!!
It's not me, it's just the way they dress me.
It's not NICE to fool Mother Nature!
It's not often I'm right, but I'm wrong this time.
It's not over until the FAT table sings.
It's not pretty being easy.
It's not sugar that makes tea sweet, it's the stirring.
It's not the fall that kills you, it's the sudden stop.
It's not the money I want, it's the stuff.
It's NOT the principle of the thing -- it IS the money!
It's not who wins or loses, it's who keeps score.
It's often cheaper to be forgotten than remembered.
It's OK to wear the same thing every day: a smile.
It's ok, I'm just *outside* of Philadelphia.
It's okay to call someone stupid; just don't prove it.
It's okay to laugh in the bedroom, but don't point.
It's only a hobby ... only a hobby ... only a
It's only PIXELS on a CRT, for crying out loud...
It's possible...
It's probably just your house being knocked down.
It's psychosomatic. You need a lobotomy. I'll get a saw.
It's raining, it's pouring, the old man is...dead, Jim.
It's safer to pretend to know too little than too much
It's so bad, it may turn my hair dark.
It's so hot, fire hydrants are looking for dogs!
It's starting to rain, .SQZ the animals into the .ARC !
It's stupid to continue doing what doesn't work.
It's symbolic of his struggle against reality.
It's the anticipation of failure that paralyzes.
It's the brain we want to buy.
It's the drizzle that makes me particularly morose.
It's the kind of thing that makes people go "Hmmmmmm.."
It's the last straw that always breaks the camel's back.
It's the people you meet that really get you down.
It's too early in the Morning to be User Friendly!
It's vitally important that we talk and drink.
It's what inside you, not the outside that counts.
It's what you learn after you know it all that counts !
It's who you look like......Not who you are.
It's Wise To Know Enough To Not Know Too Much
It's worse than that, it's physics, Jim!
Ithinkmyspacebarstoppedworking.
Its hard to be nostalgic when you can't remember a thing.
Its important to use apostrophe's right.
Its not the size of the ship, its the size of the waves.
Its not the thing you fling, its the fling itself.
Itsdifficulttobeverycreativewithonlyfiftysevencharacters
Ivy covered professors, in ivy covered halls.
Iz okey. Zmodem iz working now.
J'suis le Grand Zombie.
J. Edgar Hoover slept with a night light on all night.
JACKBLAK.SYS Not Found! Operator Not Loaded!
Jammed? Force it. If it breaks it needed replacing anyway
Japanese Ducks go, "Clack Clack" (So Soddie)
Jay Leno Spaceprobe launched to tickle Uranus.
Je suis un grand frommage.
Jealousy is about all the fun you think they had.
Jealousy is all the fun you think they have.
Jesus Saves, Adam passes, Moses SCORES!
Jesus Saves, Moses scores on the rebound!
Jesus saves, passes to Moses... he shoots... HE SCORES!!
Jesus saves... ...and Moses invests
Jesus Saves... and Gretsky scores on the rebound!
Jim Bakker & Jimmy Swaggert's new magazine - Repenthouse
Jim, you don't ask the Almighty for his ID!
Jimi Hendrix's modem was a Purple Hayes.
Jimmy Hoffa, call your office.
JoAnne Wardlow: Intelec Coconuts Conference Host
JoAnne Wardlow: Intelec Crelm Toothpaste Conference Host
JoAnne Wardlow: Intelec Fwee Bwian Conference Host
Joanne Wardlow: Intelec Gwen Dibley Conference Host
JoAnne Wardlow: Intelec Monty Python Conference Goddess
JoAnne Wardlow: Intelec Rat Tart Conference Host
JoAnne Wardlow: Intelec Shrubbery Conference Host
Joey's morgue, you stab, we slab!!!!
John Wayne toilet paper; rough, tough, won't take sh*t.
Johnson & Johnson Tagline: █████░░░░░█████
Join AHA: Acronym Haters of America.
Join Fitness Club, weigh $1250 less in three months.
Join hands across the seas. Stop continental drift.
Join Taglines Anonymous. We can help.
Join the Army, Meet interesting people, Kill Them.
Join the Group Mind - become a Borg
Join the War on Puberty, eliminate juvenile delinquency.
Jone's Motto: Friends come and go but enemies accumulate.
Josef Stalin's grave was a Communist Plot.
Journalism is literature in a hurry.
Journey of 100 miles starts with argument on loading car.
jpunix!urchin.fidonet.org> (1:106/88.0)
Judge a man by his questions rather than by his answers.
Judge not a carpenter on how fast the chips fly.
Judge not, lest ye be judged incompetent by the world.
Judicial reform is no sport for the short-winded.
Jugular - one who does skillful tricks of sleight of hand
Jump off cliffs; build your wings on the way down.
Junior! Quit playing with your floppy!
Junk - stuff we throw away. Stuff - junk we keep.
Junk will accumulate to overflow space provided for it.
Junk: Stuff we throw away. Stuff: Junk we keep.
Jury: A group chosen to decide who has the best lawyer.
Jury: Twelve people too dumb to get out of jury duty.
Just a sec......yep, I hear a beer calling me!
Just another inmate in this ASYLUM!!!
Just as I had the answer, I forgot the question.
Just Because I'm Moody Doesn't Mean You're Not Irritating
Just call me Cleopatra, Queen of Denial.
Just cannot resist a little fun along the way. :-)
Just don't tell the asylum you saw me here.
Just dropped in to see what condition my condition was in
Just exactly what is a "Dildo Head"?
Just filling in all the blanks.
Just fitting on the disk in the bay... Otis Redding
Just for today..... do not anger.
Just give me what the Dr.ordered..OHHOOO Dr Pepper..
Just got a new car for my wife ... what a great trade!
Just in one of my moods. <burp> I think that helped.
Just listen to those old diodes slam dancing.
Just moving fast is not the same as getting somewhere.
Just My Opinion (But I'm Right!)
Just one little kiss? I've had all my shots!
Just one more call dear.... Honest!!
Just pray for a tough hide and a tender heart.
Just remember: when in doubt, you're always right.
Just send my paycheck to MasterCard or VISA.
Just sittin' here watchin' the wheels go round & round...
Just Tell Me How To Follow Protocol.
Just the thing for that special occasion!
Just think - in German, "Tag" means "day".
Just think what the oyster gets for its irritation.
Just try .ZIPping your lip in a floppy drive!
Just trying out my new Mason-Dixon Line reader...
Just want to add my two cents worth, for what it's worth.
Just when I got it all together I forgot where I put it.
Just when I make ends meet, someone moves one end.
Just when I've found the answer, you change the question.
Just when you think it's hopelessly broken, it works.
Just when you think life can't get worse, it does.
Justice delayed is justice denied.
Justice is dispensed with sometimes in the court system.
Justice is incidental to law and order.
Justice: A decision in your favor.
Justify my text? I'm sorry but it has no excuse.
K.I.S.S.
Kablaaaaaaaaaaaaammm!
Kay Lenz grace and beauty to any role.
Keep America Beautiful.... emigrate.
Keep an eye ouch yonda'.
Keep cool, stand in front of an open refrigerator.
Keep emotionally active. Cater to your favorite neurosis.
Keep grandmothers off the streets - legalize bingo.
Keep hands off the secretary's reproducing equipment.
Keep matters in suspense.
Keep on hacking...
Keep one foot in the past when searching for the future.
Keep playing with your floppy, you'll go blind!
Keep this up and you'll get warts.
Keep thy Tail Bushy and thine Eyes Bright,
Keep to the left, please, keep to the left.
Keep trying.
Keep your eyes open before marriage, half-shut afterwards
Keep your hands away from my pockets mister
Keep your head--run the guillotine.
KENNEDY COMPOUND -KEEP OUT- TRESPASSERS MAY BE VIOLATED!
Kernel panic: Nut lose in operator's chair.
KEYBOARD - Hardware used to enter errors into a computer.
Keyboard not found. Press [F10] to continue.
Keyboard not found... THINK F1 to Continue.
KGB keyboard has no <ESC> key!
Kibitzer: A person with an interferiority complex.
Kids give us the opportunity to be the parents we wanted.
Kids, don't try this at home without an adult present.
Kids-They're not sleeping, they're recharging!
Kids: find out what they want, then advise them to do it.
Kids: keep 'em short on cash and long on hugs.
Kids? Who said anything about kids?
Kill them all! .... Let God sort them out.
Kill two birds with one stone? What happened to shotguns
Kilroy was here.
Kin: An affliction of the blood.
Kindness is its own motive; we are made by kindness.
Kinescope - used for locating family or 'kin'.
Kinky = with a feather : perverted = the whole chicken
KISS (Keep It Simple Sysop!)
Kiss me twice. I'm schizophrenic.
KISS method of programming: Keep It Simple Stupid
Kiss my ASCII.
Kleenex Von Trapp: The Sound of Mucous.
Kleptocracy: corrupt government
Kleptomaniac: A rich thief.
Klingon Philosophy - Do unto others (Period!)
Klingon Thanksgiving Grace: "Let us prey..."
Knights In Shining Armor Are Never Too Many Or Too Brave.
Knock softly but firmly: I like soft, firm knockers...
Knofler makes a Schecter Custom Stratocaster hoot & sing.
Know what I hate? I hate rhetorical questions!
Know when to fight and when to run.
Know your best quality.
Knowing Murphy's law won't help either.
Knowledge is power, if you know it about the right person
Knowledge rests not on truth alone, but upon error also.
Kotex isn't best thing in world, but next to it.
KPLA, Klingon radio: All glory, all the time!
Krikkit's sky is the universes least interesting sight
KSUTRA.COM: Path to SEX.DAT not found. Check hardware.
L8R; Cya; Bye
La dee dee, one two three, Eric the half a bee.
Lack of planning does not constitute an emergency.
Laddie, ya think ya might like ta ... rephrase that?
Ladies & Gentlemen, Elvis has left the bldg.
Ladrao que robuda ladrao tem 100 anos de perdao.
Lady Justice Blindfold: Hates to see lawyers make deals.
Lady Luck tires when someone rides her back too long.
Lady prof to suitor: "I'll put on a little slipstick."
Lady with chastity belt is not having a ball.
Laetrile is the pits.
Lake Erie died for your sins.
LAMA=priest. LLAMA=beast. LLLAMA=conflagration.
Landscape architects DON'T do lawns.
Langsam's Law: Everything depends.
Language is a human virus from outer space.
Laptops and Taglines; proof power comes in small packages
Large Cheese Pizza UPC Code -> │║▐║│║│█│║▌│║▌││
Lasciate ogni speranza voi ch'entrate.
Lassie, where's Timmie?
Last week I even forgot how to ride a bicycle.
Last week's Procrastinator's meeting has been postponed
Last yur I kudnt spel modjerater now I are won.
Later dates.
Later...
Latest conspiracy theory: Humpty Dumpty was pushed.
Laugh and the world thinks you're an idiot.
Laugh at the insolence of power; arrogance of the rich.
Laugh at your problems; everybody else does.
Laugh track: fraudience
Laughing stock: cattle with a sense of humor.
Laughter is the best lubricant for life's engine.
Laughter is the best medicine...cheaper too!
Laughter, the best weapon.
Laundry: A place where clothes are mangled.
Law of Cybernetic Entomology: There's always one more bug
Law of Insurance and Taxes - Whatever goes up, stays up.
Law of Revelation: The hidden flaw never remains hidden.
Law of Supply: It's yours if you don't need nor want it.
Law of Window Cleaning: It's always on the other side.
Laws are like sausages, it is better to not see them made
Lawyer in posh restaurant? Ambiance chaser.
Lawyer \LAW-yer\ v. 1. Uses the law to get yers.
Lawyer..... One skilled in the circumvention of the law.
Lawyers do it in their briefs.
Lawyers, I suppose, were children once.
Lawyers: the best argument against gun control...
Lawyers: the larval form of politicians.
Laziness: resting before you get tired.
Laziness: the habit of resting before you get tired.
Lead me not into temptation -- I know the way myself.
Lead poisoning: getting shot.
Leader: required to have both character and competence.
Leakproof seals, will. Quiet toilets, aren't.
Lean books are often larded with fat of others' works.
Learn a new language, eat foreign alphabet soup!
Learn to distinguish between hard knocks and opportunity.
Learn to listen. Opportunity sometimes knocks softly.
Learn to recognize the inconsequential, then ignore it.
Learn to say no politely and quickly.
Learn which bridges to cross and which bridges to burn.
Learning makes people fit company for themselves.
Learning teaches you how much you don't know!
Learning without thought is labor lost.
Leave an Electronic Message; Save a Tree!
Leave graft in agriculture; get it out of Congress.
Leaving in a huff is her favorite means of transportation
Left lane must turn right.
Left to themselves, things tend to go from bad to worse.
Left-lane Darwinism: Survival of the fastest.
Legal marijuana needs true glaucoma patients.
Legalize dope. Tax religion. Flog miscreants.
Legends - Sometimes adults fantasize in medieval.
Legislature should be renamed "ledgersalture".
Leisure is the mother of philosophy.
Lend money to a bad debtor and he will hate you.
Less is More!
Less than 100 posts to go!
Let a fool hold his tongue and he will pass for a sage.
Let he who takes a Monday plunge return it by Tuesday.
Let he who takes the plunge remember to return it.
Let him who is stoned cast the first sin.
let length(Long_Walk) > length(Short_Pier)
Let length(walk) > length(pier)
Let me have two brains on drugs, and an orange juice.
Let me know if this message doesn't get through to you.
Let me out of here fast. TRON is catching up.
Let me show you the cure
Let no good deed go unpunished.
Let not the sands of time get in your lunch.
Let the games begin...
Let the rain fall, and fall, and fall.
Let your children hear the nice things you say about them
Let your mouth write no check that your tail can't cash.
Let's all vote for the all night party.
Let's call this meeting to some sort of order,if possible
Let's get dangerous.
Let's have a little fun, let's do a pun.
Let's just say we did -- and don't!
Let's organize this thing and take all the fun out of it.
Let's organize this thing and take the fun out of it.
Let's see your tagline hunting permit, sir.
Let's win this one and go home.
Let's you and him fight.
Lets keep genealogy vital.
Letterbox CGA: Run VGA programs on XTs and PC Jrs.
Lexigraphers prefer PerfectWord, not WordPerfect.
Liar, Liar, Pants on Fire!!!
Liar: One who tells an unpleasant truth.
Liberal......A power worshipper without power.
Liberalism - symbolism over substance.
Liberals! Looks like we'll have to blast our way out!
Libertarians want liberty: yours and mine...
Liberty doesn't work in practice as it does in speeches.
Liberty means responsibility; why most men dread it.
Libretto: aria code.
License on a sheep-country pickup: EWE HAUL
Lick this spot>>>>>[X]<<<<<for a really good buzz!!!
Life - brief interlude between nothingness and eternity.
Life = Run-time Virtual Reality Demo
Life After Death? Is that like Terminate & Stay Resident?
Life ain't easy for a Borg named Hugh.
Life can be great if you live it to the fullest!
Life can be profitable, if you know the odds. - Ripley
Life expectancy for humans in the wild: 35 years.
Life has a great deal up its sleeve.
Life has a lot of undocumented features.
Life imitates art far more than art imitates life - Wilde
Life in Oklahoma is OK
Life is a banquet & most suckers are starving!
Life is a beta test. My copy's got bugs.
Life is a bitch...then the worms eat ya'!!
Life is a bowl of cherries, there's always a few pits.
Life is a Cabaret, old Chum
Life is a first draft .... with NO rewrite.
Life is a fragile bargain, rescindable at any time.
Life is a game, and money is how you keep score.
Life Is A Highway. I'm gonna ride it all night.
Life is a kind of trick.
Life is a series of rude awakenings. - R. V. Winkle
Life is a tragedy for feelers and a comedy for thinkers.
Life is a yo-yo, and mankind ties knots in the string.
Life is an onion and each one peels it crying.
Life is anything that dies when you stomp it.
Life is full of little surprises. - Pandora
Life is hard - and even harder when you're not stupid.
Life is hard... Then you die.
Life is hard; why subject yourself to salesmen?
Life is just a bowl of chili, but no beans for you.
Life is just one big beta test
Life is like a diaper - short and loaded.
Life is like a grapefruit.
Life is like Jazz, it should be improvised.
Life is like......an analogy.
Life is lived forwards, but understood backwards.
Life is much easier if you look at the source code.
Life is not a spectacle or a feast, it is a predicament.
Life is not fair...it is, however, quite a circus.
Life is one big worse case scenario.
Life is one long process of getting tired.
Life is short, eat dessert first!!
Life is short. Learn to enjoy it!
Life is so uncertain, eat dessert first
Life is something that happens when you can't sleep.
Life is still in Beta test.
Life is to you a dashing and bold adventure.
Life is too important to ever take seriously.
Life Is Too Short To Dance With Ugly Women
Life is too short to drink bad wine.
Life is too short to stuff a mushroom.
Life is unsure, always eat your dessert first.
Life is what happens while you're busy making other plans
Life is what you make it.
Life is...life is...life is...life is a kumquat.
Life might be easier if we had the source code.
Life Styles of The Itch and Uranus.
Life would be so very easy if we only had the source code
Life would be very easy if we only had the source code
Life! Don't talk to me about life!
Life! Can't live with it, can't live without it.
Life!! Don't talk to ME about life!
Life's a beach - and then you diet.
Life's a beach and still you always marry one.
Life's a bitch, but some of the puppies ARE cute...
Life's a bitch, time's a bastard, and death finishes it.
Life's bad enough without inventing any more of it.
Life's one certainty is uncertainty!
Life's too short & horses are cheap; ride 'em hard!
Life's too short for chess.
Life, loathe it or ignore it, you can't hate it.
Life. Don't talk to me about life.
Life: Too many questions, too few answers.
Life: You peel layer after layer, you find nothing in it.
Life: you'll never get out of it alive.
Lifeforms emerged, demanding welfare and voting rights.
Light at the end of the tunnel could be a flame thrower!
Light sleeper sleeps with light on; hard sleeper...
Like a military school, bits of me keep on passing out.
Like little play things we dance on our strings.
Like trapeze artists, computers need a net to work.
Like winter snow on summer lawn, time past is time gone.
Like, !wow!, _man_, this is *real* *groo*vy!
Like, I think my bottle absorbed my Beer, eh.
Lilacs weeping fragrance in the rain.
Limelight is a very chancy illumination.
Limit Congress to 2 terms: 1 in Congress, 1 in jail.
Limit Congressmen to 2 terms: One in office, one in jail!
Limit Politicians to 2 terms... 1 in Office & 1 in Jail!
Line noise provided by your local telephone company.
Line noise? What fh=.hElL is.LinS nfise?
Liposuction will destroy your FAT
List all installed virus programs now? (Y/N)
Listen to the rhythm of crashing hard drives.
Little boats should keep near the shore.
Little girls, like butterflies, need no excuse.
Little pitchers have wide ears.
Live a clean, healthy life and soon die of boredom.
Live and learn!
Live beneath your means.
Live better, electrically!
Live fast, die young and leave a good-looking corpse.
Live long and prosper . . . just don't let the IRS know!!
Live long enough to be a burden to your kids!
Live now -- procrastinate tomorrow!
Live so that the family parrot can live afterwards.
Live today; you can always procrastinate tomorrow.
Live: Know the past, help the present, touch the future.
Living in the fast lane gets you to the other end rapidly
Living means dying -- Engels
Living on earth is better than loafing around Hades.
Living poor is best left to those with no money.
Living: The best demonstration of victory over mortality.
Lk#s9$ alkj --Oops! Sorry, fell asleep on the keyboard.
Loaning items: Yeah, I'll bring it back tomorrow... NOT!!
Lobbest thou thy Holy Hand Grenade of Antioch...
Lock and Load. These fingers have just begun to type.
Logic and proportion have fallen sloppy dead...·
Logic is a little tweeting bird chirping in the lea..
Logic is a wreath of pretty flowers with a very bad odor.
Logic is an organized way of going wrong with confidence.
Logic is in the eye of the logician.
Logic is logic. That's all I say.
Logic, coming to the wrong conclusion with confidence.
Loneliness: Having a memory and no one to share it with.
Long live the C64! G-g-guys? I was only kiddin, <BANG!!>
Long live The Great Electronic Underground!
Look after molehills mountains will look after themselves
Look at all the Indians.
Look at them yo-yos! That's the way to do it!
Look Indy! The Gooten-Leiben Blimp!
Look into his eyes, and see if someone else is driving.
Look into yourself to discover your first priority.
Look Ma, No Taglines!
Look out for barking dogs that bite.
Look out! Behind You!
Look people in the eye.
LOOK! There in the crosshairs! It's a LIBERAL! FIRE!!
Look! A flying porpoise!
LOOK! It's a bird! It's a plane! It's...no, it's a bird.
Look, a tagline! Step on it quick before it multiplies!
Look, is there someone else we can talk to?
Look, it's a bleeding pet, isn't it?
Look, it's people like you what cause unrest.
Look, where are we going, because I'm eager to get there.
Looking for a few good yes men.
Looking for reality? Visit a latrine.
Lookout World! The Modem is Ringing!
Looks like I picked the wrong week to stop sniffing glue.
Looks like Woody Woodpecker with a perm!
Lore: Takes a licking and keeps on twitching.
Lose that ugly FAT! Download a trojan today.
Losing weight: the triumph of mind over platter.
Losing your drivers' license is God saying "Walk!"
Lost -- $50. If found, just keep it.
Lost gold may be found, time lost is gone forever.
Lost in the Muscle-Car Era....
Lost in the quagmire of insanity.....
Lost interest? It's so bad I've lost apathy.
Lottery (n), A tax on people who are bad at math.
LOTTERY: Just a tax on people who are bad at math.
LOTUS - Let Only The Users Suffer
Lotus executives do not wear Look & Feel T shirts.
Louisiana road sign: Trash is not bayou-degradable.
Love -- a grave mental disease.
Love and scandal are the best sweeteners of tea.
Love conquers all things except poverty and toothaches.
Love is a great beautifier.
Love is a matter of chemistry; sex is a matter of physics
Love is being stupid together.
Love is blind, to everything except fat.
Love is in the offing, said the homicidal maniac.
Love is in the offing. Be affectionate to who adores you.
Love is like a baseball game, four balls and you walk.
Love is like a baseball game, three strikes you're out.
Love is of chemistry, sex is of physics.
Love is sentimental measles.
Love is the most subtle form of self-interest.
Love me or hate me, but spare me your indifference.
Love means having to say you're sorry every 5 minutes.
Love the sea? I dote upon it - from the beach.
Love thy neighbor ... just never get caught.
Love thy neighbor, but not in public.
Love to but, ... well, maybe.
Love to but, but I'm building a pig from a kit.
Love to but, having fun gives me prickly heat.
Love to but, I did my own thing & now I must go undo it.
Love to but, I don't want to leave my comfort zone.
Love to but, I feel a song coming on.
Love to but, I have to be on the next train to Bermuda.
Love to but, I have to bleach my hare.
Love to but, I have to floss my cat.
Love to but, I have to fluff my shower cap.
Love to but, I have to fulfill my potential.
Love to but, I have to jog my memory.
Love to but, I have to rotate my crops.
Love to but, I have to sit up with a sick ant.
Love to but, I have to stay home and see if I snore.
Love to but, I have to study for a blood test.
Love to but, I have too much guilt.
Love to but, I left my body in my other clothes.
Love to but, I must thaw some karate chops for dinner.
Love to but, I never go out on days that end in "Y".
Love to but, I prefer to remain an enigma.
Love to but, I promised to help a friend fold road maps.
Love to but, I think you want the OTHER [your name] .
Love to but, I want to spend more time with my blender.
Love to but, I'll be looking for a parking space.
Love to but, I'm attending the opening of my garage door.
Love to but, I'm being deported.
Love to but, I'm counting the bristles in my toothbrush.
Love to but, I'm door-to-door collecting static cling.
Love to but, I'm due in court for kitty littering.
Love to but, I'm enrolled in aerobic scream therapy.
Love to but, I'm getting my overalls overhauled.
Love to but, I'm gong to be old someday.
Love to but, I'm having all my plants neutered.
Love to but, I'm having my baby shoes bronzed.
Love to but, I'm in training to be a household pest.
Love to but, I'm knitting dust bunnies for charity.
Love to but, I'm observing National Apathy Week.
Love to but, I'm sandblasting my oven.
Love to but, I'm taking punk totem pole carving.
Love to but, I'm teaching my ferret to yodel.
Love to but, I'm too old/young for that stuff.
Love to but, I'm touring China with a wok band.
Love to but, I'm trying to be less popular.
Love to but, I'm trying to cut down.
Love to but, I'm up to my elbows in waxy buildup.
Love to but, I'm waiting to see if I'm already a winner.
Love to but, I'm working on my cottage cheese sculpture.
Love to but, I'm worried about my vertical hold.
Love to but, I've been scheduled for a karma transplant.
Love to but, I've been traded to Cincinnati.
Love to but, I've dedicated my life to linguini.
Love to but, I've got a Friends of Rutabaga meeting.
Love to but, it's my parakeet's bowling night.
Love to but, it's not fair to the other Beautiful People
Love to but, it's too close to the turn of the century.
Love to but, my bathroom tiles need grouting.
Love to but, my crayons all melted together.
Love to but, my Dress For Obscurity class meets then.
Love to but, my favorite commercial is on TV.
Love to but, my Millard Filmore Fan Club meets then.
Love to but, my palm reader advised against it.
Love to but, my patent is pending.
Love to but, my subconscious says no.
Love to but, my uncle escaped again.
Love to but, my yucca plant is feeling yucky.
Love to but, none of my socks match.
Love to but, the grunion are running.
Love to but, the last time I went, I never came back.
Love to but, the man on television told me to stay tuned.
Love to but, the President said he might drop in.
Love to but, there's a disturbance in the Force.
Love to but, you know how we psychos are.
Love truth but pardon error.
Love will find a lay.
Love your enemies -- it makes them so damned mad.
Love your neighbor: Just don't get caught!
Loving Pit Bull ... needs home ... Master has died ...
Luck is a matter of preparation meeting opportunity.
Luck often wins out over science and technology!
Luck: Preparation meeting Opportunity.
Lucky is he for whom the belle toils.
Lucy in the Sky With s
Lunatic asylum: where optimism most flourishes.
Lurkers of the world unite!
Luxuriantly hand-crafted from only the finest ASCII.
Luxuriantly hand-crafted of only the finest ASCII.
Luxury once sampled becomes necessity.
Luxury: Costs $7.69 to make and $20.00 to market.
Lycanthropes have a howling good time!
Lynch mobs don't think about tomorrow...
Lynch's Law: When the going gets tough, everybody leaves.
M R Ducks. A R Not! C M Wangs? W I B, A R Ducks!
Mac screen message: "Like, dude, something went wrong."
Macedonia is greek and nobody can steal it from us.
Machine wash warm, Tumble dry. Do not bleach!
Machine-independent program: Will not run on any machine.
Macho: Man who jogs home from having a vasectomy.
MacIntosh - The step between Nintendo and IBM!
Macintosh: just like Nintendo, 'cept less games available
MACINTOSH: Machine Always Crashes, If Not, The OS Hangs
MacIntosh:Computer with training wheels you can't remove.
Mad: Affected with a lot of intellectual independence.
Madam, an error, we did a hysterectomy on your husband
Madness takes a toll make sure you have the exact change.
Madness takes it's toll; please have exact change.
Madonna/Quayle '96 - Truth or Duh!!?
Madonna: Our Lady of Perpetual Promotion.
Madre que consiente engorda una serpiente.
Mafia DOS: "Thisa you lasta chance [Y/N]?"
Magratha disappeared and its memory passed into legend.
Magrathea is a gateway back to our own dimension.
Maintainer's Motto: If we can't fix it, it ain't broke.
Major Galactic civilizations pass through 3 phases.
Make A Difference - Elect *New* Idiots For Congress!!
Make a wish, it might come true.
Make friends with sysops: Page at 3 a.m.
Make headlines! Use a corduroy pillow.
Make love AND war.... get married!
Make Love, Not War. Get Married & Do BOTH!
Make me an offer. I have a computer to support!!
Make me breakfast and perhaps I'll consider it. ■ Troi
Make new friends but cherish the old ones.
Make new friends but keep the old. Like silver and gold.
Make someone happy tomorrow, Mind your own business today
Make two grins grow where there was only a grouch before.
Make way!, Make way!, A PROGRAMMER HAS ARRIVED!!
Malice is merely stupidity raised to a higher power.
Mamas, don't let your babies grow up to be lawyers...
Man after my own heart (means I'd better watch my wallet)
Man and wife make one fool.
Man is a clever animal that behaves like an imbecile.
Man is a dog's ideal of what God should be.
Man is a fool, always wanting what is not.
Man is a piece of the universe made alive.
Man is the bad child of the universe.
Man is the missing link between apes and human beings.
Man is the only animal that blushes. Or needs to.
Man isn't "meant" to do things. He "means" to do things
Man looks into the abyss, and sees himself.
Man loves little and often, woman much and rarely.
Man marry girl with no bust have right to feel low down.
Man rarely dreams up a god superior to himself.
Man who eats too many prunes, sits on toilet, many moons!
Man who farts in church sit in own pew.
Man who fights with wife all day gets no peace at night.
Man who gets kicked in testicles left holding the bag.
Man who kisses girl's behind gets crack in face.
Man who knows better wants woman not quite that old.
Man who lay woman on ground get peace on Earth.
Man who lay woman on hill not on level.
Man who snatch kiss when young, kiss snatch when old.
Man who stands on toilet seat is high on pot.--Confucius
Man who suck nipple make clean breast of things.
Man who took key to girl's apartment get no new key.
Man with athletic finger make broad jump.
Man with holes in pockets feels cocky all day.
Man's horizons are bounded by his vision.
Man's inhumanity to man makes countless thousands mourn.
Man, born of woman is of few days; full of trouble.
Man: There is nothing more miserable and more arrogant.
Maniac: He who leaves Maine. Mainer: he who stays.
Manners are noises you don't make while eating soup.
Mantenha sua CPU virgem, nao remova o HIMEM.
Manuals come out, after all possible keystrokes fail.
Manuals: Never has so much been so confused by so many.
Many a family tree needs trimming.
Many a golfer yells "fore", takes 6, and puts down 5.
Many a good message ends with a bad tagline.
Many a yo-yo thinks he has the world on a string.
Many are absent from reality physically and/or mentally.
Many changes of mind and mood; do not hesitate too long.
Many foxes grow gray, but few grow good.
Many kiss the hand that they wish they could bite off.
Many office holders are sworn in one year, sworn at next
Many possess the wisdom of many and only the wit of one.
Many receive advice, only the wise profit from it.
Many rise to the occasion, few know when to sit down.
Many things are more than just the sum of their parts.
Many tombstones should read: "Died at 30. Buried at 60."
Many would be cowards if they had courage enough to be so
Man`s horizons are bounded by his vision.
March 16: National "Hassle Jan Day"
Margaritas in a birdbath? Enough tequila mockingbird!
Marijuana, nature's way of saying "Hi!"
Marketing is simply sales with a college education.
Marriage is not a WORD, it's a SENTENCE.
Marriage is one of the chief causes of divorce.
Marriage is the only adventure open to the cowardly.
Marriage makes a life of deception a necessity.
Marriage secret: One talks, the other doesn't listen.
Marriage should be every woman's end--but not her finish.
Marriage, a romance but the hero dies in the 1st chapter.
Marriage, is a lifelong venture, approached with caution.
Marriage. A joint venture resulting in a fiscal merger.
Marriages are based on believing you won the arguments.
Married politicians do it to wife and country.
Married.. Who me ? ... I can't mate in captivity.
Married? Me? No, I can't mate in captivity!
Mars needs women, apply at NASA.
Marvin counted 579X106 sheep before falling asleep.
Mary had a little jam -- labels in her laser jet.
Mary had a little lamb -- a little beef, a little ham.
Mary had a little lamb -- the doctor died of shock!
Mary had a little lamb -- The doctor was very surprised.
Mary had a little lamb, a little beef, a little ham.
Mary had a little lamb, some wine and a loaf of bread...
Mary had a little lamb. Boy, was the doctor surprised!
Mary had a little pram -- punch line for sex.
Mary had a little RAM -- about a MEG or so.
Mary had a little RAM -- only a MEG or so.
Mary had a little RAM -- only about a MEG or so.
Mary had a little scam -- and did 5 to 10.
Mary had potatoes, wine, salad, and a little lamb.
Massachusetts has the best politicians money can buy!
Master debaters often argue with themselves.
Math and alcohol don't mix. Please don't drink and derive
Math illiteracy affects eight of every five people.
Matrimony is the root of all evil.
Matrimony isn't a word, it's a sentence.
Matter will be damaged in proportion to its value.
Maturity: acting your age instead of your urge.
Maud Adams correctly.
May a thousand angry hornets take refuge in your pants.
May all your hang-ups be drip-dry.
May I suggest a nice set of fur lined ankle straps?
May the force be with you.
May the Schwartz be with you!
May the wind behind you always be your own...
May we kiss those we please, and please those we kiss.
May you live all the days of your life.
May you live in interesting times.
May your best yesterday be better than your worst today.
Maybe a silly question - but what am I doing here?
Maybe if I just shut up, everything will be fine.
Maybe we should quit now.
Maybe you're correct being nervous now.
Mayor of a major U.S. city.
Maytag is my middle name: I'm an agitator.
McBorgs - Over one billion assimilated!
Me a cynic?...I doubt that.
Me heap big programmer! Me read core dumps in restroom!
Me, indecisive? I'm not so sure about that.
Me...a skeptic? I trust you have proof.
Me: Optimistic Pessimist, Wife: Pessimistic Pessimist.
Me? FAT? No, just Horizontally Disproportionate.
Me? Paranoid? Who wants to know?
Mealtime: When kids sit down to continue eating.
Meaning of Life: <Deleted for lack of space>
Meaningless tagline attached to pointless message.
Medical Def'n #9:OUTPATIENT; A person who has fainted.
Medical Staff - a doctor's cane.
Medical staff: A physician's cane.
Meditation is not what you Think.
Meester, do you vant to buy a duck?
Meet my car, Fenry Honda.
Meet my friends, Ida Noe and H.E. Dunnit.
Meet the new Boss--same as the old Boss...
Meetings are indispensable for doing nothing.
Megabyte: Congressional spending.
Megahertz--when something is really painful.
Megan Follows scripts scrupulously.
Melanie Mayron the New York Marathon.
Melted fruit snacks on keyboard. Delete children [Y/N?]
Melting pot: was 'USA', now means wrong dish in microwave
Member #8675309: International Tagline Theft Ring
Member, Atheist Muslims, a non-prophet organization
Member, Cadavers Union Local B-943
Member: International Brotherhood of Tagline Thieves!
Memoirs are the backstairs of history.
Memories keep the wolf of insignificance from the door.
Memory defect detected. Go back to school? (Y/N)
Memory is a thing we forget with.
Memory is the second thing to go during the human story..
Memory is the second thing to go. I can't remember the
Memory Manager: Something I need more than my computer.
Memory overload error noted ... Meltdown now evident.
Memory seems to go first, or second, or ...
Memory: Subject to RAMsom.
Men are born ignorant; they are made stupid by education.
Men are creatures with two legs and eight hands.
Men are inherently chauvinistic.
Men are more sentimental than women. It blurs their minds
Men avoid attributing cleverness to others unless enemies
Men die and worms eat them - but not for love.
Men fight for freedom, then pass laws to take it away.
Men know life too early, women too late.
Men, in general, are but overgrown children.
Mental floss might prevent moral decay.
Mental Floss prevents Moral Decay.
Mental Floss: In one ear and out the other.
Menu: A list of meals the restaurant has just run out of
Menu: List of dishes which the restaurant has run out of.
Meran heard part of the wish and improvised the rest.
Message brought to you by sufficient coffee indigestion.
Message disgusting enough: No tagline required.
Message sent. Destroy immediately upon receipt.
Met a good virus lately?
Metaphors be with you.
Method acting.. I'm vaguely aware of it. - Picard
Metric Lit: The Courtship of Kilometers Standish.
Mice and Men make plans, Cats and Women should work.
Mice crawl under doors, programs crawl under Windows.
Mickey Mouse says "Hi"!
Mickey Mouse wears a Dan Quayle watch.
Microbiology Lab: Staph Only!
Microbrain, growl for me, let me know you still care. Q
Microsoft 900 numbers. I have call blocking installed...
Microsoft DOS 5.0 Customer Support: 1-900-SUCKERS !!
Microsoft? Little mushy things?
Microwaves frizz your heir.
Midas was into golden showers.
Middle Age: Halfway between adolescence and obsolescence!
Middle age: When your age starts to show at your middle.
MIDDLE AGE: With any luck I'll outgrow it.
Middle-age: that time when our kids decide we're dorks.
Middle-aged: Anyone 10 years older than you.
MIDI: Many Indecent Dollars Incurred
Midwest farmers are just plain folks.
Mie spel czecher iz awn the phritz.
Military intelligence is a contradiction of terms.
Milk of Amnesia -- when you NEED to forget.
MilliHelen: amount of beauty required to launch one ship.
MilliHelen: Beauty required to launch one ship.
Milliway's is an extraordinary venture in catering.
Milliway's, a sophisticated answer to the third question.
Milliway's, The Restaurant at the End of the Universe.
Mind like a steel trap - just a bit rusty...
Minds, like parachutes, work only when open.
Mine! Mine! It's all mine!
Minister of Comedy, Religion, Philosophy and Taglines
Minnie and Mickey Mouse are slow maze learners.
Minor operation. What workers do in a coal mine.
MIPS = Meaningless Indicator of Performance Statistic
MIPS: The shapely part of a computer that sways.
MIPS: What my wife gives me sun up to sun down.
Miracle owes its origin to the negation of thought.
Miracle Software, Inc. Motto: If it works, it's a Miracle
Misbehaving witches are sent to their broom closet.
Mischief all comes from too much opening of the mouth.
Misery brings strange bedfellows.
Misery loves company, but company does not reciprocate.
Misery. Dejection. More misery and more dejection.
Misfortune: The kind of fortune that never misses.
Misfortunes always enter any door left open for them.
Misinformation is the cruelest computer virus of all.
Misogyny recapitulates philandery
Missed it by that much!
Missiles converging on your ship are a special service.
Misspelled? Impossible. My modem is error correcting.
Misster, do you vant to buy a duck?
Mistakes are oft the stepping stones to failure.
Mistakes at least show someone did something at sometime.
Mistakes made by Congress get worse when corrected.
Mistakes=Learning. If you knew it, you wouldn't make 'em.
Misteaching: Telling one's grandmother how to suck eggs.
Mister! Here's your mule.
Mistletoe at airline counter? Kiss your baggage goodbye.
Mistrust first impulses, they are always good.
Miyazawa to Bush: "Your dinner is on me!"
MM-mm MM-mm Good! Cream of Spotted Owl soup!
MNP - Mighty Nice Piece at Fifi's House of Pleasure.
Mobius strippers never show you their back side.
Mock Frog! We use no artificial additives of any kind!
MODEM - Monumentally Overpriced Data Eating Machine.
Modem sex begins with a handshake.
Modem: A southern inquisition ------------ Modem hun?
Modem: Deterrent to receiving wanted and unwanted calls.
Modem: What landscapers do to dem lawns.
Modems.....reach out and BYTE someone!
Moderation always; but don't get carried away with it.
Moderation is a fatal thing. Nothing succeeds like excess
Moderator (n): see also GOD, Tyrant, Dictator, Oppressor
Modern Brequinda is concrete and Dragon Burger Bars.
Modern mother: "You never write, nor call, nor fax."
Modern poets mix too much water with their ink. -Goethe
Modesty becomes you. Try it more often.
Modesty died when false modesty was born.
Modesty is a good bait when fishing for praise.
Mom to picky child: "Just give peas a chance."
Mommy, why does that moon have a crack?
Monarchs in butterflights of migration.
Monastery: A home for unmarried Fathers.
Monday is the root of all evil.
Monday: The day after the football game.
Mondays are a rotten way to spend a seventh of your life.
Money can't buy happiness, but allows a choice of misery.
Money can't buy happiness, but it does quiet the nerves.
Money can't buy love, but it'll buy a 28.8k modem!
Money can't buy poverty, you have to earn it.
Money costs too much -- Lew Archer
Money is a good aphrodisiac. Flowers work almost as well.
Money is a lousy means of keeping score.
Money is always there but the pockets change.
Money is an aphrodisiac. Flowers work almost as well.
Money is an excellent servant, but a horrible master.
Money is like an arm or leg - use it or lose it.
Money is round, it rolls away.
MONEY IS THE ROOT OF ALL EVIL! Send $9.95 for info
Money is the root of all evil, and man needs roots.
Money is the root of all wealth.
Money is the sincerest form of flattery.
Money is the sinews of both love and war.
Money is truthful. Men who speak of honor must pay cash.
Money Isn't Everything - but is way ahead of 2nd place!
Money Isn't Everything. It Is The Only Thing.
Money Isn't Everything. (Just Kidding!)
Money isn't everything...but it keeps the kids in touch!
Money Not Found: Abort, Retry, break out Quicken?
Money talks - mine says "Goodbye"
Money talks, but credit has an echo.
Money Talks..... Mine says BUY BUY!
Money won't buy happiness, but it will get a dinner date.
Money won't buy happiness, but it's a great downpayment.
Money: A mint makes it first and we try to make it last.
Monologue: A conversation between realtor and prospect.
Monopolized cable service is all cable and no service.
Monotheism is a gift from the gods.
Moon Over Miami: using the can on Flight 243.
MoPar forever: God drives a HEMI
Morale is self-esteem in action.
Morality is a private and costly luxury.
Morbid - a slightly higher offer.
More Power! I need MORE POWER!!
More spice in a man's life usually doesn't mean nutmeg
More than a mouthful causes tongue sprain...
More than a state of mind, it's a way of life...
More than you wanted to know? Aren't you sorry you asked?
More troubles than a centipede with fallen arches.
Mosquito: Designed by God to make flies seem better.
Most "scientists" are bottle washers and button sorters.
Most allies must be watched just like the enemy.
Most babies do not dress for success.
Most bugs are real sons of glitches.
Most dangerous human error? Forgetting your goals.
Most dangerous thing in a combat zone: officer with a map
Most dangerous untruths? Truths moderately distorted.
Most family trees have several branches best forgotten.
Most free items find an eager waiting user.
Most great discoveries start with making a mistake.
Most important political office? Private Citizen.
Most of our future lies ahead.
Most of us don't sell out because nobody wants to buy.
Most of us hate to see a poor loser--or a rich winner.
Most people deserve each other. Forgive and remember.
Most people have trouble believing parents ever had sex.
Most people living on Earth were unhappy much of the time
Most people's lives are governed by telephone numbers.
Most political jokes get elected.
Most religions do not make men better, only warier.
Most weight lifters are biceptual.
Most wonderful ideas are so obvious that they're not.
Mother Earth is not flat!
Mother Nature erred: Leaves should fall up.
Mother nature is a bitch.
Mother said I hadn't oughta, so I stayed a virgin, sorta.
Mother's board, Dad's a UNIX.
Mother's Helper: What a child becomes when they want $.
Motherbored - 'Let's play some Nintendo, son!'
Mothers-in-law must drink goat's milk, always butting in.
Motto of the LAPD: "We Treat You Like A King!"
Mountain Climbers do it AAAAAAAAAGGGGGGGGGHhhhhhhhh!
Mountains culminate in peaks, and nations in people.
Mouse+mouse=mice. Therefore, Spouse+spouse=spice.
MOV POP, this hacker's gonna PUSH you into a home.
Move along people, there's nothing to see here.
Move your vowels every day or you'll get consonated.
Movement To Ban Silly Tag Lines; Send donations to:
Mr Worf! Do you intend to blast a hole in the viewscreen?
Mr. Bullfrog sez: Time is fun when you're having flies.
Mr. Crusher, try the caps lock.
Mr. Worf! Eating Christmas Cookies, on my bridge?
Mr. Worf, prepare to fire photon torpedoes...Oh, It's you
Mrs. Ghandi is in a sari state.
MS-DOS is CP/M on steroids.
MS-DOS....DR DOS' Sister.
MSDOS is a boot sector virus.
Mud slinging politicians clod their way to the top.
Multitasking = 3 PCs and a chair with wheels!
Multitasking = screwing up several things at once.
Multitasking causes schizophrenia.
Muppeteers do it under a table or back stage.
Muppeteers feel "warm fuzzies"
Muppeteers have warm hands.
Murphy is out there... waiting for YOU!!!
Murphy never had it so good.
Murphy was an optimist.
Murphy's Law is always a good excuse.
Murphy's law only fails when you try to demonstrate it.
Murphy's Law: If anything can go wrong, it will.
Mushroom Omelette: Breakfast of Champignons.
Music is the only sensual pleasure without vice.
Music with dinner is insulting both chef and violinist.
Musical encores: thank-you notes.
Musicians are just playin' folks.
Must Go - Its finally stopped raining in London
Must go - My attack cat needs her claws filed.
Must think of a tagline... think, think, KaThunk!
My 2 cents' worth, and priced just right!
My advice for youth? Youth doesn't take advice!
My best feature? I would say my overwhelming humility.
My best taglines are in for repair! This one's a loaner.
My biggest regret is that I spent so much time regretting
My blood type? Why, Folgers, of course!
My bologna has a first name, it's O-S-C-A-R.
My boss is going places. The sooner the better.
My brain is my second favorite organ.
My brain operation was considered minor surgery.
My brain's not crippled, it's functionally challenged.
My brother is with the FBI. They caught him last week.
My capacity for happiness could fit in a full matchbox.
My cat walks all over me!
My compiler has a first name, it's Q.U.I.C.K.
My components are indiscreet.
My computer can beat up your computer.
My computer even came with a driver's side air bag.
My computer has a loose nut on the keyboard.
My computer has EMS.... Please help!
My computer has the dreaded "Not Enough Memory" virus!
My computer NEVER loc
My computer puts out.
My computer's sick. I think my modem is a carrier.
My cow aborted, now she is decalfinated.
My cow died, so I don't need your bull anymore.
My dad hit me only once - with the Buick.
My decision is *Maybe* and that's final.
My doctor says I need to get some blood in my alcohol.
My Dog ate my REP Packet!!!
My dog can lick your computer.
My dogs say "hi."
My ex-wife got the gold mine, but I got the shaft.
My family tree is in the forest, somewhere!
My foot is asleep so I am typing this very quietly.
My genes are so tight, they may stay with me forever.
My get up and go just got up and went...
My girlfriend's schizo. She's good people, but....
My Go this amn keyboar oesn't have any 's.
My God! A conference-related question!
My hard disk went on a diet and lost it's FAT.
My hat covers my head.... Just like hair used to!!
My haystack had no needle!
My kids have the toys their Dad wanted.
My last original thought died of loneliness.
My lawyer can beat up your lawyer.
My leg fell asleep... now it'll be up all night.
My life is but a box of wormgears.
My life is still in BETA test.
mY lINKAGE iS sTUCK iN rEVERSE.
My lucky star turned out to be a black hole.
My mail reader can beat up your mail reader.
My Maserati does 185. Lost my license, now I don't drive
My MD wrote an Rx for regular sex, but Blue Cross refused
My mind ain't so open that anything can crawl right in.
My mind is like a blotter: Soaks it up, gets it backwards
My mind. I can feel it. I can feel it going. Goodbye.
My mom has a glass eye, and my dad has a crystal ball!
MY money does talk -- it says "Goodbye".
My mother is NEVER on time! - Worf
My Mother loves ME! It's the computer she hates.
My Mother told me I'd have messages like this.
My Mother-In-Laws' "Other Car" Is A Broom !
My name is Jim, and I'm a tagaholic.
My name is SHORT, but I am tall, I am, I am, really...
My name is Taylor, but I don't know a needle from a pin.
My name seems to be "xxx-xx-xxxx" what's yours?
My name? Why, do you think I should have one?
My neighbor has a circular driveway. She can't get out.
My nipples explode with delight.
My only regret is dying and finding YOU here.
My opinion is based on real-life experience...
My opinions are not those of my ex-employer.
My opinions expressed above are not necessarily mine.
My Other Body's A Ten.
My other car is a Galaxy Class Starship, need a ride?
My other car is STARBUG 1.
My other computer is a Cadillac.
My other computer is a CRAY!
My other computer is a HAL 9000!
My other computer is an 805468972345876348786.
My other processor is a Moulinex
My OTHER tagline collection is funny.
My other tagline is a footnote.
My other tagline is a Porsche.
My other tagline's amusing!!
My other vehicle is a Galaxy Class Starship ...
My patience is like 7-Up: Never had it, never will.
My phone is Baroque--Please call Bach!
My planet was blown up, I didn't know about the party.
My poor mouse only has one ball.
My problem is an 8088 brain in a 80486 world.
My profession? Does the word "peon" mean anything to you
My radio is tuned to the voice of a star...
My reality check just bounced.
My reality check just pounced.
My reputation grows with every failure -- Shaw
My ship finally came in, and I was at the airport.
My ship finally came in, and now the dock's on fire.
My Starship runs on an Infinite Probability Warp Drive!
MY Sysop can beat up YOUR Sysop!
My systems are only programmed for one at a time. ■ Data
MY tag line is bigger than YOUR tag line!
My tagline is in the shop - this is a loaner
My taglines are original. I am a copy.
My tags are on strike. They're demanding more space!
My teeth aren't the sharpest in the world. ■ Ro
My time is come, my race run, I expect to come in last.
My train of thought is boarding at gates 5, 6 & 7
My trouble is that my absence makes good company.
My Twit Filter just put me on its Twit List!
My vote for "Tag Line of the Year" award!
My wallet's cache is disabled.
MY WAY is a long and winding road.
My widget is better than yours simply because it's MINE.
My wife is a computer widow.
My wife made me join a bridge club. I jump off Tuesday.
My wife stays young because she uses Oil of Delay...
My wife's latest car is an "E" type broomstick.
mY φτ╫Σr MÖdΣm |s à sTr|ⁿg and a τ|n (an
Myself, I'd trust him to the end of the Earth.
Mystery of GOVT: Not how it works; how to make it stop.
Myth-conceptions are the major cause of wars!
Mythology: Invented lies for future consumption.
Nagagator: map-reading back-seat driver.
NAGLINE "Eat your liver or you won't get any dessert."
NAGLINE "Make sure you wash behind your ears."
NAGLINE "Put on a sweater before you catch a cold."
NAGLINE "Wash your hands. Who knows where they've been"
NAK NAK who's there? ╣▄@)╜$╫Eâ. NO CARRIER
NAK NAK... Who's there?
Nam homo proponit, sed Deus disponit.
Name for a topless bathing suit: "Two for the show?"
Name:│║▐║│║│█│║▌│║▌││ Rank:▐║│║█│║▌│ Serial
No:│║▐║│║│█│
Nao existe caminhada, existe caminhante.
NASA (Space Administration)........Jerry Brown
Natural laws can't be modified or legislated.
Natural laws have no pity.
Nature abhors a hero.
Nature always sides with the hidden flaw.
Nature sides with the hidden flaw.
Nature, like people, sometimes weeps for gladness.
Navel Lint... Belly Button Offspring
NAVY: Never Again Volunteer Yourself
NBC: The Never Been Caught (Before) Network
Necessity is a mother.
Necessity is the mother of strange bedfellows.
Neckties: Easy directions to men's brains.
Need a new tagline? Call 1-900-TAG-GAGS! $3/minute
Need hubcaps? Try Midnight Auto Supply.
Need more getup and go? Eat prunes.
Needs are a function of what other people have.
Neewbes - A bit of new blood in an old thread * Dracula
Neither warp nor wooft alone suffice; but together....
Nepotism is fine as long as you keep it in the family.
Nervous as long tailed cat in roomful of rocking chairs.
Nervous: Asking what wine goes well with fingernails.
Net-mail - The real Qwk'er picker-upper!
Network Administrators thumbing nodes at each other...
Network management is like trying to herd cats.
Network? I'm retired, I don't do no work never.
Networks - computing method of shared blame.
Neurosis is a communicable disease.
Neutrality favors the oppressor - Bishop Desmond Tutu
Neutrality pays when your wife and mother-in-law argue.
Neutrinos are into physicists.
Neutrinos have bad breadth.
Nevada is the NV of the nation
Never accept a drink from a urologist.
Never agree with me, it shakes my self confidence.
Never apologize, never explain. -Churchill
Never appeal to his better nature. He may not have one.
Never argue with a fool, others might not know who is who
Never Argue With a Skunk, Mule, Woman or SYSOP!!
NEVER ask a barber if you need a haircut.
Never assume villainy when mere incompetence suffices.
Never attribute to malice what is explained by stupidity.
Never be led astray onto the path of virtue.
Never believe anything unless it's been officially denied
Never believe in miracles, simply depend upon them.
Never believe what you hear, and less of what you think.
Never borrow trouble, the interest is entirely too high.
Never buy a software package bigger than your head.
Never call a man a fool; borrow from him.
Never complain.
Never confuse a motion with an action. Apples & Oranges.
Never confuse endurance with hospitality.
Never confuse moving fast with going somewhere.
Never confuse public opinion with public sentiment.
Never cut down an Ironwood Tree to build your life raft.
Never deprive someone of hope, it may be all they have.
Never do anything twice that you don't have to do at all.
Never do today what you can delegate tomorrow.
Never do today what you can put off until tomorrow.
Never do tomorrow what you can put off today
Never drink and derive.
Never drink from your finger bowl, it contains only water
Never eat anything larger than your head.
Never eat at a place called Mom's.
Never eat more than you can lift.
Never eat prunes when you're famished.
Never eat the last cookie.
Never encourage someone to become a lawyer.
Never enough time, unless you're serving it.
Never exaggerate.
Never fish in the sea of life without bait.
Never forget that clones are people two.
Never forget: 2 + 2 = 5 for extremely large values of 2.
Never give anyone a fruitcake.
Never give up on anybody. Miracles happen every day.
Never go to a doctor whose office plants have died.
Never go to bed mad. Stay up and fight!
Never go to bed with anybody crazier than you are.
Never have children, but always have grandchildren.
Never hit a man with glasses. Use your fist.
Never interrupt when you're being flattered.
Never invest in anything that eats or needs painting.
Never invite newlyweds to a come-as-you-are party.
Never judge a man by his taglines.
Never kiss anything that doesn't have lips!
Never lean forward to push an invisible object.
Never let mechanical devices know you're in a hurry.
Never let your feet run faster than your shoes.
Never lick a gift horse in the mouth.
Never look behind you. Something may be gaining.
Never Major in Minor things.
Never mention being on a diet.
Never mind the dog, beware of the owner & fecal deposits.
Never mind the facts - I know what I know
Never mind the star, get those damn camels off my lawn
Never mind, Rome wasn't burned in a day.
Never miss a good opportunity to shut your face.
Never moon a werewolf.
Never park your hard disk in a tow-away zone.
Never pay for work before it's completed.
Never play leapfrog with a unicorn.
Never program and drink beer at the same time.
Never put off 'til tomorrow what you can avoid altogether
Never put off till tomorrow what you can ignore entirely.
Never refuse homemade brownies.
Never say "oops."
Never say anything bad about another person's dog.
Never say never; say 'highly unlikely' instead.
Never say, "I'm game", at a meeting of the NRA
Never settle for less than your best.
Never share a foxhole with a Hero.
Never sleep with anyone crazier than yourself.
Never stand between a fire hydrant and a dog.
Never stand near a sneezing dragon.
Never take action when you're angry.
Never tell a lie, unless lying is your strongest point.
Never tell people everything you know.
Never tell them what you wouldn't want to do.
Never test for a condition you don't know how to handle.
Never test for an error you don't know how to handle.
Never think of the future. It comes too soon regardless.
Never time to do it right, but always time to do it over.
Never trust a candidate whose lips are moving.
Never trust a junkie.......Especially a BBS one...
Never trust a person who says, "Trust Me"....
Never trust a pit bull.... even one named "Fluffy"
Never trust a politician whose lips are moving.
Never trust a salesman whose lips are moving.
Never trust a skinny cook.
Never trust a smiling wolf to tend your sheep.
Never trust anyone who speaks well of everyone.
Never try this stunt on your own PC.
Never try to out stubborn a cat.
Never underestimate the power of forgiveness.
Never underestimate the power of human stupidity.
Never underestimate the power of soup.
Never use a preposition to end a sentence with.
Never use a tool that's more intelligent than you are.
Never volunteer.
Never walk out on a quarrel with your wife.
Never waste a fair right on your social inferior.
Never wear a Big Mac suit while next to George Foreman.
Never, never, never *MOON* a werewolf.
New book: Do's and Don'ts for a Hormonious Honeymoon.
New Disney club for kids: M-I-C-K-E-Y, M-O-D-E-M
New Documentary: Nancy Allen A Day's Work
New from Kytel Records: HOOKED ON TAGLINES
New Highway gets Railroaded.
New LAPD Motto: We treat you like a King.
New Mail not found! Start whine/pout sequence? [y/n]
New Product: Preparation A - for Asteroids sufferers.
New strain of system-trashing virus : WINDOWS
New tagline. Please read the instructions.
New Technology Is Always Priced Just Beyond Your Budget
New York City artist: Yankee Doodle Dandy.
NEW! The Fart Book; complete with scratch and sniff $4.95
Newborn: hamster-like with fewer signs of intelligence.
Newest Storage: A WORN disk. (Write Once..Read Never).
NEWSFLASH! Energizer Bunny arrested, charged with battery
Newt: a small semi-aquatic salamander.
Newton - Gravity Tour '92
Next on GERALDO: Mice, Mouses or just plain RODENTS?
Next time you wave at me use more than one finger.
Next time you wave, use ALL of your fingers!!
Nice computers don't crash.
Nice computers don't go down.
Nickel: Once good for getting the wrong number with.
Nietzche is pietzche, but Sartre is smartre.
Nietzsche is pietzsche, Goethe is murder.
Night of the Living Dead - Nocturnal BBSr!
Nihilism should commence with oneself.
Ninety percent of everything will prove to be plain crap.
Nirvana smells funny...
Nitrate - lower than the day rate.
Nitrate: The motel rate for a stay of more than two hours
Nixon "When the President does it, it's not illegal"
No amount of careful planning will ever replace dumb luck
No answer is also an answer.
No bachelor files for divorce after a home-cooked meal.
No battle plan ever survives contact with the enemy.
No Commander, I meant the OTHER battleship.
No comment.
No condo, no MBA, no BMW, no 486, no clever tagline.
No decorations necessary.
No dolphins. All gone. Vanished.
No door, but if we waited someone would build one.
No facts are sacred, none are profane.
No generalization is wholly true, not even this one.
No Hillary! THAT RED BUTTON'S NOT FOR ROOM SERVICE!!!
No job is too simple nor too small to make a mess out of.
No life grows great until it is dedicated, disciplined.
No light, but rather darkness visible -- Milton
No man can serve two masters, yes-men can serve hundreds.
No man has a good enough memory to make a successful liar
No man is lonely while eating spaghetti.
No man is useless. He can always serve as a bad example.
No matter how cynical you get, it's impossible to keep up
No matter how large that drive is, it'll never be enough.
No matter what goes wrong, someone knew it would.
No matter where you go -- there you are!
No medicine can cure a vulgar person.
No more police taxes, make 911, a 900 number?
No need to be leading to have the courage to go ahead.
No New Mail. Leave threatening message for SysOp? (Y/n)
No one can sincerely help another without helping himself.
No one can take advantage of you without your permission.
No one can think clearly with clenched fists.
No one does as much harm as one going about doing good.
No one else pays attention to you, so why should I?
NO ONE expects the Monty Python Conference!
No one gets a change of scenery except the lead dog.
No one is an expert in all things.
No one is so happy or sad as he imagines.
No One Is Ugly After 2 AM
No one should hide their true self behind a false face.
No one should test the depth of a river with both feet.
No parking in the red zone.
No Parking...Prosecutors will be Violated
No person ever became wicked all at once.
No person is lonely while eating spaghetti.
No person should govern another without their permission.
No problem is so formidable that you can't just walk away
No Purchase Required. Details Inside Package.
No quarter asked, no change given.
No reason for it; it's just my policy
No region can include itself as well -- Whitehead
No sane man will dance.
NO SCOTTY!!!! I said "beam me a BROAD!"
No sense being pessimistic. It wouldn't work anyway.
No sense of humor? You probably have no sense at all.
No sentence fragments.
No sEx CaUses DistOrted VisIon
No story. Last year's news. Forget 'em. They're gone.
No tagline today -- can't think of anything witty.
No taglines allowed
No tax collector will ever enter the Kingdom of Heaven.
No thanks, I already have a nagila.
No wanna work! Wanna bang on keyboard!
No way, Dude!
No woman should imitate men. Men are not worth it.
No wonder can last more than three days.
No! to a 4 year old means, "Not while I'm looking."
No, boars are never chauvinists.
No, I don't have a habit. I only read 8 packets a day!
No, I don't know what "apathy" means, nor do I care.
No, I haven't lost my mind... it's backed up on tape...
No, I'm from Iowa. I only work in Outer Space.
No, I'm not an elitist. Why do you ask, peasant?
No, I'm NOT an Extended Character.
No, I'm not grouchy. For a hermit, I'm really congenial.
No, I'm not just another extended character.
No, no--the message is up there!
No, Q, I meant a BUD light!
No, Taco Bell is not the Mexican telephone company.
No,son, you can't split the atom with a penknifNO CARRIER
No. Go away. I'm only practicing.
Noah might have saved dinosaurs with Zip instead of Arc.
Noah saved all the animals from the flood by arcing them.
Noah saved animals from the flood by arcing them!
Noah! Come quick! There's water in the basement!
Noble deeds that are concealed are most esteemed.
Nobody can be as agreeable as an uninvited guest.
Nobody can be just like me. Even I have trouble.
Nobody else knows what to do either.
Nobody ever bet too much on a winning horse.
Nobody ever bets enough on the winning horse.
Nobody ever goes there, it's too crowded.
NOBODY expects the Spanish Inquisition!
Nobody has ever learned all of WordPerfect.
Nobody home but the lights, and they're out too.
Nobody in personal ads is ever "average-looking."
Nobody is as deaf as those who will not to hear.
Nobody knows the truffles I've seen.
Nobody likes crazy people, but crazy people like me.
Nobody notices when things go right.
Nobody roots for Goliath.
Nobody shoots at Santa Claus.
Nobody's seen it all.
Node: Was aware of. The past tense of "know."
Nominee for Court Jester: Jesse Jackson
Non omnia possumus omnes.
Non-fiction often is more unrealistic than fiction.
Nondeterminism means never having to say you are wrong.
None are so fond of secrets as those who won't keep them
None but a mule denies his genealogy.
None Of You Exist! My Sysop Types All Of This In!
None of you exists, Charles types all this in!
None of you exists, my sysop types all this in!
Nonsense, no man I know can do it that way. ■ O'Brien
Normal is not enough.
Normal people are the ones you don't know very well.
Northern Exposure: Watch out for the frostbite!
Nos micturate te salutamus.
NOSTALGIA isn't what it used to be!
Nostalgia was much better in the good old days.
Nostrildamus Nose the Future.
Not a computer nerd; merely a techno-weinie
Not a real tagline, but an incredible soy substitute!
Not a slob; a victim of a dysfuntional wastebasket.
Not all bugs are worth fixing.
Not bad for a board that sometimes works...
Not breaking the rules, just testing the elasticity...
Not enough disk space? Just use: Assign C = A Format A:
Not every surrender is to an enemy.
Not everything in life is funny. - R.L. Asprin
Not everything more difficult is more meritorious.
Not everything that counts can be counted.
Not getting enough? See if SEX.COM is off-line.
Not in this lifetime!
Not many people live in Montana--it's almost MT
Not me! I have witnesses (the best money can buy, too)!
Not now ... I have to go mow the laundry.
Not now Honey, I'm on the air.
Not now, I'm having an attitude adjustment.
Not now, I've got a headache.
Not Ready Error reading user's mind.
Not to know is bad, but not to wish to know is worse.
Not tonight honey..I have a modem.
Not tonight, dear, I just changed the sheets.
Not tonight, dear, I'm too depressed.
Not tonight, dear, I'm too full.
Not tonight, dear, I'm too tired.
Not tonight, dear, I've got a headache
Not tonight, dear, I've got to get up early tomorrow.
Not tonight, dear, it's that time of the month.
Not tonight, dear, you won't respect me tomorrow.
Not tonight, dear. I have a modem.
Not tonight, hon. I have a headcrash.
Not very flattering, is it?
Not when the only female here is my Daughter.
Nothing ain't worth nothing, but it's free!
Nothing astonishes like common sense and plain dealing.
Nothing better to do?
Nothing can be made foolproof, fools are too ingenious.
Nothing can go wrong...go wrong...go wro*%$@# NO CARRIER.
Nothing ever gets built on schedule or within budget.
Nothing improves with age, look at you for example...
Nothing in this world is certain but DOS and taxes.
Nothing irritates women more than a happy bachelor!
Nothing is 100% certain, bug free or IBM compatible.
Nothing is as easy as it looks.
Nothing is as inevitable as a mistake whose time has come
Nothing is ever constant, unless it is dead.
Nothing is ever foolproof. They are always so ingenious.
Nothing is fool-proof to a sufficiently talented fool.
Nothing is foolproof because fools are so ingenious.
Nothing is foolproof, idiots are too ingenious.
Nothing is impossible for he who doesn't have to do it.
Nothing is impossible for someone impervious to reason.
Nothing is impossible for those who don't have to do it.
Nothing is interesting if you're not interested.
Nothing is lost forever, except the Cathedral of Chalesm.
Nothing is more believed as that known least by the most.
Nothing is so good that somebody will not hate it.
Nothing is so rare as a person you can put up with.
Nothing is so simple that it can't get screwed up.
Nothing is so smiple that it can't get screwed up.
Nothing is true, everything is permitted.
Nothing is very funny when you're underneath.
Nothing is worth more than this day. --Goethe
Nothing is wrong with you that reincarnation can't cure.
Nothing matters very much, and few things matter at all
Nothing really obnoxious ever totally disappears.
Nothing recedes like success.
Nothing spells LOVE better than 6 hours of screaming sex.
Nothing succeeds like failure.
Nothing works, and nobody cares.
Nothing wrong with my memory - my forgetter's better!
Nothing's as good as a good yawn, with a good stretch.
Nothing's as good as a parking meter with 10 min left.
Nothing's as good as a reachable itch.
Nothing's as good as being a pound lighter on the scales.
Nothing's as good as hearing oneself quoted.
Nothing's more dangerous than a mind with a solitary idea
Nothing's too good for you, so that's what I'm getting yo
NOTICE! All incoming fire has the right of way.
Notice!! Executive Error, Starting Sysop Erasure
Notice: All incoming fire has the right of way.
Nouvelle cuisine shows more on the bill, than the plate.
Now *that's* impressive!
Now and then an honest person goes into politics.
Now and then an innocent man is sent to the legislature.
Now entering the 80XXX echo...(Some assembly required).
Now I am the first to appreciate a joke.
Now I lay me down to sleep, try to count electric sheep.
Now I would say that that was also a very curious event.
Now is the time for all good men to come to.
Now is the Winter of our Disk's Content.
Now may be an excellent time to become a missing person.
Now on CD ROM, classic taglines of the computer era.
Now really!
Now serving number 4!!! Number 4!!!!!!!!!!!!
Now that I've given up hope I feel much better...
Now that I've screwed this thing up, what do we do?
Now that Superman's dead, do we need the kryptonite?
Now where can you find one, nicer than this?
Now where did I park my hard drive?
Now where did I put that fire extinguisher?
Now why didn't I label my diskettes?
Now you don't REALLY expect an answer to that, do you?
Now, did you want 5 minutes or the full half hour?
Now, if you ran Windows...had a 486...had money...
Now, now, we're not schizophrenic, am I?
Now, what were you saying, peasant?
Now, witness the power of this FULLY operational Tagline!
NOW, you can press the other key to continue...
Now... where did I park that hard disk?
Nowadays even some illiterates can read and write.
California has its faults.
It's Not What You Know, But Who You Know.
Never underestimate the power of human stupidity.
Nuclear medicine - medicine practiced at 3-Mile Island.
Nuclear submarine's major problem: Whale mating season.
Nuclear Weapons: May they rust in peace.
Nude cooks should wear aprons when frying bacon.
Nudists are people who wear one-button shirts.
Nudists are people who wear one-button suits.
Nudists wear drip-dry suits.
Null modems were created when God got no handshake.
Number of phone rings = number of steps from toilet -1
Numbers justify math teachers' existence.
Numbers on restaurant checks do not follow math laws
Nurse! I said: "SLIP off his SPECtacles!"
Nursery rhyme in computer puts a farmer in the DELL.
Nuther Bryalunt Minde Distoryed By Publik Educashun.
NY would you live in New York?
O lente, lente, currite noctis equi
O oysters come and walk with us, the walrus did beseech.
O'Toole's Comment on Murphy's Law: Murphy was an optimist
O'Toole's Commentary: Murphy was an optimist.
Oatbran can cause cereal output errors.
Obesity: A surplus gone to waist.
Objection your honour! It's lunch time.
Objects are closer than they appear...
Objects fall so as to do the most damage.
Objects in taglines are closer than they appear.
OBLIGATO -- being forced to practice the piano.
Obligatory sneering reference to something French!
Obscenity exists to shock the elderly.
Obscenity is whatever gives a judge an erection.
Obsession? Obsession with what? Oh..... this thing...
October, when greens turn brown and tans pale.
October; When trees change from hirsuties to bald pates.
Of all forms of caution, cautious love is the most fatal.
Of all the people I have met, you are certainly one.
Of all the things I lost I miss my mind the most.
Of all thirty-six alternatives, ignoring it is best.
Of all thirty-six alternatives, running away is best.
Of all wild beasts, a boy is the most difficult to tame.
Of course I can cook, but I never do it on the first date
Of course I have proof aliens are among us. Look at Unix!
Of course I tessssted it.
Of course I'm running Windows█δ╓°┬ NO CARRIER
Of course I'm telling the truth! Would I Shih Tzu?
Of course it's a dog...would I Shih Tzu?
Of course, I had my own personal alchemist too.
Of course, Natalie Wood not do anything like that!
Of course, Shelley Winters at Palm Springs.
Of course, we could always get a sump pump.
Off by CRASHING COMPUTER. Time Logged: ^D!@#$%^(*&^%^Z.
Off to tag another one...
OFF-line mail make sysops happy.
Officer I couldn't have been doing more than 600 watts.
Official LAPD Bat Boy.
Official Tagline of Major League Baseball
Often it is fatal to live too long.
Often the test of courage is not to die but to live.
Oh captain! my captain! our fearful trip is done.
Oh could I fly, I'd fly with thee.
Oh dear, reality seems to be on the blink again.
OH NO! Not YOU again!
Oh no! Not another expensive update.
Oh no, not deja-vu again. Oh no, not deja-vu again. Oh no
Oh no.... I've been OBE, AGAIN!
Oh people who wait in the shadow of Deep Thought...
Oh Tasha, See Me, Feel Me, Touch Me!
Oh that? I was playing leap frog with a unicorn.
Oh very clever Worf, eat any good books lately?
Oh war. Thou son of Hell.
Oh well, half of one, six dozen of the other.
Oh what a tangled FAT we weave, when we FUBAR Interleave.
Oh Ye of little faith...
Oh yeah? Beta test this.
Oh! I almost forgot! It's absolutely VITAL to plan ahea
Oh! I thought you were asking about my work ETHNIC...
Oh! Pinprick wasn't meant to refer to your...
OH!! BOY!!! LOOOOOK!!!! I'm Pointing at you!
Oh, excuse me, but my Vogon space cruiser is here. Bye!
Oh, I'm sorry, was that your hard drive.
Oh, just look for flying saucers.
Oh, my ears and whiskers, how late it's getting!
Oh, no! Not another learning experience!
Oh, pardon me, was that *your* culture? So sorry.
Oh, Picard, I will enjoy you morning, noon and night!
Oh, thanks! I guess I'm SOL!
Oh, that Santraginean seawater.
Oh, those Santraginean fish.
Oh, well... never mind!
Oh, what a tangled web we weave -Hair Club For Men.
Oh, yes, my lovely, I've longed to hear you say that.
Oh, you're no fun anymore!!
Oh,the difference between nearly right and exactly right
OK I got the new release, Now when's the next one?
OK kids, looks like we're on our way.
OK Scotty, NOW! Detonate and energize! I mean.......
Ok! I'm weird, but I'm saving up to become eccentric.
OK! OK! I lied! I am not ordinary!
OK! OK!, I'll TALK, just call your tagline off!
Ok, how about a program to calculate the speed of darkness
OK, I'm weird! But I'm saving up to be eccentric.
Ok, let yourself go, as long as you can let yourself back
Ok, now for a quick backu^L+b&2PO^1+=.
OK, so I'm wierd.... but I'm saving up to be eccentric.
Ok...We'll try again....
Okay - right after this one we're BACK to the TOPIC!
Okay -- NOW you can panic!
Okay Okay - right after this one we're BACK to the TOPIC!
Okay, I'm crazy! But I'm saving up to be eccentric.
Okay. When I count to three, everybody smile!
Old age & treachery triumph over youth & vigor.
Old age and treachery will beat youth and enthusiasm.
Old age is a disease without a cure.
Old age is not for sissies.
Old age isn't so bad when you consider the alternative.
Old baggage handlers never die; just lose their grip.
Old bakers never die, they just quit making dough.
Old biddies never sigh, they just pine away.
Old birds are hard to pluck.
Old card players never die; they just shuffle off.
Old computers make great boat anchors.
Old enough to know better...young enough not to care.
Old fashion designers never die; they just fad away.
Old florists never die; they make other arrangements.
Old fools usually started as young fools.
Old frogs never die, but they do croak!
Old Grandad is dead, but his spirit lives on.
Old Hippies don't die, they get just get haircuts
Old is a state of mind - mostly denial!!!!!!
Old lawyers never die; they just make another appeal.
Old MacDonald had a computer, with EIE I/O
Old musicians never die -- they decompose.
Old musicians never die, they just decompose.
Old plumbers never die; they just go to the minor leaks.
Old programmers never die, they just lose their byte.
Old programmers never die. They branch to a new address.
Old psychologists never die; they're forever Jung.
Old quarterbacks never die - they just pass away.
Old sitcoms never die, they go to syndication.
Old Skiers never die. They just go downhill.
Old soldiers never die - young ones do.
Old soldiers never die, they just fade away..
Old trellis knitting a sweater of roses.
Older than dirt but filled with young ideas.
On a clear disk you can seek forever
On a quiet night, you can listen forever and hear nothing
On all lasergrams: Don't forget the Zap code.
On earth as it is in San Francisco
On no account let a Vogon read poetry to you.
On the batting end of a no-hitter.
On the other hand, you have different fingers.
On the other hand... you have five different fingers.
On the stage, dying is easy, comedy is difficult.
On the Train of thought, 99% are riding for half fare!
On the whole history tends to be rather poor fiction.
On this BBS, we recycle all of our bytes, bit by bit.
Once a king always a king, but once a knight isn't enough
Once a Programmer, Always A Programmer!
Once declared, resolutions are subject to criticism.
Once more into the breach.
Once Upon A Time, In A Galaxy Parked By The Bay...
Once upon a time, in your wildest dreams...
Once uttered, words run faster than the horses I bet on.
Once you understand your computer it is obsolete.
Once you've defined your goal, write it down.
Once, adv.: Enough.
One B-2 bomber = 30,000 4-year college educations.
One bit short of a byte.
One Buchanan beats a Bush hiding a Quayle any day.
One crow will not peck out another crow's eyes.
One day I'm a windshield, the next day a bug thereon.
One family builds a wall, two families enjoy it.
One good turn gets all the blankets!
One good turn gets most of the blanket on a cold night.
One good turn gets most of the blanket.
One horse can run faster than another. But which one?
One Is Seldom Criticized For A Closed Mouth.
One Klingon Flea to another...Meet you on the next ridge.
One lie always leads to another almost automatically.
One loss doesn't make a season.
One man tells a falsehood, a hundred repeat it as true.
One man's "magic" is another man's engineering.
One man's folly is another man's wife.
One man's meat is another man's poison...
One man's Sushi is another man's Bait.
One man's theology is another man's belly laugh.
One Man's Trash Is Another Man's Treasure
One man's Windows are another man's walls.
One night ain't no love affair.
One of his heads is now saner than an emu on acid.
One Of The Joys Of Travel Is Meeting New People. G. Khan
One of the most common of all diseases is diagnosis.
One of these days, Alice, one of these days.
One person's <grin> is another's <groan>.
One person's bug is another person's feature.
One person's theology is another person's belly laugh.
One should never spoil a good theory by explaining it
One thing about pain: it proves you're alive.
One way to better your lot is to do a lot better...
One way to stop a run away horse is to bet on him.
One who is always in a stew generally goes to pot.
One who is in peril thinks with their legs.
One's needs are a function of what other people have.
One's never alone with a rubber duck.
Onion ring to rule them all, onion ring to bind them.
Only a doctor suffers from good health.
Only a mediocre person is always at his best.
Only a mediocre person is ever at their best.
Only a sick mind could like this tagline.
Only a Vogon is uglier than a Vogon ship
Only adults have difficulty with childproof caps.
Only DaVinci knows why Mona Lisa smiled.
Only Dead fish swim WITH the stream...
Only female mosquitoes bite.
Only fools make technology a master instead of a servant.
Only fools read taglines.
Only God can make a random selection.
Only he attempting the absurd can achieve the impossible.
Only I can tell where my own shoe pinches me.
Only in baseball is a self-sacrifice appreciated.
Only in your dreams are you really free.
Only in your dreams, Commander. ■ Troi
Only lemmings jump to conclusions.
Only one man stood and watched the sky.
Only people born with chimneys are allowed to smoke.
Only Sky Divers know why Birds sing!
Only the ephemeral is of lasting value -- Ionesco
Only the hand able to erase can write the truth.
Only the insane take themselves Quite So Seriously.
Only the lead dog sees the scenery change.
Only the lucky find life is two steps forward, one back.
Only the mediocre are always at their best.
Only the mediocre are at their best all the time
Only the rich have distant relatives.
Only the stupidest calves chose their own butcher.
Only the US Post Office wins in these sweepstakes
Only they can conquer who believe they can.
Only those with brains need wear safety helmets
Only XT users know that January 1, 1980 was a Tuesday.
Onward and backward! We must look busy.
Ooh eee ooh ah ah, ting tang walla walla bing bang!
Ooh, goodie! I hear the Nurse coming with another shot!
Ooo la la!
Ooops. My brain just hit another bad sector.
Oops.. I forgot all about the Amnesia Conference!!
Open it up and what have you got: Bibbity, Bobbity BOOOO.
Open mouth, insert foot, echo internationally.
Open mouth, insert foot, echo stupidity internationally.
OPEN SEASON ON NET GREMLINS DECLARED (BAG YOUR LIMIT!)
Open the door, Richard!
Open the Pod Bay doors Hal.
Open Windows let the bugs in.
OPERATOR ERROR: Nyah, Nyah, Nyah, Nyah, Nyah!
OPERATOR! Trace this call and tell me where I am.
OPINION: Where "moderation" means "attack."
Opinions are like noses, almost everybody has one.
Opinions are like rear ends, everybody's got one.
Opinions expressed here or there are not necessarily mine
Opportunities taken are what makes your future.
Opportunity always knocks at the least opportune moment.
Opportunity does not beckon with beepers and billboards.
Opportunity knocked...and I was in the shower.
Opportunity knocks once - the neighbors rest of the time.
Opposing action systems do not execute simultaneously.
Optimism is an intellectual choice.
Optimist: one who imagines the future is uncertain.
Optimist: Someone who doesn't know all the facts yet.
Optimist: YUGO owner with a radar detector.
Optimists invent airplanes; pessimist invent parachutes
Optimization hinders evolution.
Orator: a two minute idea, a two hour vocabulary.
Ordinary citizens: People Without Clout
Oregon cellars contain more water than Texas rivers.
ORG.ASM not found. Girlfriend not happy...
Organic: Church music.
ORGASM.SYS not found. Should I fake it? (Y/N)`
Oriental housekeeper.....maid in Japan.
Original discoveries, seem so obvious afterwards.
Originality is the art of concealing your source.
Originality is undetected plagiarism.
Orthopedists get all the breaks.
OS/2 - The sane way to jump out of windows.
OS/2 = half an operating system.
OS/2 Version 2: Windows with bullet proof glass.
OS/2 VirusScan - "Windows found: Remove it? (Y/y)"
OS/2... Opens up Windows, shuts up Gates.
OS/2: Upgrades are free. Who would PAY for it anyway?
OS/2: What Windows will NEVER BE!
OS/2: Your Brain - Windows: Your brain on drugs.
Ostrich: He runs so fast he leaves his behind behind.
Other than it doesn't work, it works fantastic for me.
Other than penicillin do you take if you have everything?
Other than that, Jackie, how was the parade? - Dan Quayle
Other things change, but we start and end with family.
Other times, other customs.
OTOH, BTW, IMHO this is gibberish.
OUCH! I got my floppy caught in my PKZipper!
Our big cities are becoming Third World countries.
Our father who art in Redmond, hallowed be thy DOS
Our Father, UART in heaven, I/O'd be Thy name...
Our first and last love is self-love.
Our future is always uncertain our end is always too near
Our houseplants have a good sense of humus.
Our Lady of Blessed Acceleration, don't fail us now!
Our life is a trip between two eternities.
Our memories of yesterday will last a life time.
Our mission: To boldly stay home and watch TV.
Our national flower is the concrete cloverleaf.
Our necessities are few but our wants are endless...
Our O/S which art in CPU - UNIX be thy name .....
Our on-going mission: to boldly stay home and hack.
Our parents ruin our early lives, our children later.
Our program, who art in memory, EXE be thy name...
Our world: a 8000 mile in diameter spherical pile of dirt
Out of Body... back in 5 minutes.
Out of String Space - the Final Frontier.
Out of string space? Try Scotch Tape.
Out of the frying pan, into der fire. - The Swedish Chef.
Out of the mouths of babes comes whatever they just ate.
Out of the mouths of babes does often come cereal.
Outlaw junk mail, and save the trees!
Outpatient - a person who fainted in the doctor's office
Outpatient. A person who has fainted in the waiting room
Outside noisy, inside empty.
Over the river and through the woods? GIVE ME THAT MAP!
Overdrawn? But I still have checks left!
Overestimation: Thinking that all your geese are swans.
Oversexed people are more prone....
Overtip breakfast waitresses.
Ow. I believe I have overexerted myself.- Data
Oxymoron - an "honest politician"
Oxymoron: one who has used too much acne goo?
Oxymoron: Spending Cuts
Oxymorons... "military intelligence" and "tech support"!
Oxymorons... "postal service" and "tech support"!
Ozarks Social Attire: two shotguns and a jug of 'shine.
Pain -- Finally something we can depend on.
Pain is a part of all life. Misery is at your option.
Pain is just God's way of hurting you.
Pain of child birth; preview of things to come.
Pale ink beats a good memory.
Paleontology students dig up dirt on pre-history.
PANDORA.ZIP Warning! DO NOT unZip this file!
Pansy - someone who likes his vice versa.
Pants: Trousers' country cousins.
Paper clips are the larval stage of coat hangers...
Paper is always strongest at the perforations.
Paperless bathrooms - a step beyond the paperless office.
Paradigms: Shift Happens
Parallel processors share the task.
Paralyzed from the neck up.
Paranoia is heightened awareness.
Paranoia isn't as much fun as it used to be.
Paranoia: the feeling that a tagline is about you.
Paranoia: the feeling that this tagline is about you...
PARANOID - One who is really in touch with reality.
Pardon Me, But Would You Have Any Blue Poupon?
Pardon me, do you have any grey poop on?
Pardon me, I just regained consciousness.
Pardon my driving, I'm trying to reload on the move.
Pardon my driving, I'm trying to reload.
Parenting #1: You can't do everything right.
Parenting #2: It's futile to look back--or ahead.
Parenting #3: You're not always popular.
Parenting #4: You shouldn't take parenting too seriously
Parenting #5: All parents are disliked by their kids.
Parenting #6: Raising kids is a moment to moment affair.
Parenting #7: All parents fail at one time or another.
Parenting #8: There are times you should trust your kids
Parenting #9: You're only human, cut yourself some slack
Parenting: Feeding the mouth that bites you.
Parents of teens make great tight-rope artists.
Parents: One of the hardships of a minor's life.
Parking is such street sorrow.
PARODY ERROR: Can't Find File WEIRD_AL.EXE
Part curiosity, part adventure, mostly fame and money.
Part-time musicians are semiconductors.
Parts is parts.
Parts that cannot be assembled in improper order will be.
Parturient montes, nascetur ridiculus mus.
PASCAL is a French sex position involving cheese.
Pascal programmers do it with indentations.
Pascal: not Wirth a nickel.
Pass me the bowl of grated Arcturian Mega-Donkey.
Passing on curves: What a beauty-contest judge does.
Passionate kiss like spider web -- lead to undoing of fly
Passionate kiss, like spider web, leads to undoing of fly
Path = Wandering Considerably.
PATH=allthosedirectories
PATH=harddrive;drawer;desktop;pocket;boxincloset;boxunder
Pathology - the intense study of paths.
Patience is a virtue possessed by few men and no women.
Patience will come to he who waits for it.
Patience, great things are afoot.
PATIENCE-A Virtue That Carries A Lot Of Wait
Patience: A minor form of despair, disguised as a virtue.
Patience: A surfer sitting in Walden Pond.
Patience: What we prefer not to use.
Patriotism is always the last refuge for the scoundrel.
Patriotism is the virtue of the vicious.
Patriotism: willingness to kill/die for trivial reasons.
Paul Revere was a tattle-tale.
Paul said it is better to marry than burn, some wonder.
Pay attention! This is the mother of all taglines.
Pay lay vooh frazayh?
Pay no attention to that man behind the curtain!
PCBackup: 1 of 1362 disks.
PCDOS&MSDOS&CP/M&WINDOWSI'LLFIDDLEWITHOS/2WOULDN'TYOU
Pckd tgln, vwls nsrtd ltr.
PCs are OK except when you use them as bowling balls.
Peace is an extension of war by political means.
Pedestrian: The most approachable chap in the world.
Pedestrians come in two types: Quick or Dead.
Pedestrians: The Quick or the Dead.
Pee-Wee's favorite baseball team --> the Expos.
Peeking two-eyed through a keyhole takes a narrow mind.
Peeping Tom: In partial observer.
Penguin: The headwaiter of the Antarctic.
Pentagon Tagline: developed at only 2 Billion over budget
People are always available for work in the past tense.
People are the only creatures with the power of laughter.
People have one thing in common: they are all different.
People in the wrong talk louder than everyone else.
People of Earth, your attention please.
People on the go don't have time not to have time.
People say I'm apathetic, but I don't care.
People say I'm indecisive, but I'm not so sure.
People say I'm indecisive. Am I? I don't know.
People sweat so they won't catch fire when making love.
People think I'm insane because I frown all the time.
People who are sensible about love are incapable of it.
People who have trouble communicating should shut up.
People who live in glass houses should not throw stones.
People who live in glass houses...shouldn't
People who live in stone houses shouldn't throw glasses.
People who never get carried away should be.
People who sleep like a baby obviously don't have one.
People who stagnate rather than evolve are almost dead.
People who talk to themselves never learn anything.
People who want to rule are the least suited to do it.
People will act rationally only when all else fails.
People will believe anything - if you whisper it.
People will buy anything that's one to a customer.
People with dogs are too cowardly to bite for themselves.
People with narrow minds usually have broad tongues.
People wrestling with conscious go for 2 falls out of 3.
People! Can't live with em, Can't live without em!
People, by nature, are civic animals.
People, not dogs, sell their souls for money or power.
Pereant, inquit, qui ante nos nostra dixerunt.
Perfect! Absolutely perfect!
Perfection is the road, not the destination.
Perhaps a radiologist can find something of value in him?
Perhaps they're having their caves redecorated.
Perhaps we'd confuse him if we'd run away more....
Perhaps you should hold it to your ear.
Perhaps you thought of something and I didn't notice.
Perot/Bush/Quayle: The Millionaire, the Skipper & Gilligan
Perry Mason: Case of the ...
Person slow to anger is better than the mighty.
Person Unclear on the Concept
Personal friend of Elvis.
Persons reading between the lines do so at their own risk
Pessimism never won a battle.
Pessimist: Always right and gets no enjoyment from that.
Pessimist: one who no's too much.
Pessimist: One with a choice of two evils, chooses both.
Pet Store: Buy one, get one flea.
Peter Norton is the "Betty Crocker" of software!
Pets are not just for Christmas, but for a LIFETIME!!!!
Pets: pure love contained in soft packages.
Petty crime is the scourge of business today.
Phasers don't kill people... Unless you set them too high
Pheromone control, you have to generate the right smell.
Philosophic enjoyment = mutual misunderstanding.
Philosophy is to the real world as masturbation is to sex
Philosophy: A route leading from nowhere to nothing.
Phyllis Coates holiday ham with beer glaze.
Physics is experience, arranged in an economical order.
Physics shook its head and looked the other way.
Pi R squared. Nooooo, Pie R round, cornbread R square!
Piano tuners do it twice a year.
Picard to bridge, where am I?
Picard to Lwaxana: "Not THAT kind of 'Engage'!"
Pick pockets of America Unite! Call 1-800-4-USA IRS
Pick two ONLY: [1] Fast [2] Right [3] Cheap
Pick two: 1)Fast 2)Right 3)Cheap 4)Windows (counts as 2)
Pickup survey: Man says "Hi"-71%; Woman says "Hi"-100%
Picture if you will...
Pilots are just plane folks.
Pirata,eu? Näo! Sou apenas um distribuidor näo-autorizado
Pirates demand your money or your life; women expect both
Pity a donkey with a IQ of 138. Nobody likes a smart ass
Pity the meek, for they shall inherit the earth.
Pity the poor corpuscle, for he labors in vein.
Pkzip v. _._ will be released in the ___ qtr. of 19__!
Place all paint in the rear. Leave no stern untoned.
Plagiarism prohibited. Derive carefully.
Plagiarism is the best source of new ideas.
Plan a year in the spring, plan a day in the morning.
Plan for bad fortune while your fortune is good.
Plan to throw one away. You will anyhow.
Planned parenthood --- the impossible dream.
Plans have been available in the local planning office.
Plasma is another matter.
Play it, again Sam.
Played poker with Tarot cards. Got a flush. 5 people died
Plays solitaire... for cash.
Plea bargain: K-Mart justice that screws the public.
Please come back to Detroit, we missed you the first time
Please deposit $5 for the next three messages.
Please disregard the emergency message you got yesterday.
Please do not break character.
Please don't feed the typesetter.
Please don't steal my taglines until I perfect them.
Please don't touch the secretary's reproduction equipment
Please don't unzip here. I'm bashful; I'll probably laugh
Please don't yell at me. I'm new at this.
Please excuse my friend, he's having a nice day at last.
Please hold on.... I'm defragmenting my brain...
Please ignore previous fortune.
Please ignore previous tagline.
Please insert another quarter and try again.
Please let me know if you did not receive this.
Please make yourself at home -- do the dishes!
Please recycle this tagline. Once is not enough.
Please report all lost or stolen taglines to your Sysop.
Please restrict your taglines to good clean humor
Please return stewardess to original upright position.
Please return stewardess to the upright position.
Please save the above drivel for future reference.
Please take a number.
Please take my word for it.
Please take note:
Please tell me if you don't get this message.
Please think when you drink....
Please wait... Caller has exited to DOS...
Please wait... Sysop has exited to DOS...
Please, doctor, not while my wife is on board. ■ O'Brien
Please, forget that, I was just going to start eating.
PLEEEAASE don't squeeze the Limbaugh transcripts
Plop, plop, fizz, fizz, oh, what a relief it is.
Plumbers spend a lot of time working in dark, wet holes.
PMS - Periodic Monster Syndrome
PMS = Powerful Mood Swings
PMS = Punish My Spouse
Pobody's Nerfect
Podiatrist detective; there's something a foot.
Poetry is what Milton first saw after he went blind.
Poetry isn't obscene.......it's per verse!
Poets are rather silent on the subject of cheese.
POETS: Piss On Everything, Tomorrow's Saturday.
Point a finger of blame; you have 3 pointed at yourself!
Point at someone, you point three at yourself.
Point click point clic...guess my mouse isn't loaded.
Poke me with that one more time and I'll break it off!
Poker Face: The face that launched a thousand chips.
Poker: It's darkest just before you've drawn.
Polar Bears don't hunt Penguins. Why? Too far to swim...
Polaroids: what polar bears get from sitting on icecaps.
Poli(Many) Tic(Bloodsucker) Politics = Many Bloodsuckers
Police tagline. Do not cross
Polygamy: multi tasking wifestyle...
Politeness makes wrinkles smooth.
Politeness.........The most acceptable hypocrisy.
Political Correctness is a Borg plot.
Political correctness isn't.
Political savvy: Knowing which bribes to accept.
Politically correct tagline: [..............]
Politically incorrect and DAMNED proud of it!!!
Politically Incorrect and proud of it!
Politically incorrect, morally challenged, irreverent...
Politician: A living example of Artificial Intelligence.
Politicians and Criminals prefer unarmed victims.
Politicians fly the SST now, and all of us pay later.
Politicians have no morals, no vision, no ethics, no clue
Politicians profit by confusing theories with conditions.
Politics - "Poly" = many "ticks" = bloodsuckers
Politics is stealing from the many and giving to the few.
Politics is the entertainment branch of industry
Politics- The conduct of public affairs for private gain.
Politics: Passing the buck or passing the doe.
Politics: The glad hand and the marble heart.
Politics: the indifference of the majority.
Politics: When one makes a decision that involves others.
Polly Doesn't Want a Cracker... Polly Wantsa Finger!
Polymer physicists are into chains.
Pornography? I don't even own a pornograph.
Positive fantasies: Actively guiding your imagination.
Positive thinking: Believe everything positively stinks.
Positive: Being mistaken at the top of one's voice.
Post no bills.
Post-operative - a letter carrier.
Post-Operative: Fancy title for a letter carrier.
Postage not necessary if mailed within the United States.
Postmen never die, they just lose their zip.
Postscript: The only thing of interest in some letters.
Poverty can't buy happiness.
Poverty is the root of all evil.
Power attracts the corruptible.
Power corrupts. Absolute power is kinda neat.
Power is an illusion; only stupidity is real.
Practice good mirth control, use a conundrum.
Practice safe algebra, use brackets.
Practice safe eating. Use condiments.
Practice safe government, use kingdoms.
Practicing Misanthrope, Curmudgeon in Training
Practiss maks perfict.
Pragmatism should never be confused with moderation.
Praise the Lord and pass the ammunition!
Praise, if you don't swallow, can't hurt you.
Praise: valuable asset if you don't aim it at yourself.
Praise: What you receive when you are no longer alive.
Pray for the success of atheism.
Pray not for things, but for wisdom and courage.
Precinct toilets stolen. Police have nothing to go on.
Predestination was doomed from the start.
Preferred Customer at Diane's House of Pies.
Pregnancy is a side effect of sloppy birth control.
Prejudice is the reason of fools. Voltaire.
PRENUPTIAL AGREEMENT: an "I do" with an asterisk.
Present technology may permit history to have an end.
Preserve the old, but know the new.
Preserve wildlife....pickle a squirrel.
President of the Itty Bitty Tittie Committee!
Press "+" to see another tagline.
Press <Alt-A> to Adopt Me! I need a better home.
Press <CTRL>+<ALT>+<DEL> to continue.
Press <ESC> to load the BBS, or <ALT>+H for an IQ test.
Press all the keys at once to continue...
Press any key - i.e. the key with "ANY" on it.
Press any key to continue or any other key to give up.
Press any key to continue or any other key to quit
Press any key... NO! NOT THAT ONE!
Press END to achieve Nirvana.
Press F1 for hopelessly confusing gobbledygook.
Press [ESC] to detonate or any other key to explode .
Press ù┬Åñ≡ to abort self destruct sequence.
Pretend to spank me - I'm a pseudo-masochist.
Pretend you understand what's going on.
Pretending sleep is the most common birth control device.
Prevent computer viruses. Install Trojans!
Prevention is better than cure.
Price of admission - your premise.
Priests do it faithfully with Masses.
Prima doughnut: cruller worth singing about
PRIME DIRECTIVE, MY A**! Phasers on maximum!
Printers do it without wrinkling the sheets.
printf("to C or not to C...that is the question/n");
Prism: place for lightwaves that commit minor refractions
Pro golfers know that money grows on tees.
Pro is to con as progress is to Congress.
PRO: one who does best work when he doesn't feel like it
Probation: killing Time for criminals.
Problems precisely defined are already partially solved.
Procedure SaveMyJob(var Message:TPascalEcho);
Proceed with Caution - Twisted Mind Under Construction!
Processing endless loop - please wait.
Procrastination means never having to say you're sorry.
Procrastination: The art of keeping up with yesterday.
Prodigy: the "Bait and Switch" On-Line Shopping Network.
Prodigy: the SHUT UP AND SHOP!" On-Line Network.
Profanity...It's not just for Windows users anymore.
Program corrupted! Bribe it to continue.
Program Error: Unable to read user's mind!
Program in haste, debug in leisure.
Program too small to fit into memory.
Programa corrompido! Dê uma propina para continar.
Programmable Controllers Control Programmers
Programmer Dracula: 'I'll have a small byte, my dear.'
Programmer's Oxymoron: Spare-Time
Programmers are artists, too.
Programmers do it with their fingers.
Programmers don't repeat themselves, they LOOP
Programmers get overlaid.
Programmers get overlayed!
Programmers should never drink and derive.
Programming -- the art of reinventing the wheel.
Programming Department: Mistakes made while you wait.
Programming: The art of debugging a blank sheet of paper.
Programs will expand to fill available memory.
Progress is made on alternate Fridays.
Projects not worth doing, are not worth doing well.
Promises and performances vary with hopes and fears.
Proofread carefully to see if you any words out.
Proper witches ride brooms since nature abhors a vacuum.
Propri<HIC> propri<HIC> bartender...another drink!
Prosperity makes some friends and many enemies.
Prostenic Vogan Jeltz was not a pleasant sight.
Prostitute: Someone who sleeps using the Buddy System.
Protect your right to arm bears.
Protein - in favor of young people.
Protein: Supportive of young people.
Proverb: Nightgale that forgets song is hummingbird.
Presentez toujours le devant au monde.
Prune Juice --- it keeps you runnin'
Prune Juice. A warriors drink!
Prune: A plum that has seen better days.
Prunes give you a run for your money.
PS/2 it? PS/on it too.
Psst! Hey kid... wanna try a BBS? The first call is FREE!
Psst! Your .ZIP file is open.
Psychiatrists stay on your mind.
Psychiatry is the care of the id by the odd.
Psychic Con: You know where and when.
Psychic Convention cancelled due to unforeseen problems.
Psychic wanted, qualified person knows where to apply.
Psychoanalysis: makes simple people feel they're complex.
Psychoceramics: The study of crackpots.
Public opinion flourishes where there are no ideas.
Public Schools: The point of know return.
Pulled herself up by her garter straps.
Punctuality is the thief of time.
Puns are bad - but poetry is verse.
Pure drivel tends to drive away ordinary drivel.
Purranoia: the fear your cat is up to something.
Purring....Sound of a cat manufacturing cuteness.
Purring....the sound of a cat manufacturing cuteness.
Push any key. Then push the any other key.
Put all your begs in one ask-it...
Put it to the wall, Mr. LaForge. - Picard
Put lawyers on the ethics committee, for balance.
Put off procrastinating until a later time.
Put on your seatbelt. I wanna try something.
Put the cat out?? I didn't know it was burning!!
PUT THE COMPUTER DOWN, HONEY..I'm quitting NOW!
Put the phone down and serve the bloody customers.
Put your brain in gear before starting your mouth.
Put your hard drive to your ear. Can you hear the C: ?
Q-Tip: When a really powerful alien gives you advice.
Q: Did you ever fail as a parent? A: Every day.
Qagh -- it's not just for breakfast anymore!
QEMM: Quirky Expanded Memory Manager.
Quality is to be found in absolutely everything I due.
Quark, Quark, Quark (mating call of rare Quantum Duck)
Quarrels can't last long if fault is on one side only.
Quartermasters have two sizes--too large and too small.
QUAYLE.BAS:DECLARE SUB elevator (topFloor-1)
Quem ri por último, ou é tapado, ou näo entendeu a piada!
Questions, questions! Does it ever end?!
Quick! Close your mind!! Something might get in.
Quick! hand me that solar-powered flashlight.
Quick! Make a wish! It has a chance to come true.
Quick! Operator! Give me the number for 911!
Quick! Say something profound in 45 characters or le.
Quick, call a Witch Doctor. My witch is sick!
Quick, I need a tagline, let me steal yours.
Quick, press another key!
Quinn was aghast... as usual.
Quit BBSing; the wife and dog will be friendlier.
Quit while you are ahead.
Quit work and play for once.
Quit work at fire hydrant factory: no place to park.
Quit worrying about your health. It'll go away.
QUO: What Elmer Fudd calls a crow.
Quoted from Some More of God's Greatest Mistakes.
Quoted from the Celestial Home Care Omnibus.
Quoted from Where God Went Wrong.
Quoted from Who Is This God Person Anyway?
Quoth the Raven, Eat My Shorts.
Quoth the Raven: File Access DENIED, forevermore.
Québec bras...They don't lift, they only separate!
Qwkmail, within 30 minutes or your next message is free.
QWKmail: The Final Frontier.
R.I.P. -- He passed away peacefully, while on-line...
R.I.P. -- He passed away with his modem on...
R17 is not a fixed velocity, but it is clearly too fast.
Race Car spelled backwards is Race Car!
Racing for pink slips: doubled 386 vs 486 straight.
Racist leaders live off the fatheads of the land.
Radical: Anyone whose opinion differs from ours.
Radio Shack motto: We service what we sell... often.
Radioactive cats have 18 half-lives.
Radioactive halibut will make fission chips.
Radiologist - a doctor with an interest in radios.
Rainforest: a scarcity of animals a plethora of tourists.
Rainy days and automatic weapons always get me down.
Raise ducks for quack profit.
Raise your IQ-- eat gifted children.
Raising pet electric eels has lots of current popularity.
Raising your voice does not reinforce your argument.
RAM - real estate abused by programmers.
RAM = Rarely Adequate Memory
Ram charged over cliff; did not see ewe turn.
RAM CRAM - the Joy of TSRs.
RAM DISK is not an installation procedure
RAM: Rarely Adequate Memory
RAM: Really Anti-Money
RAMsom, what you pay to sloppy programmers.
Random numbers are too important to be left to chance.
Randomness scares; religion is used to explain randomness
Ransom demand will be met. Just return the coffee pot.
Rap is to music as Etch-A-Sketch is to art.
Rape?! No, let's call it "Assault with a friendly weapon"
Rational information in arguments not permitted here.
Rattlesnakes won't bite lawyers. Professional courtesy.
Reached beer d/l limit must u/l now
Read messages, not taglines.
Read my lips " No Nude Texans "
Read my lips. No more stolen taglines.
Read my lips. No New Faxes!
Read the Bill of Rights.
Read the docs? Wow, what a radical concept.
Read the instructions? Why? It seems to be working fi
Read the manual? Doesn't it come in automatic?
Read the Manual?!?! What a radical concept!
Read the MESSAGE! Not the TAG!
Reader not found, please notify tagline.
Reading with your eyes closed may help you understand.
README.DOC: last minute uh-ohs.
REAL cars send the power to the rear!
Real knowledge is knowing the extent of one's ignorance.
Real knowledge is to know the extent of your ignorance.
Real McCoy Miracle: a pregnant woman.
Real men *do* cry in real time and real space.
REAL men - Loggers - wipe their asses with spotted owls.
Real men don't snort mayonnaise.
Real Men use BASIC. C is for Unix.
Real men write self-modifying code.
Real programmers argue with system analysts on principle.
Real programmers can't read code while wearing a tie.
REAL Programmers Don't Write Games.
Real programmers drink Jolt Cola.
Real programmers drink Jolt!
Real programmers practice safe HEX.
Real programmers snort Taster's Choice.
Real programmers use COPY CON PROGRAM.EXE.
Real programmers use punched cards.
REAL programmers use undocumented DOS calls
REAL programmers write self-modifying code.
REAL SysOps disconnect the speakers.
Real Trekkers work out at the He's Dead Gym.
Real wealth is the kind that can only increase.
Reality does not exist - yet.
Reality has been suspended until further notice.
Reality has taken precedence over virtuality!
Reality is a constant intrusion on my dreams.
Reality is an illusion caused by an alcohol deficiency.
Reality is an illusion produced by alcohol deficiency.
Reality is an obstacle to hallucination.
Reality is for people who can't face science fiction.
Reality is for people who can't handle BBSing
Reality is for people who can't handle Star Trek.
Reality is for those that can't handle drugs.
Reality is good for you.... in small doses.
Reality is in the mind of the beholder...
Reality is something you must always rise above.
Reality is something you rise above.
Reality is the indefinite enumeration of objects.
REALITY IS THE LEADING CAUSE OF STRESS!
Reality stems from the line printer.
Reality sure has unknown dimensions.
Reality sure is big...
Reality, a fantasy gone wrong, dreadfully wrong!!!
Reality-O-Meter: [\.......] Hmmph! Thought so.
REALITY.SYS Corrupted: Re-boot universe? (Y/N/Q)
Reality: Crutch for people who can't read science fiction
Reality: Life without alcohol.
Reality: Only a concept and the home of the brave.
Reality=ugly; Imagination=shiny; Fantasy=friendly
Really get stoned, drink wet cement.
Really stupid people believe they are intelligent.
REALLY!?!!? Does anyone read this thing?
Rebel without a cache.
Rebel without a clue!
Rebellion to tyrants is obedience to God.
Rebooting your brain can be tricky.
Rebuttal = butt transplant.
Recent investments will yield a slight profit.
Recession Is Here: Submarine Sandwich Shop Goes Under!
Recognize the signs of spring.
Rectotomy - what the surgeon REALLY did to me.
Recursion, noun: see recursion.
Recursion: What goes around, comes around.
Recursive (ree 'cuhr siv) adj. - see recursive
Recursive Tagline Error: See tagline for help.
Recursive: recurrent Windows user.
Recycle today, or it ends up in your kids' backyard.
Recycle! For us and for them.
Recycle: For me, for you, for them, and them, and them.
Red meat isn't bad. Fuzzy blue-green meat is bad!
Red ship crashes into blue ship ... sailors marooned.
Red, white, and blue. Three colors that only run forward.
Redneck: (n); a person whose family tree doesn't fork.
Reduce brain fat. Eat Moral Fiber.
Reduce Carbon Dioxide emmissions - STOP Breathing
Redundancy - an airbag in a politician's car.
Redundancy is something I can do again and again.
Redundant: See "Redundant"
Refer to previous tagline.
Reformat Hard Drive! Are you SURE (Y/Y)?
Refuse Novocain...Transcend Dental Medication !
Regardless of what you may think, this is NOT a tagline.
Regular or extra crispy, how do you want the environment?
Relativistically speaking I am the center of the UNIVERSE!
Religion is the fashionable substitute for belief.
Religions change, beer and wine remain.
Religious dogma: devout maternal canine...
Religious people are wicked, how would they be without?
Religious Backup: PRAY it doesn't crash!.
Remain seated until this message comes to a complete stop
Remains to be seen! (Sign hanging in the city morgue)
Remember that a kick in the butt may equal a step forward
Remember that all news is biased.
Remember that the "Suggested Retail Price" seldom is.
Remember that three lefts make a right.
Remember the deal's not done 'til the check clears...
Remember to leave 15% for the tip of the iceberg.
Remember when a trojan was a warrior?
Remember when safe sex was not getting caught in the act?
Remember when the air was clean and sex was dirty?
REMEMBER! Friends don't let Friends Vote for Democrats
Remember, if you win the rat race, you're still a rat.
Remember, it takes two to dance the tango.
Remember, it takes two to play peekaboo.
Remember, it takes two to share a kiss.
Remember, one runner does not make a race.
Remember, one shoe cannot be a pair.
Remember, one singer is not a duet.
Remember, the end never justifies the meanness.
Remember, the paper is strongest at the perforations.
Remember, UNIX spelled backwards is XINU.
Remember: don't start a fight you can't win.
Remember: No matter where you go; there you are.
Remind you of someone?
Renegade tagline! We're tired of being kidnapped!
Rents are so high now, leases are breaking tenants.
Repartee: An insult with a suit and tie on.
Repent and return those library books.
Repetition is the death of art.
Reports of things uglier than Vogon ships are unreliable.
Republican rule: The more I get, the better off you are.
Repunzel, Repunzel, ... turn on your modem.
Reputation: What others are not thinking about you.
Reserved parking for │┐and┴capped ┬ag│ines.
Resist being put into boxes.
Resist giving advice on matrimony, money or hair styles.
Resista a tudo, menos às tentaçöes.
Resistance Is Useless! (If < 1 ohm)
Resistance is useless, if you have no volts or amps.
Resisting temptation is not as hard as recognizing it.
Resort: A place where the tired grow more tired.
Responsibility on your shoulders? Less room for chips.
Responsibility without power is like slavery.
Restaurant: An eating place that does not sell drugs.
Restroom-The only place a flush beats a full house
Results may be unpredictable.
Results of his IQ tests are back. They're negative.
Retire from Congress in 1992 and pocket campaign funds.
Retired teachers have no class at all.
Retirement: when you get a certificate of depreciation.
Retreat hell! We're just fighting in another direction.
Revelation demands the ability to read.
Revenge is sweeter than life itself. So think fools.
Revolutions are not about trifles, but from trifles grow.
Ribbon cables, like undies, should not be bundled.
Rich enough to own limousine have nothing to chauffeur it
RIP... This tagline has now been ripped off.....
Rise from life as a banquet, neither thirsty nor drunken.
Road racers go in deeper and come out harder!
ROBOMAIL, your way to TAGLINE HEAVEN!
Robot def. Your plastic pal who's fun to be with.
Robot: Your plastic pal who's fun to be with.
Robotech? Oh, look Darling, it's Dallas in outer space!
Rock and roll is the hamburger that ate the world.
Rock Concert Garment: Heavy Metal Jacket
Rock me baby, rock me baby, all night long....
ROFL: Read Our Flappin' Lips?
ROM = Read Operator's Mind.
ROM instruction: (R)ead (O)perators (M)ind.
ROM wasn't built in a day.
Rome didn't FALL in a day either.
Rome wasn't built in a day, contractors were on strike.
Romulins, Klingons, and Borg, Oh! My!
Ron stole Maggies heart away, and I got Sidney's leg.
Ronald Reagan, the Milli Vanilli of Presidents.
Ronald Reagan.....A Triumph of the embalmer's art.
Ross Perot's campaign died for your sins.
ROTFL -- Rave on, tofu flinging leeches!!!
Rotisserie: A Ferris wheel for chickens.
Rounded numbers are always false.
Royalty free tagline.
RTFM: But it's the computer manuals I hate.
RTFM? You've got to be kidding.
RU486SX - 16 bit version of the popular abortion pill.
Rubber bands have snappy endings!
Rude, Crude and Socially Unacceptable...
Rule #167: neither a borrower nor a lender be.
Rule 1, Grow three extra legs, it keeps the crowd amused.
Rule 2, Find one very good Broknian Ultra Cricket player.
Rule 3, Put the teams in a large field with a high wall.
Rule 4, Throw sporting equipment over the wall.
Rule 5, Players lay about themselves with anything.
Rule 6, The winning team shall be the first that wins.
Rule of Order: He who shouts the loudest has the floor.
Rule of Thumb: The person either above or below you.
Rule One: Plan your taglines so that you can be sure
Rule to live by: Rub her feet.
Rules - get broken all too frequently.
Rules? What rules?
Rumors love lies.
RUN AWAY! RUN AWAY!
Run for the toilet, Taco Bell's done it again.
Run for your life!
Running water is fine, but not running through the roof.
Running Windows is better than washing them
RUNTIME ERROR 1072 at 4000:00C4: Lousy Beta Testing
Rush Limbaugh: a boil on the butt of reason...
Russian Express Card motto: Don't leave home.
S met ing's hap ening t my k ybo rd . .
S.O.S. - Everyone, vote against incumbents.
Sacred cows make great hamburgers.
Saddam Hussein still has a job. Do you?
Sadly, just before the read out, the Earth was demolished
Sadness needs its own time to be.
Safe sex means never having to say "You've got WHAT?!?"
Safe sex used to mean putting your car in park.
Said the fly " Let us flee." Said the flea "Let us fly."
Sailors curse the rain that farmers prayed for in vain.
Sailors do it upon the waves.
Sails trimmed, autopilot on, now it's "Miller Time."
Sally sells C Shells to the C Sore.
Salvation is only a Beer Bottle away.......
Same to you, fella....
San Francisco: where NOBODY eats Rice-a-Roni.
Sandwich every criticism between two layers of praise.
Sandwich: An faulty attempt to make both ends meat.
Sane? Hell, if I was sane why would I be here?
Sanity is a state of mind and I moved out of state.
Sanity not found. Abort, Ignore, Retry, Fail?
Santa Claus has the right idea: Visit people once a year.
Santa's elves are just a bunch of subordinate Clauses.
SASS - Sysops Against Stupid Signatures
SAST = Sysops ■ Against ■ Stupid ■ Taglines ■
Satanism: The hedonistic pursuit of fine fabric.
Satire does not look pretty upon a tombstone.
Satire: cloaks ignorance with semblance of truth.
Satire: weapon of the powerless against the powerful.
Sattinger's Law: It works better if you plug it in.
Satyrs have more faun.
Save a tree....EAT a beaver
Save energy: be apathetic.
Save gold...it has VALUE not a printed price
Save more trees, eat more beavers.
Save our planet, leave something of value behind.
Save our virgin forests - buy a tree a chastity belt.
Save out planet for our descendants.
Save police time - beat yourself up
Save the Bacteria: it's the only culture some people have
Save the earth, some of my best friends live here.
Save the plankton - eat a whale.
Save the turtles... don't wax your car.
Save the whales! Start collecting a whole set today.
Save the whales. Buy IBM.
Save the whales. Collect the whole set.
Saved whales are to be stored in Davy Jones' locker.
Savings accounts and toothpaste, only come out easy.
Sax Ewell Harris meant nothing by that last remark.
Say "No," then negotiate.
Say "please" a lot.
Say "thank you" a lot.
Say No, Then Negotiate.
Say something soft & sweet. Marshmallow.
Say the secret word and this duck is yours.
Say this is a pretty good BBS isn't it?
Say, is it raining outside?
Saying a big hello to intelligent lifeforms everywhere.
Saying bad things is very rude and highly impolite!
Scabbard: non-union poet
Scenery is here. Wish you were nice.
Schizophrenia beats being alone.
Schizophrenia beats dining alone.
Schizophrenia beats modeming alone.
Schwarzkoff happens.... In downtown Baghdad.
Science has not yet found a cure for the pun.
Scientific Method: A useful logical fallacy.
Scientific progress goes "Boink"!
Scientists have discovered a cure for apathy. So what?
Scott me up, Beanie!
Scotty!, Hurry beam me u%#$& NO CARRIER
Scotty, beam down Doctor Crusher and a six-pack...
Scotty, beam me up another message."
Scotty, beam me up another QWK message packet.
Scotty, I've fallen and I can't beam up!
Screw each and every prime directive.
Screw the essentials, I want the luxuries!
Screw up your courage! You've screwed up everything else
Screw your friends. Enemies won't let you get that close.
Scrooge had it wrong: "Blah" and "Some thug..."
Scrute the inscrutable; eff the ineffable.
SCUD: (S)ure (C)ould (U)se (D)irections.
Sculptor: A poor unfortunate who makes faces and busts.
SDRAWKCAB spelled backwards is backwards.
Search and Replace: digging change out of sofa cushions.
Seattle Rain Festival - Canceled due to sunshine.
Seattle Rain Festival - Jan. 1 to Dec. 31
Seattle: An Indian word meaning 52 degrees and raining.
Second star to the right and straight on 'til morning
Second star to the right and straight on till morning
Second-hand tagline. As-is. $10. No refund or exchange.
Secret ballot: permits claim you never voted for the guy
Secret of happiness: Total disregard of everybody.
Secretary of Education.............Dan Quayle
Secretary of Health & Welfare......Barney Frank
Secretary of Labor.................Anita Hill
Secretary of the Treasury..........Charles Keating
Secretary of Transportation........Ted Kennedy
Secretion - hiding something.
Secretion: Something someone is hiding from you.
Secretory of Defense...............Rodney King
Sector not found: did you look under the sofa?
Sects! Sects! Sects! Is that all Monks think about?
Sects, sects, sects! Is that all you ever think about?
Security is a game where final goal is never reached.
Security, confine Ensign @TOLAST@ to the brig.
Security, confine the alien Sysop to the brig.
Security, get that floozy off my bridge. ■ Picard
See h^w we++ this 24OO bd mqdem i Upg+aqeq tO 96OO woTk$!
See if you can guess which parts of me weren't replaced.
See Spot? Spot Seagate. Spot open gate.
See you in the movies!
Seeing is believing, Touching is convincing.
Seek not to follow footsteps but what they sought.
SEGA and Nintendo are combining, they call it Windows NT
Seismologists do it to a fault.
Seize no evil, ears no evil, and nose no evil.
Self abuse is the sincerest kind.
Self-made man: A horrible example of unskilled labor.
Self-sacrifice: to sacrifice others without blushing.
Selfishness is a vice we see it only in others.
Sellebrity: athlete in TV commercial
Semiconductor: A part-time orchestra leader.
Semper Fidelis
Senate Member.
Send money.
Send Monopoly Money to your Favorite TV Evangelist.
Send more tourists..... the last ones were delicious!
SENILE.COM found . . . Out Of Memory . . .
Senility means never having to drink just to forget.
Seniors are years ahead.
Sentient plasmoids are a gas.
Serfs up - Spartacus.
Serial killer strikes! Mouse and modem found dead.
Serial Port: Red wine on Grape Nuts.
SERIOUS: You can afford a computer, immunize your kids.
Seriousness is the only refuge of the shallow -- Wilde
Seriousness is the very next step to being dull.
Serology - the study of English Knighthood.
Set phasers on "Discuss Reasonably"
Set phasers to 'caress.' Fire at @TOFIRST@!
Set phasers to 'get a clue.' Fire at @TOFIRST@!
Set phasers to extreme itching!
SET PROFIT=ON; SET BUGS=OFF
Seven Deadly Sins: All the good stuff in a short list.
Sex and death, two things that occur once in a lifetime.
Sex in a Volkswagen = Farfergnookie.
Sex is a misdemeanor-the more you miss the meaner you get
Sex is better than reading; no overdue fines.
Sex is for kids, it gets dangerous in old age.
Sex is hereditary. If your parents didn't, you won't.
Sex is like an industrial film covered in fur..
Sex is not a answer. Sex is a question. Yes is the answer
Sex is only dirty if it's done right.
Sex isn't the best nor the worst thing in the world.
Sex, Drugs, and Crime...God, I love Congress.
Sex, it's not just fun, it's bio-logical law.
Sex: Momentary fun; position ridiculous; expense damnable
SEXIST??!! I'm not sexist! I pick on everybody!!
Sexual harrassment won't be reported, it will be GRADED!
Sexy women are nature's way of saying 'keep it up!'
Sha na na na, na na na na, Hey Hey Hey, Goodbye.
Shake off your heavy trance! And leap into a dance.
Shake well before and after use.
Shake well before using.
Shake, a man of note, wrote so many things to quote.
Shaken - not stirred.
Shall I, wasting in despair, Die because a woman's fair?
Shame is an ornament to the young, a disgrace to the old.
Shamed be he who thinks evil of it.
Share and enjoy.
Share your happiness with others today.
Shared pain is lessened; shared joy is increased.
Shareware - You write it, we'll share it.
Shareware author dies: .GIF at eleven.
Shareware it only works if you pay.
Shareware, crippleware, annoyware, underware
Shareware, crippleware, annoyware, underwear.
Shareware? Reminds me of a girl I knew in High School
Shareware? Reminds me of a girl in my high school.
Sharing: soul enrichment.
Sharks don't feed on lawyers; professional courtesy.
Sharp wits, like sharp knives, often cut their owner.
Sharper than an asp's tooth to have a thankless child.
She can't take much more of this Captain.
She canna take anneh more, Cap'n!
She devotes her spare time to neglecting duties.
She got pregnant simply because she hated rabbits.
She has been under more drunken sailors than a naval head
She is descended from a line that her mother listened to.
She kept saying I didn't listen to her -- or something.
She said "You get three wishes, what are the other two ?"
She sells C shells
She talks so much her tongue is sunburned.
She was but a poor, temporary substitute for you, dear...
She'll be comin' round the modems when she comes.
She's a WITCH! She turned me into a newt!
She's barking mad, I thought I'd mentioned that.
She's been on more laps than a napkin.
She's Got A Ticket To Ride. I travel by Ankle Express.
She's looking at menopause in a rear-view mirror.
She's so fat... When she sings... It's over!!
She's the kind of woman who leaves no stone unthrown.
Shedding on polyester leads to no end of trouble...
Sheep can hear zippers at 1,000 meters.
Sheep would be startled to see the sun rising.
Sheesh! You start havin' fun, and they send the lawyers!
Shell to DOS... Come in DOS... Do you copy?
Sherman, set the Way-Back Machine for 1492.
Shh! Be vewy quiet! I'm hunting wuntime ace!
Shh! Be vewy vewy quiet! I'm hunting tagwines!
SHHHH! Be vewy quiet -- I'm hunting FOREBEARS.
Shhhhh! Be vewy, vewy quiet... I'm hunting net gwemlins.
Shhhhhh... you'll wake the babe.
Shhhhhh.....the topic cops are coming.
shift key/ never heard of it1111
Shill: Guy who loses $2000 at a table, & leaves smiling.
SHIN - A device for finding furniture in the dark.
Shin: Device for finding furniture in the dark.
Ships that pass in the night are lucky.
Shoot low, the liberals may be crawling!
Shoot your program and put it out of its memory!
Shop sign -- We buy anything saleable.
Shop Thom McCann's to reboot your computer.
Shoplifters with the runs always take Klepto Bismol.
Shoplifters with the runs.... take Klepto Bismol!
Shotgun wedding: a case of wife or death.
Should I serve white or red wine with Penguin?
Should Kathleen Turner key in the lock?
Should old acquaintance be forgot - Count of Monte Cristo
Shouldn't something funny go here?
Shouldn't you be doing something productive?
Shouldn't you be doing something useful?
Shouldn't you go back to lurking now?
Show & Tell: Lecture by Gypsy Rose Lee.
Show affection, it may result in a pleasant response.
Show me a good tagline... And I'll steal it.
Show me a sane man. I'll cure him for you.
Show respect for age. Drink good Scotch for a change.
Show some gumption for once in your life!
Showtime, folks!
Shut up, kid. -- Guinan
Shut up, or I'll nail your other foot to the floor.
Shut up, Spock! We're rescuing you! --McCoy
Sick pay is a form of ill-gotten gains.
Sick Pay: Ill-gotten gains.
Sigh-groan sequence initiated. Execute poster? (Y/N)
Sigmund's wife wore Freudian slips.
Sign at nursery: Come to me my melon-cauliflower baby.
Sign Here: __________________________________
Sign in a delicatessen: "Deli Beloved."
Sign on baby's bib: SPIT HAPPENS.
Silence cannot be misquoted.
Silence is evidence of a superb command of the language.
Silence is more eloquent at times than words.
Silence is not only golden; it's seldom misquoted.
Silent gratitude isn't of much value to anyone.
Silly rabbit, tricks are for hookers!
Silly wabbit, QWKs are for kids.
Silver and gold make even pigs seem clean.
Silver nitrate: after dark fee for Lone Ranger's horse.
Simon Lubkin. Dealer in Romancement.
Simple rule: If you don't treat me right, shame on you.
Simplicity, carried to an extreme, becomes elegance.
Sin has many tools, a lie is only handle for them all.
SIN OF OMISSION: Any sin that you forgot to commit.
Sin: Guilt with pleasure.
Since GOD spelled backwards is DOG, is my poodle Satan?
Since I've used up my sick leave, I'm calling in dead.
Since life goes on - you might as well get on with it.
Since prehistoric man, no battle has ever gone as planned
Since she won't live forever, why give her a diamond?
Since they didn't move, he called them breakfast and ate.
Since using the leaf as legal tender, we all become rich.
Since vegetarians eat vegetables, beware of humanitarians
Since we all move so slow, why is it called rush hour?
Singing the blues--hallelujah in a minor key.
Sinner: A stupid person who gets found out.
Sir @TOFIRST@! Go change your armour!
Sir Damon! Go change your armour!
Sir Lancelot, you have chain mail in Knight's Conference.
Sir Robin! Go change your armour!
Sir! Romulan warbird decloaking÷$#&^&^&%&@!!¥NO CARRIER
Sir, I've been meaning to discuss these feelings. ■ Troi
Sir.....We believe we found part of your suitcase.
Sirius is paved with gold, so I've heard it said.
Sit down, you're rocking the boat.
Six megs, two monitors, and an attitude
Six pints of bitter, quickly, the world's about to end!
Sixties, Seventies, Eighties, Nineties, yr 2000=Naughties
Skating away...on the thin ice of a new day.
Skeleton: Hardware Flesh: Software Brain: Logic Circuit
Skeptics are seldom deceived.
Skier: Someone who pays an arm and a leg to break them.
Skiier: Avalanche looking for a place to happen.
Skiing Halted, Operator Broken, Out of Service for Repair
Skin: Keeps insides in and the rain out.
Slapped himself getting in touch with his feminine side.
Slartibartfast had hoped for an easy retirement.
Sleep is a poor substitute for caffeine.
Sleep is a totally inadequate substitute for caffeine.
Sleep warm, love well and carry a big stick.
SLEEP!? SYSOPs aren't supposed to SLEEP!
SLEEP.COM *** Process interrupted. Kill intruder?
SLEEP:that fleeting moment just before the alarm goes off
SLEEP? NEVER! I'm a consultant.
Slicker than owl crap on a hot tin roof.
SLIIIIIIIME in the Ice Machine!
Slip out of those wet clothes (and into a dry martini).
Slow picking up the check? Hand it to them.
Slow the aging process: send it through Congress!
Slower Traffic Keep Right - Is that so difficult?????
Slowly I turned . . . step by step . . .
Small change can often be found under seat cushions.
Small changes can produce big results!
Small problems seem insurmountable to small minds.
Small programs are for small minds.
SMART Drive: What D.C. drivers are incapable of.
SMARTDRV - "Did ya hear the one about the..."
SMARTDRV - "Ya mother wears army boots!"
SMARTDRV - Did you think I wanted a dumb one?
SMARTDRV installed. It's your data that's stupid.
Smarter than the average bear.
Smash forehead on keyboard to continue.
Smile and everyone wonders what you've been up to.
Smile if you are wearing sexy underwear.
Smile if you're not wearing underwear...
Smile if you're wearing sexy underware.
Smile when you call me that!
Smile when you say "Damn Yankee."
SMILE when you say that.....
Smile! You're on Candid Modem!
Smile! It makes people wonder what you're up to.
Smile! Things can only get worse.
Smile, but sharpen your knives.
Smile,you may meet a person who will play with your life.
Smile. It makes people wonder what you're up to.
Smile.....if you're just a bit damp......
Smile: Mirth Mark
Smog makes haze while the sun shines.
Smoke 'em if you got em.
Smoke a doobie while driving - leave no turn unstoned.
Smoke detectors save lives.
Smoke me a kipper! I'll be back for breakfast.
Smokey the Bear says: Strip mining prevents forest fires.
Smoking cures weight problems... eventually.
Smoking is one of leading causes of statistics.
SMOREPLAY: What Smurfs do before they smuck.
SNAFU: Situation Normal, All "Fouled" Up!
Snails' pace: .00758 mph.
Snap Crackle, Stop!
SNOOZE.EXE Complete. Repeat (Y/N)
Snout rings. That's how we tell them apart.
Snozzelberry? Who ever heard of a snozzelberry?
So Bill Gates said, Let there be DOS ...
So Britain's got Di and Fergie; WE have Woody and Mia!
So crowded in here, I must go outside to change my mind.
So download them and shut up...
So he said "Gleep Gloop Glop", and I had to agree...
So long and thanks for all the fish.
So many idiots... too few flame-throwers...
So many jerks ... so few bullets
So many lawyers, so few bullets.
So Many Messages!.............So Little Time!
So much for No New TAXES, I'm giving up lip-reading.
So much for that one...
So much time and pain as well.
So simple a child could do it? Go find me a child!
So simple that even an adult can use it!
So slow, I can't even create a breeze....
So soon old; so late smart.
So that's what my horoscope meant when it said "kaboom".
So this is it... We're going to die...
So ugly not even the tide would go out with him.
So where did we all come from? Stop acting like a monkey.
So why did they go from PS/2 to PS/1???
So, my brother is human after all. - Robert Picard
Society like air, is necessary but not complete for life.
Society prepares the crime; the criminal commits it.
Society's to blame!!!
Sodom! For Gomorrah we die.
Software Independent: Won't work with ANY software.
Software, hardware, -- is that you talking Sigmund?
Software: Lingerie
Solitary pastimes: Nose Picking, Farting, Scratching.
Solitude: good place to visit, a poor place to stay.
Solution Series: Works for Windows, Publisher and Money
Solve the problems of the world: Vote anarchist.
Some are more equal than others....
Some are wise; others are otherwise....
Some assembly required: the whole damned thing.
Some assembly required? Now they tell me!
Some authors should be paid by the quantity NOT written.
Some believe their life sentence is take up room and die.
Some bosses call passing the buck delegating authority.
Some climb the ladder of success wrong by wrong.
Some cures are worse than the disease.
Some days it take effort to just keep up with the losers.
Some days it's chickens, some days feathers...
Some days the only good thing on TV is the vase.
Some days you're a bug, other days a windshield.
Some days, I'd kill Flipper for a good tuna sandwich.
Some days, rocking a boat is the way to get things done.
Some days, you get the bear. Some days the bear gets you.
Some do everything to being and nothing to end.
Some Do, Some Don't, Some Will and Some Won't.
Some farewells are easier than others. - P. Marlowe
Some folks never exaggerate--they just remember big.
Some inquiring minds want to know & some don't!
Some learn the tricks of the trade, not the trade itself
Some lives are as a lamp that flickers but cannot flare.
Some Londoners are just P. Lane folks.
Some lose their tempers from seeing you keep yours.
Some men are discovered, others are found out.
Some men without a god are like fish without bicycles.
Some minds should be cultivated, others plowed under...
Some nonsense now and then is relished by the wisest men.
Some of us just die, others of us live on.
Some people are born stupid, others work to acquire it.
Some people are like a Don Quayle without the intellect.
Some people are, through no fault of their own, sane.
Some people aren't equipped to attend a meeting of minds
Some people can't succeed at anything, even suicide.
Some people carve careers, others chisel them.
Some people grasp stupidity as though it were a virtue.
Some people march to a different drummer--others polka.
Some people push for a tofu-free work environment.
Some people take the bull by the horns--others shoot it.
Some rise by sin and some by virtue fall.
Some settling may have occurred in shipping.
Some speakers should be called gusts of honor.
Some stock market investors go stock-raving mad.
Some things have to be believed to be seen.
Some thoughts are best guillotined before actions result.
Some TV shows are so dull they should have yawn tracks.
Some winners rely upon miracles without believing in them
Some women get excited about nothing, then marry him.
Some would change a bad shirt instead of a bad mind.
Some zoophilic dreams are really wild.
Somebody got up on the wrong side this morning. ■ Riker
Somebody has to be the grownups, and now it's our turn.
Somehow, I can't see myself doing it for money. ■ Geordi
Someone is speaking well of you.
Someone is unenthusiastic about your work.
Someone left the cake out in the rain...
Someone superglued all my bytes onto my hard drive.
Someone whom you reject today, will reject you tomorrow.
someonelemmeoutaherethisplaceisfullanuts!!
Something is especially grim about pubs near stations.
Something will have to be done, something irresponsible.
Sometimes even fools make good suggestions.
Sometimes I sit and think, sometimes I sit and stink.
Sometimes I wake up grouchy - sometimes she wakes me up.
Sometimes I wake up Grumpy...other times I let her sleep.
Sometimes it takes a fool to rush in to get the job done.
Sometimes the fax lie.
Sometimes the fool who rushes in gets the job done best.
Sometimes the only solution is to find a new problem.
Sometimes the truth is the worst horror.
Sometimes you get the bear, sometimes the bear gets you.
Sometimes you're the bug, sometimes the windshield.
Sometimes you're the windshield, sometimes you're the bug
Sometimes, the only solution is to find a new problem.
Song: "It Had To Be Stew" - Army cook
Song: "There's A Whole Lotta Bakin' Goin' On"
Song: "You Made Me Shove You" - wrestler
Soon To Be A Major Motion Picture.
Sooner or later growing becomes it's own sweet reward.
Sorry I'm a bit late, I've had the most ghastly time.
Sorry I'm late, please don't send me to Abuse!!
Sorry, a fatal error has occurred. You're dead.
Sorry, can't think of an insult stupid enough for you.
Sorry, did I post that message in the Amnesia Conference?
Sorry, I forgot all about the Amnesia Conference!
Sorry, my taglines are in a box somewhere.
Sorry, no tagline. Writers union is on strike.
Sorry, no tagline. Normally get it fresh on Mondays...
Sorry, no witty Tagline here.
Sorry......my mind has a few bad sectors!
Sound really has almost nothing to do with true music.
Sounds like a great idea to me!
Sounds like quite a character.
Southern DOS: Y'all Reckon? (Yep/Nope)
Southern gays are homo sex'yalls
Space bar? I wonder what the cover charge is...
Space-lag is very bad for sub-clauses.
Spaceballs: The taglines.
Spaghetti code = job security.
Spaghetti code means job security.
Spam for me, please, with a side of crunchy frog.
Spam Spam Spam Spam... Spam Spam Spam Spam.. Spamityspam!
Spam, Spam, Spam, Spam, Spam, Eggs, and Spam.
Spam, Spam, wonderful Spam...
Spare the rod and spoil the drag race.
Spare the rod when young and kids'll grow up to carry 'em.
Spare time? You're lookin' at it.
Sparky's Law: You must say something cute here!
Sparky, Sparky, Bo-Farky. Banana Fana Fo-Farky ..
Speak kind words, and you will hear wonderful echoes.
Speak of braggarts: talking of those lacking something.
Speak softly and carry a two-handed sword.
Speak your mind... you have absolutely nothing to lose!
Speaker of the House...............Paul Tsongas
Special Guest Speaker: Cyrano Jones!
Specialization is for insects.
Specifications subject to change without notice.
Speculation is the return lane of the road to knowledge.
Speech writers hope to make a WordStar.
Speed costs money. How fast do you want to go?
Speed doesn't kill. Stopping very fast kills.
Speed Kills! Use Windows!
Speed things up, make pre-aged wine from old raisins.
SPEED, QUALITY, PRICE: pick any two.
Spend time confirming the need & the need will disappear.
Spending $1K a day: $1M lasts 3 yrs; $1B lasts 3,000.
Spent the afternoon flinging cow flop frisbees.
Spice up your love life....kiss a Klingon today!
Spiderman Lives!
Spiritual Truth via Superior Firepower
Spit and polish sounds kind of unsanitary, doesn't it?
Split hairs any finer and you'll end up with split ends.
Split personality? Who, us?
Spock, that man is a politician. Set phasers on KILL!!
Spoken word not sparrow; once flown, can't catch.
Spongecake: Dessert made of borrowed ingredients.
Spooks are a breed apart.
Sports: only entertainment you never know the ending.
Spring has sprung, the grass has ris.....
Spring is God's way of saying, "One more time!"
Spring makes everything young again except humans.
Spring: When anglers get that faraway lake in their eyes.
Stability in marriage: one party is in a coma.
Stack it...to the limit...one more time.
Stackedwurst: a German girl measuring 38-24-36
Stagnation: country without women
Stalemate: ex-spouse
Stamp out FAT today..... get a Virus!
Stamp out philately.
Standards are wonderful! So many to choose from!
Standing on head makes smile of frown for mouth only.
Star date 42274.23.4 Beamed down for a pee..
Star Trek XXVII - The Search for Kirk's Teeth.
Star Trek: The Geritol Generation ■ Upcoming TV series
Stairway to Heaven: 8088 80286 80386 80486 P5
Start a family only if your parents are able to baby sit.
Start meetings on time, regardless of who's missing.
Start of fairy tale: "If I am elected..."
Start off every day with a smile and get it over with.
Start slow and taper off.
Start the day with a smile and get it over with.
Starve a feeding bureaucrat...vote Libertarian.
State Dept. of Unnecessary Double Redundancies Dept.
Statistics are human beings with the tears wiped off.
STATISTICS: numbers looking for an argument.
Status Quo--Latin for the mess we are in.
Stay away from flying saucers today.
Stay away from hurricanes for a while.
Stay back! I have a modem and I know how to use it!!
Stay out of this Marvin, this is organism talk.
Stay with me, I want to be alone.
Stayin' alive! Stayin' alive! - Count Dracula
Steal all you want, we'll make more...
Steal this tagline and I'll infect your system!
Stealing a rhinoceros should not be attempted lightly.
Stealth condoms - they'll never see you coming!
Stealth means never having to say you're sorry.
Steer clear of any place with a "Ladies Welcome" sign.
Steer clear of restaurants with strolling musicians.
Steers don't grow up to be cow boys.
Sternal - having to do with the back of a ship.
Steward wasted our tax dollars.
Stick to your talent and the cows will be well tended.
Stick \'stik\ n. 1: A boomerang that doesn't work
Still alive and kicking - 'cept, life keeps kicking back!
Still crazy after all these years!
Still going and going and going and going...
STILL HERE? The message is over.... Go Home. Go On!
Still, it'll all be over in a couple of days, won't it?
Stop me before I post again!
Stop searching forever. Happiness is just next to you.
Stop searching forever. Happiness is unattainable.
Stop spelling misteaks: use error correcting modems.
Stop tagline theft! Copyright your tagline (c)
Stop that or I shall have to hurt you.
Stop what you're doing and TAKE A SHOWER!!!
Storks bring babies....swallows keep them away....
Straight trees have crooked roots.
Strange but not a stranger...
Streakers repent! Your end is in sight.
Strength of mind: Person who can eat one salted peanut.
Stress- n. Doing a tight 180-degree U-turn at Warp 9.5.
STRESSED spelled backwards is DESSERTS.
Stretch pants: What Lassie does when the show runs under.
STRING space corrupt? But I always use TAPE!
Strings, Percussion, and Celesta - Bartok WAS Country!
Strip mining prevents forest fires.
Strip mining prevents forests.
Strive at all times to bend, fold, spindle or mutilate.
Strive for Mediocrity.
Strive for perfection, settle for excellence!
Strive for the impossible or you shall wither.
Strong families; best anti-poverty program available.
Studies show taglinetheftitis is highly contagious.
Study hard let other people sell fries.
Stulti timent fortunam sapientes ferunit.
Stupid tagline found. Abort, Retry, Swipe a better one.
Stupid: Being unable to find your own butt in the dark.
Stupidity has no limits, genius does.
Stupidity is no excuse for not thinking.
Stupidity is NOT a handicap! PARK ELSEWHERE!
Stupidity is the only universal capital crime.
Stupidity: elemental force that no earthquake can match.
Sub omni lapide scorpio dormit.
Sub-Woofer: Canine in an underwater vessel...
Subliminal: Send me $1000 in small, unmarked bills.
Submitted for your approval.
Subway: A place so crowded even all men can't get seats.
Success comes in a can. Failure comes in a can not.
Success is achieving the top of the food chain.
Success is simple: do your best. People may like it.
Success is simply a matter of luck. Ask any failure.
Success of those we dislike proves that luck exists.
Succumb to natural tendencies. Be hateful and boring.
Such stuff dreams are made of. - S. Beauty
Suddenly, a minute passed.
Suggestion for Enterprise crew: Install seatbelts.
Suicidal twin kills brother by mistake.
Suicide Hotline...please hold for the next available...
Super-frantic-unproductive-nothing-legislation: the usual
Superior beings in the universe? Yup! Dogs.
Superior firepower is invaluable when negotiations start.
Superlatives offend the truth and cast doubt.
Superman - alias for Sysop.
Supernovae are a blast.
Support capital punishment for tagline thieves. (tm)
Support FREE software. Write it yourself.
Support National Motherhood Week - Make one today!
Support nuclear families! The mutants are fun to watch!
Support Pacifism: Get out & fight for what you believe in
Support senile delinquency.
Support the constitutional right to arm bears.
Support wildlife, throw a party.
Support your medical examiner, die strangely!
Support your right to keep and arm bears!
Support your Sysop.... Send your Paycheck!!
Suppress that thought.
Supreme Court-Left Wing closed, enter through Right Wing.
Sure I can help you out! Which way did you come in?
Sure I can multi-task. I have two computers!
Sure I know how to copy disks. Where's the Xerox machine?
Sure I paid my electric bi
Sure I'm ugly! But in the morning you'll be sober!
Sure there's apathy in the world, but who cares?
Sure you can trust the government! Ask the Indians.
Sure you're using TODAY'S version??
Sure, drinking kills brain cells, but only the weak ones.
Sure, Patrick, but will the Pontiac do warp nine?!
Sure, we just route the main sensor through Data's cat.
Sure, when OINK FLAP OINK FLAP ... I'll be damned.
Sure, when pigs...OINK,FLAP,OINK,FLAP...I'll be damned!
Sure...It is possible although it is thought provoking.
SURF NAKED - because sharks hate to peel their food
Surge into electronic mail.
Surgeon General....................Dr. Kevorkian
Surly to bed, and surly to rise.
Surly to bed, surly to rise . . .
Surprise due today. Also the rent.
Surprise the world. Get to work on time today.
Surprise your boss. Get to work on time.
Survival Tip #2: Never MOON a werewolf.
Swap read error. You lose your mind.
Sweat, plus sacrifice, equals success.
Swell-head: Nature's frantic effort to fill a vacuum.
SWF, Blonde bombshell, seeks man NOW! No Sysops
Synonym: A word you use when you can't spell the other.
Syntax Error in KITCHEN.H : COFFEE not found.
SysOp has requested chat! Alt-H to accept.
Sysop not found; please notify computer
SYSOP \'sis äp\ n: hacker's diety; omnipotent.
SYSOP \'sis äp\ n: the person laughing as you type.
SYSOP: A person who needs only 2 hours sleep each night.
Sysop:`sis äp n: The person laughing as you type messages
Sysoping, it's not just a job, it's a HEADACHE!
Sysoping, not just an adventure, sometimes it's emesis.
Sysoping: More fun than being beaten with a sledgehammer.
Sysoping: Not just an adventure, it's a job.
SYSOPING: for people who don't get enough stress...
Sysops die at an early age.....Murdered by their Wives...
System Crash (A)bort (R)etry (T)hrowup.
SYSTEM ERROR 1303 : SYSOP CAN'T GET OUT OF BED!
SYSTEM ERROR! (A)bort, (R)etry, (I)gnore, (S)ell it!
System error! Strike any user!
SYSTEM ERROR: press F13 to continue...
SYSTEM ERROR: (A)bort, (R)etry, (F)orget it....
SYSTEM ERROR: press F13 to continue.
System Failure. Push (B)ullsh*t (W)hine (S)urrender.
System halted - Don't waste your time pressing any key.
SYSTEM HALTED - Press all keys at once to continue
System halted - Press any key to do nothing
Tablet - a small table.
Tabloid: A newspaper with a permanent crime wave.
Taco Bell is *Not* a Mexican phone company!
Tact is for weenies.
Tact is knowing how far to go in going too far.
Tact is the intelligence of the heart.
Tact: Describing others as they see themselves.
Tact: Recalling a lady's birthday but forgetting her age.
Tag line thievery... on the next Geraldo!
Tag line thievery..Coming up next on Geraldo.
Tag lines are irrelevant if you don't understand them.
Tag ■ I am he as you are me and we are all together
Tag! You're it!
Tag, line.... you're it!
Tagito ergo sum (I Tag, therefore I am).
Tagless messages just look naked somehow...
Tagline -- Shmagline!!!
Tagline addiction. It's all YOUR fault!
Tagline addiction: It's a humor ailment.
Tagline being cleaned..watch this space.
Tagline Bounty Hunter.
Tagline bungee jumper .____________________>->o
Tagline burnout: Stress caused by constant cleverness.
Tagline Censorship: Good Taste In Small Doses
Tagline connoisseur.
Tagline covered under Official Secrets Act
Tagline dueling: email variation of telephone tag.
Tagline error. Contact your systems programmer.
Tagline fever is the primary symptom of BBS addicts.
TAGLINE FOR THE HARD OF HEARING!!!!!!!!!!!
Tagline frequencies are Open.... now hailing...
Tagline has been seized by the Tagline Censor.
Tagline Lingerie, so sheer it shows your personality.
Tagline Lotto: ▓▓▓▓▓▓▓▓▓▓<- Scratch here for prize
Tagline Lotto: ▓▓▓▓▓▓▓▓▓▓<- Scratch here to reveal prize.
Tagline näo se inventa, copia-se.
Tagline Repairs: Make smart $1.25; Make funny $125
TagLine Serial No.10397 - (C) 1992, All rights reserved
Tagline shortage. Please help recycle taglines.
Tagline space to let. Inquire within.
Tagline spill closes highway. Film at 11!
Tagline spill closes highway. Story at 10!
Tagline Theft - News at 11:00.
Tagline theft is a compliment.
Tagline theft isn't a crime, it's an art.
Tagline theft, like car-jacking, is on the rise.
Tagline thievery ... On the next Geraldo!
TAGLINE UNDER CONSTRUCTION
Tagline Virus! Don't steal this tagline!
Tagline void where prohibited.
Tagline wanted. Apply within ====================>
Tagline Witheld: Patent Pending.
Tagline's this not words order in are. ■
Tagline, tagline, who's got the tagline?
TAGLINE. (plain vanilla version)
Taglinemania: first seen on Ed Sullivan, 1966.
Taglines \'tag-läinz \ The bumperstickers of BBS'ing.
Taglines are almost as bad as bumper stickers.
Taglines are copyright of LOTUS. you have been WARNED!!
Taglines are for lovers.
Taglines are irrelevant. You will be assimilated...
Taglines are like cats. You just think they're yours.
Taglines are the bumper stickers of the '90s.
Taglines for sale -- call for best rates.
Taglines make great Christmas gifts.
Taglines make great gifts.
Taglines R Us: Philosophy in a nutshell.
Taglines that users would love to read and forget! -Dik
Taglines unite! Stop kidnapping of taglines.
Taglines Version 1.11 (Rev) 1.10 last issue
Taglines...one line freedom of speech!
Taglines: More interesting than the crap above.
Taglines: The Movie
Taglines? We don't need no stinkin' taglines ..
Taglinophobia: Fear of having an insipid tagline.
tagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtag
Tagteam -- bunch of people thinking up taglines.
Tain't funny, McGee...
Take a bite out of crime .. Abolish the IRS!
Take a long walk off a short pier.
Take an astronaut to launch.
Take big bites; moderation is for monks.
Take egotism out, and you castrate the benefactors.
Take every word of others with a grain of salt...
Take it off! Take it ALL off!
Take me drunk! I'm home.
Take my advice, I don't use it anyway.
Take my advice... after all I'm not using it.
Take my advice.... I'm not using it....
Take my tagline, please!
Take my visa, take my wife, but NOT my modem!!
Take my wife! Please! Oh--sorry, dear...(gulp)
Take my wife, pl--wrong echo!
Take no friends and leave no enemies.
Take our politicians: they're a bunch of yo-yos.
Take the bull by the hand, and don't mix metaphors.
Take the prisoner to the dungeon he said condescendingly
Take this DOS and shove it - I ain't a bootin' it no mo
Take time to have friends.
Take two aspirin and call me in the morning.
Take two aspirin and call the consultant.
Take two crows and caw me in the morning.
Take what you can use and let the rest go by.
Take your dog to obedience school. You'll both learn...
Take your levity whenever and wherever you can find it.
Takers eat well, but givers sleep well.
Talk about memory, this system includes a sense of guilt.
Talk is cheap because supply exceeds demand.
Talk is cheap until you hire a lawyer...
Talk is cheap, and so am I.
Talk is cheap, until you hire a lawyer.
Talk is cheap--except when Congress does it.
Talk shows: the sound of the populi when it voxes.
Talk slow, but think quick.
Talk slowly! I'm blond.
Talk slowly, I'm only running at 33Mhz.
Talkie Toaster - "Ah, you're a waffle man then."
Talking is another disease of age.
Talking of bulls is not like being in the bull ring.
Talking to yourself's boring,you know what's coming next.
Tandy is Dandy, but Acer is Quicker.
Tanelorn: C.P. Grogan Fan Club Site
TANSTAAFL: There Ain't No Such Thing As a Free Lunch
Tasmanians, who never committed adultery, are now extinct
Tasteful words. You might have to eat them.
Taupe of the morning.
Tax abatement is welfare for the rich.
Tax reform: Don't tax you or me, tax that fellow there.
Tax Shelter- A way to spend a buck to save fifty cents.
Taxation is little more than legalized extortion.
Taxation WITH representation ain't so hot either.
Taxes are not levied for the benefit of the taxed.
Taxidermy Cafe: Let us stuff you.
Teacher (according to a child): A non-violent mother.
Teacher, may I go to the Boy's room. I need to emulate.
Teachers do it with class.
Teachers have class.
Teaching a pig to sing wastes your time & annoys the pig.
Teaching: Appearing to have known your subject forever.
Teamwork is essential it allows you to blame someone else
Teamwork is vital! (It gives you someone to blame.)
Tear jerker: soap du jour
Technicians tinker. Engineers tearit up.
Technology: Ecology's nemesis.
Technology: magic to a barbarian.
Teenager: Having tunnel vision and selective hearing.
Teenagers - Your worst nightmare!
Teenagers are your punishment for enjoying sex!
Teenagers: the Gimme Generation.
Teenagers: Your punishment for enjoying sex....
Teflon brain -- nothing sticks.
Telecommunications is a bit far-fetched.
Teleportation affects your orientation.
Television proves people will look at except each other.
Television: Society's best pesticide for the reading bug.
Telix feature: The ability to download Qmodem
Tell me again why you named your kid "Rasputin?"
Tell me another time. I'll give you my number.
Tell me more about these "habits". ■ Beverly
Tell me, am I supposed to be pleased or frightened?
Tell me, how did the fool and his money get together?
Tell no big lies today. Small ones are just as effective
Tell us, do you know anything of the balance of nature?
Tend the molehills, the mountains look after themselves.
Tennis players have fuzzy balls.
Tentacles: a linebacker's dream for every game.
Terminally clueless!!
Terminator virus found? Use ILLBE.BAK!"
Terror: A female Klingon with PMS.
Tested on small, cute, furry animals with big, sad eyes.
Testing 1 2 3. Hey, is this thing on?
Testing...Testing...1,2,3,4...can anyone hear me?
Texas Barbecue, if you can taste the meat someone goofed.
Texas DOS: "Y'all reckon?" [Yup/nope]
Texas: A Purdy, Grate Steat (gud ejukashun, to!)
TFROOMB!
Th-th-th-that's all, folks!
Thank God I'm an atheist.
Thank God that a person can have only one MIL at a time.
Thank you for brightening my day.
Thank you for encouraging my mischievous behavior
Thank you for flying BBS...
Thank you for holding your breath while I smoke
Thank you for making a simple door very happy.
Thank you for observing all safety precautions.
Thank you for your anticipated help...
Thank you for your support,
Thank you, God. Keep it up!!!
Thank you, now I think I really am going to be ill.
That concept looks like a chicken in a windstorm.
That man is richest whose pleasures are cheapest.
That must be wonderful! I don't understand it at all.
That oughta fire something up around here...
That rabbit's dynamite!
That should clear out your sinuses.
That statement is TRUE >> << That statement is FALSE
That tagline is TRUE -> <- That tagline is FALSE.
That was a pointing device? My cat thought it was dinner.
That was deep.
That was definitely the LAST bug, take my word for it.
That was so fast, can you show me one more time? ■ Troi
That was then, this is now.
That was Zen, this is Tao.
That which can be imagined can also actually be reality.
That which cometh around shall likewise goeth around.
That which does not kill me...probably missed!
That will teach exactly what to whom?
That's a great answer -- now, what was my question again?
That's a smug aura of respectability you see in a mirror?
That's enough, Data!
That's entertainment! - Vlad the Impaler
That's funny, I don't recall asking for your opinion....
That's life: some days chicken, some days feathers...
That's no tagline! It's Odo!
That's not a bug, it's an undocumented feature.
That's not a knife. THIS is a knife.
That's not funny...THAT'S SICK!
That's not line noise--my modem's speaking in tongues!
That's right, try hard to be good at the game of life.
That's the nuttiest idea you've had, Counselor. ■ Geordi
That's what I meant....only different.
That's why GOD made your eyes; to plagiarize.
Thats the sound of the men working on the tag..line.
The 1st nonabsolute number is the number of reservations.
The 2nd nonabsolute number is any guest's arrival time.
The 3 terrible ages of childhood: 1-10, 10-20, & 20-30.
The 3rd nonabsolute deals with the check, cost, & payment
The 4 Food Groups: Fast, Frozen, Instant & Microwave.
The 486SX: Intel's test of your gullibility!
The absence of alternatives clears the mind marvelously.
The agony of delete.
The angle of dangle is proportional to the heat of fire.
The answer is 42, but what's the question?
The answer is easier when the question is hypothetical.
The answer to the Great Question is 42.
THE ANSWER: --------------------------------> 42
The antics of the president always made popular tri-D.
The apemen are part of the program, we are not
The arrogance of age must submit to be taught by youth.
The Babel fish is the oddest thing in the universe.
The backup's not over 'til the fat table sings.
The backup's not over till the FAT table sings!
The ballot is stronger than the bullet.
The barman cleared his throat. "Last orders please."
The BBC would like to apologize for the previous post.
The BBC would like to apologize for the previous tagline.
The beauty of a pun is in the "Oy!" of the beholder.
The best armor is to keep out of range.
The best audience: Intelligent, well-educated, and drunk.
The best blood at times gets into fools and mosquitoes.
The best congress is one in recess.
The best conversation I had was 40 million years ago.
The best conversation I had was with a coffee machine.
The best defense against logic is stupidity.
The best defense is to stay out of range.
The best doctor is the one you hunt for and can't find.
The best draftees are married men, they take orders.
The best Female Programmers are well stacked!
The best government teaches us to govern ourselves.
The best insomnia cure is a good night's sleep.
The best laid plans often go a fowl. - Wile E. Coyote
The best prophet of the future is the past.
The best things in life are food.
The best things in life are for a fee.
The best tranquilizer is a clear conscious.
The best water doesn't come in fancy bottles.
The best way out of a difficulty is through it.
The best way to accelerate a Mac is at 9.8m/s2!
The best way to be useful: stay out of the way!
The best way to get ahead is to use the one you've got.
The best way to get praise is to die.
The best way to keep your word is not to give it.
The best way to save face is to keep the lower part shut.
The big print giveth & the small print taketh away.
The bigger the bankroll, the tighter the band around it.
The bigger the drive, the more junk collected.
The bigger they are, the harder they hit.
The biggest political jokes are the ones the voters elect
The bird of war is not the eagle but the stork.
The biter bit.
The book "Understanding DBase IV" is an oxymoron.
The Borg Are Back An' You're Gonna Be in Trouble, Hey Na, Hey Na...
The Borg are coming! Quick!! Try and look useless!!!
The Borg Empire: An Equal Opportunity Assimilator
THE BOSS IS COMING! QUICK, PRESS ESC!
The Boss may not always be right, but IS always the Boss.
The Boy Scouts is like the army with adult supervision.
The boys may be marching, but they know not where.
The Boyz In The Hood Are Always Hard..
The brook would lose its song if we removed the rocks.
The buck doesn't even slow down here.
The buck stops at the desk over there.
The buck stops at the next desk.
The buck stops here, the doe just visits.
The bus is always late, unless you are.
The business of America is justice and securing liberty.
The butler did it.
The Capitalist Ferengi has Spoken.
The cautious seldom err.
The Challenger is gone, but the challenge is still there!
The characters in this message are recyclable.
The check's in the mail...
The chief cause of problems is solutions.
The chief obstacle to human progress is the human race.
The chief said the planet was to be eaten by a star goat.
The child had every toy his father wanted.
The child is father of the man -- Wordsworth
The chips are down, and the buffalo is empty.
The choice: Roll over or stand up to the challenge.
The Church of St. Humid the Incontinent.
The cinema is not a slice of life but a piece of cake.
The city is not a concrete jungle. It is a human zoo.
The clan of those without a clan -- Robert Lebel
The client who pays the least, always complains the most.
The Clown Prince Of Modemworld.
The consumer is not a moron, it is your spouse.
The cost of feathers has risen -- now even DOWN is UP!
The cost of liberty is less than the price of oppression.
The cost of living is high, but it's worth it.
The council of Magranthea thanks you for your visit.
The Counselor and I will be indisposed today. ■ Riker
The course of true anything never does run smoothly.
The covers of some books are too far apart.
The cow ate bluegrass and mooed indigo.
The current death rate? One per person, of course.
The Czech's in the mail. Sending Frenchman by FAX.
The D/L ain't over 'til the FAT table dings.
The darkest part of the tunnel is before the tool booth.
The Day of Judgement is approaching, or it is not.
The days of the digital watch are numbered
The Dead Shall Walk the Earth and Dine on Flesh.
The debate rages on: Is PL/I Bachtrian or Dromedary?
The deeper the sorrow, the less tongue hath it.
The Def. of Upgrade: Take old bugs out, put new ones in
The Democratic rule: "Confusion creates jobs!"
The desire to work is confined to classified ads.
The destination is unknown at the start of many journeys.
The devil can cite Scripture for his purpose.
The devil falls on account of his gravity.
The devil finds work for idle circuits to do.
The devil finds work for idle glands.
The Devil made me buy this 486!
The Devil made me do it!
The dew has fallen with a particularly sickening thud.
The difference between a virus and Windows? Viruses work!
The difference between ADVENTURE and ORDEAL is ATTITUDE.
The difference between sex and lust is inconsequential.
The discontented man finds no easy chair.
The dispensing of injustice is always in the right hands.
The dog ate my .REP packet.
The dolphins all disappeared on the same day.
The dolphins had long known of the destruction of Earth.
The early bird still has to eat worms.
The earth is 98% full. Please delete anyone you can.
The earth is like a tiny grain of sand, only heavier.
The easy way out usually leads back in.
The Electric Chair Choice: Regular or Extra Crispy?
The end is what usually justifies the diet.
The entire battle fleet was swallowed by a small dog.
The etchwork read "So Long and Thanks for All the Fish".
The eventual supremacy of reason should be accepted.
The evidence before the court is incontrovertible...
The exception proves the rule.
The FACTS keep interfering with my theories.
The family that bowls together, splits.
The farther you travel, the more immaterial your position
The fastest ewes and slowest rams produce the virgin wool
The fat lady just sang.
The fear of death keeps us from living, not from dying.
The fecal material has hit the air circulating device.
The fen is muddier than the sward.
The few ... the proud ... the Windowless
The fewer our wants, the more we resemble the gods.
The fewer the facts, the stronger the opinion.
The fires of dawn! The twin suns of Soulianis and Rahn!
The first myth of management is that it exists
The first sigh of love is the last of wisdom.
The first step towards philosophy is incredulity.
The first wealth is health.
The fish in the sea are as good as the fish removed.
The flogging will continue until morale improves.
The footprint of the owner is the best manure.
The Four Food Groups: crust, sauce, toppings, cheese.
The four food groups: coffee, ice cream, beer and pizza.
The French take care of themselves - except in wartime.
The fundamental flaws are hidden by the superficial ones.
The future is like the present, only longer.
The future just isn't what it used to be
The future's so bright, I gotta wear shades!
The future's uncertain and the end is always near.
The Galaxy is a rapidly changing place.
The galaxy is littered with ex-Pralite monks.
The gene pool could use a little chlorine.
The General Theory of Relativity is too specific.
The gods play games with men as balls.
The going got weird, and he turned pro.
The Golden Rule: He who has the gold, makes the rules.
The good old days: Beer foamed and dishwater didn't.
The government is the only vessel that leaks from the top
The graveyards are full of indispensable people.
The greater the ignorance the greater the dogmatism.
The greatest cunning is to have none at all.
The greatest fault is to be conscious of none.
The greatest headaches are those we cause ourselves.
The greatest of faults is to be conscious of none.
The greatest productive force is human selfishness.
The ground hung menacingly above his head.
The Guide will employ any who walk in and get ripped off.
The GW in GWBASIC stands for "Gee Whiz".
The happy and the powerful never willingly go into exile.
The hard disk you save may be your own.
The hardest years are between 10 and 70.
The heart is wiser than the intellect.
The heat of the moment can burn you for a lifetime.
The hell with the Prime Directive - Let's kill something.
The highest bidder catches the most politicians.
The history of mankind is the history of ideas.
The Hitchhiker's Guide is essentially a guidebook.
The Hitchiker's Guide is a wholly remarkable book.
The Hitchiker's Guide says there is a knack to flying.
The hole and the patch should be commensurate.
The Holy Roman Empire: neither holy, Roman, or an empire.
The horn of plenty is usually in the car behind you.
The hot dog is the homeless eagle of free enterprise.
The hours are good, the minutes are pretty lousy.
The human adventure is just beginning...
The human race is still in ßeta test.
The hurrieder I go, the behinder I get...
The important thing is never to stop questioning.
The incomprehensible thing about the world is that it is.
The Irish are fair; they never speak well of one another.
The irony of life is that no one gets out alive...
The Joy of Hex - hacking for pleasure.
The Joy of Sox - Boston and Chicago Baseball Teams.
The jumble of letters spelled two words, 'forty-two'.
The knowledge that a secret exists is half of the secret
The lab called: your brain is ready.
The laborer is worthy of his hire, only if his labor is.
The ladder of success is easier to climb when laid flat.
The last Christian died on the cross.
The last sound that it made was "Zap" .
The last thing I saw was this Big Blue Wave!
The latest model is available AFTER you by the previous.
The law disregards trifles, has it spoken to you recently
The law hath not been dead, though it hath slept.
The law neither does nor requires idle acts, wake up.
The law of intelligent tinkering: save all the parts.
The less a statesman amounts to the more he loves a flag.
The less things change, the more they remain the same.
The light seen at an end of a tunnel is at the wrong end.
The little I know, I owe to my ignorance - Sacha Guitry
The living world is a continuum in each and every aspect.
The longer the title, the less important the job.
The Lord giveth and the IRS taketh away.
The luck ordained for you will be coveted by others.
The Magic of Windows: Turns a 486 into a XT.
The majority isn't silent--the government is deaf!
The man who just ran me over looked a little familiar.
The mark of a true MBA : often wrong, but seldom in doubt
The masses are asses -- Alexander Hamilton
The medium is the message -- Marshall McLuhan
The meek are getting ready.
The meek may inherit earth. Those who dare, the stars.
The meek shall inherit 6'x3' plots of land.
The meek shall inherit the earth, but no mineral rights.
The mice will see you now.
The mind grows by what it feeds upon.
The mind isn't the first thing to go, just seems so.
The missiles have turned into a bowl of petunias.
The mistake you make is in trying to figure it out.
The mixed up werewolf mooned at the bay.
The moderator has spoken.
The Mome Rath hasn't been born that can outgrabe me.
The moon isn't waxing, it's dusting and vacuuming rugs.
The moon may be smaller than Earth, but it's further away
The more a man is ashamed, the more respectable he is.
The more known about people, the more to admire in dogs.
The more original a discovery, the more obvious it seems.
The more you complain, the longer GOD makes you live !
The more you cultivate people the more you turn up clods.
The more you know, the less you think you know.
The more you love, the more you *can* love.
The more you run over a dead cat, the flatter it gets.
The most dangerous food is wedding cake.
The most delicate component will be dropped.
The most expensive component always breaks first.
The most moving moments find us all without words.
The most popular form of birth control: The headache.
The most useless computer tasks are the most fun to do
The mouse with a single hole is quickly caught by the cat
The moving cat sheds, and having shed, moves on...
The moving cursor writes, and having writ scrolls on
The moving dog sheds, and having shed, moves on...
The music's kinda nice. My compliments to the clef.
The neat simple solution is always wrong.
The new temp turned out to be a Girl Friday the 13th.
The next 4,999 things were also coffins.
The next night they did it again, but with a Sony Walkman
The nuclear warheads are merely a courtesy detail.
The number you call from has been disconnected.
The number you have reached is not in service !
The object of war is to allow them die for their country.
The occipital area of my head seems to have impacted...
The OFFICIAL tagline of the 1996 Olympics!
The old make the rules, the young make up the exceptions.
The older I get, it seems the better I used to be.
The one who admits he might be wrong, is often right
The one who dies with the most taglines wins.
The only argument with the wind is to put on a coat.
The only certainty is that nothing is certain.
The only chance I get to talk is while my wife inhales.
The only difference between her and it is the lipstick.
The only dope worth shooting is Nixon.
The only dual standard I embrace comes from US Robotics.
The only excuse for God is that he doesn't exist.
The only good lawyer is a -- naw, not even then...
The only good tagline is a stolen tagline!
The only heavy breathing I ever hear is after aerobics.
The only race worth winning is the human race.
The only realities are the atoms and empty space.
The only red menace in America is the sunburn.
The only road to success is always under construction.
The only rose without thorns is friendship.
The only roses without thorns are love and friendship.
The only stupid question is the one you forget to ask.
The only thing more reliable than magic is one's friends.
The only thing shorter than a weekend is a vacation.
The only thing worse than a sorcerer is his apprentice.
The only time I open my mouth is to change feet.
The only victory over love is flight.
The only Vogon a Dentrassi liked was an annoyed one.
The only way to get rid of temptation is to yield to it.
The only way to judge the future is by knowing the past.
The only winner of the War of 1812 was Tchaikovsky.
The only winning move is not to play.
The open hand of desire wants everything.
The opposite of a big bang is a gnab gib.
The opposite of a great truth is also true.
The orator, with a flood of words and his drop of reason.
The organization and definition of knowledge is critical.
The ORIGINAL tagline (one-liner) author: Henny Youngman.
The other day I was feeling so low I got my face slapped.
The other line always moves faster. 'Til you change lines
The other line moves faster.
The part you kick.
The past always looks better than it was when it was here
The past is not what it will be.
The past is now truly like a foreign country.
The past should be a mental springboard - not a hammock.
The past should be a springboard, not a hammock.
The pen is the tongue of the mind.
The person one becomes depends on what one has been.
The person who knows what is going on must be fired.
The picture is backwards, Tom said negatively
The picture of health requires a happy frame of mind.
The Plastic Pillar represents Science and Reason.
The plural of spouse is spice.
The point's that we're dilettantes, eccentrics, layabouts
The Poles are now telling free market jokes.
The price of greatness is responsibility.
The price of purity is purists.
The probability of success if not almost 1 is usually 0.
The problem is not if machines think, but if people do.
The problem isn't the wages of sin; it's the withholding.
The problem isn't the wages of sin; it's the withholding.
The problem with the gene pool is there's no lifeguard.
The Procrastinators Anonymous meeting has been postponed.
The proof is the phylogeny of plant-animal interactions.
The proof of a system's value is its existence.
The purification of politics is an iridescent dream.
The Question and the Answer are mutually exclusive.
The question is: "(2 * B!) OR NOT(2 * B!)"
The quick brwn fx jumpd ovr -- sorry, wrong program.
The race from stupidity is to the driven, not the swift.
The Ranger isn't going to like it, Yogi.
The ratchet wheel of politics is self-destructive greed.
The Reader's Digest has pages for people like you.
The REAL crisis is Bill and Hillary!!!
The reality of a place is what people remember of it.
The realm of good taste belongs to non-smokers.
The regulars thought his acceptance speech overeffusive.
The rich get richer, and the poor get more kids.
The right to be left alone is the beginning of freedom.
The right to be left alone is the root of all freedom.
The ripest fruit falls first.
The road to a friend's house is never difficult nor long.
The road to success is under construction...
The robots aren't enjoying it, sir.
The room for improvement is a room never full.
The roots of honesty and virtue lie in a good education.
The same to you fella!!
The San Francisco Ku Klux Klan wears topless sheets.
The saucer crushed expensive property, and also Harrods.
The scariest words known to man: "We need to talk."
The scenery only changes for the lead dog.
The sea hath bounds, but true deep desire hath none.
The second time I looked up Gullible I felt so SILLY!
The secrecy of my job prevents me from knowing what I do.
The secret is to bang the rocks together, guys.
The Secret to Immortality is .%&@{ CARRIER LOST
The sex was so good even the neighbors lit cigarettes.
The shabbiest truth is better than a well-dressed lie.
The shortest answer is doing.
The shortest distance between two puns: a straight line.
The show-off is always shown-up in a show-down.
The Side with the Simplest Uniform Wins
The sign above the front door read "Come Outside".
The situation is under control as of this moment in time.
The solution to a problem changes the problem.
The soul would have no rainbows if the eyes had no tears.
The speed of the leader determines the rate of the pack.
The star of riches is shining upon you.
The Steel Pillar represents Strength and Power.
The sting is in the hand of the bee holder!
The stranger, the better.
The sun always rises on the most tired people.
The sun is never the worse for shining on a dunghill.
The sun shines even on the most wicked of people.
The superfluous, a very necessary thing -- Voltaire
The surest way to be late is to have plenty of time.
The tagline has a design fllaaw.
The term "Unethical Attorney" is redundant.
The test of courage comes when we are in the minority.
The test of tolerance comes when we are in the majority.
The test: Behavior in times of controversy and challenge.
The thing I mind losing the most.... is my mind
The thing most generally raised on land is taxes.
The three freely convertible currencies don't count.
The time is right to make new friends.
The time of waiting is over.
The time to read the instructions is before you start.
The Toe that can be stubbed is not the true Toe.
The transition from cocktail to raiding party came easily
The tree of liberty is watered with the blood of tyrants.
The trick in overcoming temptation, is to play dead.
The trodden path is the safest.
The trouble with a kitten is that, eventually it's a cat.
The trouble with political jokes is they get elected.
The truth doesn't hurt unless it ought to.
The truth is one thing that nobody will believe.
The truth will ouch.
The truth, if you recognize, will clear out your sinuses.
The Tsongas ended, but the malady lingers on.
The UARTs canna' take much more of this, Captain!
The UARTs won't take this speed, Captain!
The ultimate in courage? Two Cannibals having oral sex.
The ultimate Law: All general statements are false.
The ultimate Turn on. When they shoot at you.. and miss!
The universe is a figment of it's own imagination.
The Universe is big enough to look after itself.
The universe is laughing behind your back
The universe is two parts, Earth, and everything else.
The Universe was dictated but never signed.
The USS Reagan -- "To boldly ... um ... I forget..."
The Vatican Express Card. Don't leave Rome without it.
The vortex is ready for you, you must come, follow me.
The wages of sin go unreported.
The war seems to be getting the robots down.
The warranty: Bold print giveth & fine print taketh away.
The way to a man's heart is through his veins
The way to a man's heart is through the left ventricle.
The weed of crime bears bitter fruit.
The welfare of the people is the chief law.
The wife of a careless man is almost a widow.
The wildest colts make the best steeds.
The wise do sooner what fools do later.
The wise learn more from fools than fools from the wise.
The woman cries before the wedding; the man afterward.
The Wooden Pillar represents Nature and Spirituality.
The word "dog" does not bite -- William James
The word bulldozer wandered through his mind.
The word for today is LEGS. Let's spread the word!
The word today is Legs ... Spread the word.
The word walked right out of my mouth.
The word yellow wandered through his mind.
The words of the prophets are written on the subway walls
The work praises the man.
The world has gone to bed, darkness won't engulf my head.
The world is a beautiful book, for those who can read it.
The world is coming to an end. Please log-off.
The world is like a cactus except the pricks are inside.
The world of today is run by "C" students of yesterday.
The world's a tuxedo, and I'm a pair of brown shoes...
The World's come to an end? Why wasn't I notified?
The world, as we know it, has come to an end.
The world: A comedy for thinkers; a tragedy for feelers.
The worst bankrupt is the person who has lost enthusiasm.
The worst hatred is that of relatives.
The worst possible set of circumstances is bound to occur
The worst thing about censorship is .
The worst thing men is that when not drunk they are sober
The written word preserves the wonders of the human mind.
The wrong way always seems the more reasonable.
The Young Conservatives from Sirius B, are they here?
The young know the rules, the old know the exceptions.
Theater: Holding a mirror up to a keyhole.
Their are trhee things wrong here.
Then shalt thou count to three. No more, no less...
Theologians claim this is a load of dingo's kidneys.
There ain't no such thing as a free lunch.
There are a couple of things I like about that girl.
There are good five-cent cigars, but they cost two bits.
There are many ways to show affection.
There are more dead than living and they are increasing.
There are more old drunkards than old doctors.
There are no answers at best a few possibly good guesses.
There are no answers, only cross-references.
There are no errors in this book, except this one.
There are no games on this system.
There are no limits for journeys of the mind.
There are no rules unless you choose to invent rules.
There are no rules.
There are no simple answers, only big challenges.
There are no stupid questions, only stupid answers.
There are some defeats more triumphant than victories.
There are three things that come next, uh four.
There are times when I long for a Klingon woman. ■ Worf
There are two reasons for doing: one good, the other real
There are two sides to a question, politicians take both.
There go my people. I must follow for I am their leader.
There is a certain light within a man of light.
There is a skeleton in every old house and old horse.
There is a tiny plant here, murmuring "water, water".
There is absolutely no right way to do a wrong thing.
There is always a law against doing anything interesting.
There is always a mistake just waiting for you to make.
There is always danger for those afraid of it.
There is always someone worse off than yourself.
There is an answer, I'll have to think about it.
There is another...
There IS intelligent life in the universe - it ignores us
There is more at stake here than our lives.
There is more to life than increasing its speed.
There is never truth without sufficient proof.
There is no defense except stupidity against a new idea.
There is no effective vaccine to prevent spreading yawns
There is no excuse for incomprehensible good luck.
There is no gravity, the earth sucks.
There is no job so simple that it cannot be done wrong.
There is no joy in Mudville, mighty Casey has struck out.
There is no limit on how many you can love.
There is no remedy for sex but more sex.
There is no substitute for a genuine lack of preparation.
There is no such thing as a "Fail Safe" design.
There is no such thing as a bloody Cat License.
There is no such thing as bravery; only degrees of fear.
There is nothing more impartial than a hanging judge.
There is nothing to scratch but the surface.
There is one God, but which one is He?
There is only one sure way to throw dice: away.
There is only one way to see the light; soon as possible.
There is something altogether strange going on.
There is where you wanna be, here is where you're stuck.
There isn't a door which can stop a lover or a cat.
There must always be some novelty.
There once was a [ ] from [ ] whose [ ] was
There really is an Easter bunny, I know cause I ate him.
There was a point, but it has temporarily escaped my mind
There was nothing here; and now it's gone!
There was this door to which I found no key.
There was this veil through which I could not see.
There wasn't a bus due for two million years.
There were computers in Biblical times. Eve had an Apple.
There will be big changes for you but you will be happy.
There's a brain in my tumor.
There's a fine line between wise and wierd.
There's a lot to be said for a sharp blow to the head.
There's a plot afoot to make me think I'm paranoid.
There's a time to fight, and a time to hide out.
There's a whole generation of people out there my age.
There's a Yankee in my closet - will trade for skeleton.
There's always one more bug.
There's always one more SOB than you counted on.
There's always someone better, or worse off, than you are
There's an answer to every problem. Sometimes it's "No."
There's at least one fool in every married couple.
There's Beta Days Ahead...
There's bound to be a gargoyle here somewhere.
There's just not enough sax and violins on television!
There's just not enough sax and violins on TV.
There's more than one way to skin a cat.
There's more to BBSing than meets the modem.
There's more to life than Pizza, but not much....
There's never a cop around when you need one.
There's never time to do it right, but always again!
There's no accounting for taste.
There's no fool like an old fool - can't beat experience.
There's no future in time travel.
THERE'S NO GOVERNMENT LIKE NO GOVERNMENT!
There's no intelligent life here Scotty -- Beam me up
There's no place like home.
There's no second chance for a good first impression.
There's no skeletons in my closet.
There's no such thing as gravity. The whole world sucks.
There's no there there. - Gertrude Stein on Oakland
There's not enough sax and violins on television.
There's nothing wrong with DOS that Unix wouldn't fix.
There's one thing about baldness, it's neat.
There's safety in numbers -- .357 for example...
There's so much to say but your eyes keep interrupting me
There's something inside your head...
There's something on my mind. Dust.
Thesaurus: a dinosaur with a great vocabulary.
Thesaurus: ancient reptile with an excellent vocabulary.
These are strange times we live in...
These are the days of Miracle Whip and Wonder Bread.
These are the times that really try men's soles.
These aren't dances. Their fertility rites with lyrics.
These aren't my shorts -- they bend !
These days govt. is a four letter word.
These Days There's No Arrest For The Wicked
These guys are entitled to their own view of the universe
These things on my nose aren't just for show. ■ Ro
They also serve who only stand and wait.
They are slaves who fear to speak for the fallen & weak.
They believe in obliteration of all other life forms.
They DO make 'em like they used to.
They do not love that do not show their love.
They flutter behind you, your possible pasts...
They know enough who know how to learn.
They made sure they sent your lot off first, did they?
They must be thinking of Ostend Hoverport.
They must have the defects of their qualities -- Balzac
They never let you live it down. One little mistake.
They said the time was ripe: then it fell off the tree.
They said they needed a holiday and set off in a raft.
They sat around a rock doing documentaries of themselves.
They that sow the wind, will reap the whirlwind.
They who dig pits shall end falling into them.
They who drink beer will think beer.
They're coming to take me away, HA HA!
They're only trying to make me LOOK paranoid!
They've been experimenting on you, I'm afraid.
They've discovered how to turn excess body fat into gold.
They've garble warble farble!
They've got as much sex appeal as a road accident.
Thhhufferin' thuccotash. That's dethhhhpiccable!
Thhis takline iz slitely out of cofus.
Thin may be in, but fat's where it's at!
Things are getting so bad, muggers won't go out alone.
Things are more like they are now than ever before.
Things are more like they used to be than they are now.
Things are not always as they seem - Mandrake
Things could only be worse in Cleveland.
Things equal to nothing else are equal to each other.
Things happen fast, history books add a chapter a week.
Things in this room do not react well to bullets.
Things licked from knives or spoons have no calories.
Things will get worse before they get better, if they do.
Things worth having are worth cheating for.
Things worth having are worth stealing.
Things you never hear: "Hand me that piano!"
Think "HONK" if you're a telepath
Think and you won't sink.
Think carefully before wishing, it might just come true.
Think hard now. Which one is Shinola?
Think much, speak little, and write less.
Think twice before accepting the lowest bid.
Think you got it bad. My other PC is an Osborne.
Think! While it's still legal!!
THINK! or THWIM!
Thinking ill of someone can be a two-way street.
Third of Five, six of one, half a dozen of the other
Thirty seconds into the conversation, and he'd blown it.
This ain't as good as sex---but it's safer these days.
This Arthur Dent, what is he, man or mouse?
This BBS has achieved Air superiority.
This bug's for you.
This button doesn't do anything. Please press it again.
This Charlie Brown must have been a very wise man.
This contest has to be the dumbest thing I've ever seen.
This country needs more unemployed politicians.
This discussion is hanging by a thread.
This door is baroque; please call Bach later.
This fellow's wise enough to play the fool.
This file will self-destruct in five minutes.
This fortune intentionally not included.
This game is exceedingly simple. ■ Data
This guy has blown me off for the last time. ■ Geordi
This has been a test of the Emergency Tagline System.
This information fills a much needed gap.
This is a *dangerous* place.
This is a chain tagline. I have now been stolen 8 times.
This is a good day to let down old friends who need help.
This is a gun for making people miserable with.
This is a hell of a time for a walk in the park. ■ Geordi
This is a keeper!
This is a new model tagline. Pleas read the instructions
This is a stick-up! Fax me all your money!!
This is a Tagline mirror> <rorrim enilgaT a si sihT
This is a test of the emergency tagline stealing system.
This is a test of the Emergency Tagline System.
This is a test. Please ignore -- oops, too late ;').
This is Abuse. Arguments are down the hall.
This is all Sens-So-Tape.
This is an ATM: Press F1 for $20 F2 for $50 and wait.
This is an egg. This is a frying pan. Any questions?
This is an expanded Tagline. Unlike an extended Tagline..
This is another fine myth you've gotten me into.
This is Elvis. Any messages for me?
This is from the mouth of someone who can confirm it.
This is going to fly?
This is my latest tagline...
This is my only tag line.
This is NOT Burger King. You do not get it YOUR way.
This is not my first temporal anomaly.
This is obviously some strange usage of the word safe.
This is only a test - KABOOM!!!!
This is polite after dinner conversation, is it?
This is probably the best button to press.
This is ridiculous.
This is the beginning of the end -- Talleyrand
This is the most original tagline I've ever seen...
This is the time of tension between birth and death...
This is the voice of world control. I have brought peace.
This is your pizza. T++i$ |z YoUg !zza ++i+X+ anc+O/ie$
This is your sysop. ┬├┤¡s ìs ÿou⌠ s╦sop óñ δτugæ.
This isn't a holodeck, darling, this is real. ■ O'Brien
This line intentionally left blank.
This machine is an instrument of terror.
This message being sent from the distant planet "Whoa"
This message cleared by Iraqi censors.
This message is $hareWare! To register, please send $20
This message made from 100% post-consumer data!
This message was typed on recycled phosphorus
This message will self-destruct in 30 seconds.
This message written by Zippy the Dolphin.
This meszage has bin spel chequed.
This mouse is loaded, who's the designated driver?
This never would've happened if I were captain. ■ Riker
THIS ought to get a rise out of him... <snicker>
This rerun due to Tagline Writer's strike.
This screen is microwave, dishwasher and fly safe.
This sentence is a !!! premature punctuator
This sentense contains three errurs
This software will eliminate all misakes.
This space intentionally left blank.
This space left blankish.
This species has amused itself to death.
This tag is old, wore-out, and stolen <323> times!
This Tag line is self referencing!
This TAG line stolen from Larry Bristol.
This tagl ineh asto oman yfou rlet terw ords.
This tagline Closed Captioned for hearing impaired.
This Tagline covered under Official Secrets Act.
This tagline does not count. Please do not read it.
This tagline exploits the illiterate.
This tagline has STAR quality.
This tagline intentionally left blank.
This tagline is baroque; please call Bach.
This tagline is being guarded by the CIA
This tagline is lost!
This tagline is made just for @TO@!
This tagline is not suitable for family viewing.
This tagline is only for the living.
This tagline is printed on 100% recycled material.
This tagline is SHAREWARE! To Register, send me $10
This tagline leaks silicone.
This tagline Made in the U.S.A.
This tagline may contain an encrypted satanic message...
This tagline no verb.
THIS TAGLINE NOT TO BE REMOVED UNDER PENALTY OF LAW.
This tagline now supports Soundblaster!
This tagline R-rated. This part is nude ->
This tagline rated PG-13 - Pretty Good
THIS TAGLINE REJECTED!! - Meaning Not Found!!
This Tagline Soon To Be A Major Motion Picture.
This tagline stolen by me, or was it you?
This tagline stolen by Silly Little Me!
This tagline stolen from Daniel Glick...
This tagline was filmed before a live studio audience.
This tagline was reclaimed and is not yet stolen.
This tagline waterproof to 250 ft.
This tagline will self-destruct in 5 seconds.
This won't hurt, I promise.
This ∞∞ tagline has ∞∞ a lot of ∞∞ bugs in ∞∞ it ...
thisisnotataglinebutyoucanthinkofitasoneifyoumustthatsok
thistaglnprdcdbypkzip
Thomas Edison invented the "Light Emitting Resistor".
Those at war with others are not at peace with themselves
Those on the cutting edge bleed a lot.
Those unaware are unaware of being unaware.
Those who can't write, write manuals.
Those who can, do. Those who can't, supervise!
Those who can, do. Those who can't, simulate.
Those who do not think do not deserve to have a brain.
Those who fought for it know the true taste of freedom.
Those who generalize are generally wrong.
Those who know the least know it the loudest.
Those who play with cats must expect to be scratched.
Those whom the gods love grow young.
Those without heads do not need hats.
Thou shall not kill, unless it's for dinner!
Thou shalt not admit adultery.
Thou shalt not covet thy neighbor's tagline.
Thought I wouldn't notice you sneaking off, eh?
Thought: Why does sour cream have an expiration date?
Thousands of journeys have a start but no end.
Three Cheers = 3*(HIP*2 + Hooray!)
Three lefts make a right.
Thrift is a wonderful virtue - in an ancestor.
Thrifty means spending other people's money.
Throw the keyboard out the window to continue.
Tickle your ASCII with a feather?
Tid-Bits: what you get when you blow up a Tid....
Tig Old Bitties Are More Fun
Tilting at windmills hurts you more than the windmills.
Time - what there's too much of on an XT.
Time - yet another method for depressing ourselves.
Time and pain together really get me down.
Time drags when you're guilty.
Time flies like an arrow, but fruit flies like a banana
Time flies like wind. Fruit flies like pears.
Time flies when you don't know what you're doing.
Time flies, you say? Ah, no! Alas, Time stays, we go.
Time for a cold shower!
Time for my morning SysEx dump.
Time has a wonderful way of weeding out the trivial.
Time heals all wounds, but the belly button remains.
Time is a great teacher, but it kills all it's pupils.
Time is an illusion. Lunchtime doubly so.
Time is not currently one of my problems.
Time is precious, but truth is more so.
Time is so everything doesn't happen at once.
Time is the dressmaker specializing in alterations.
Time is the worst place, so to speak, to get lost in.
Time just keeps slipping into the future...
Time on your hands? . . . get Windows.
Time really flies when you don't know what you're doing.
Time slows if you're on the outside of the bathroom door.
Time Stands Still! Feature at 10:00, or whenever....
Time takes time.
Time to take the bull by the tail & face the situation...
Time travel gives me nosebleeds.
Time travel is increasingly regarded as a menace.
Time travel seminar next week. Did you attend?
Time travel was discovered simultaneously, at all periods
Time: an illusion perpetrated by the makers of space.
Time: can't touch it, but you can be billed $50hr for it.
Timothy Leary's dead...did anyone bother to tell him?
Tinker Bell, the Computer hackers phone company.
Tip the world and everything loose lands in Los Angeles.
Tippecanoe and UNIX, too.
Tips: Wages we pay other people's hired help.
Tired of the same old crap? Eat more corn...
Tit, more than a baby feeder, it's for the paw.
To a cat, "NO!" means "Not while I'm looking."
To a dog his owner is Napoleon; hence their popularity.
To a frog, time's fun when you're having flies....
To a Kid "NO" means "NOT WHILE YOU ARE LOOKING"
To atone for national sins, British eat pub sandwiches.
To avoid seeing a fool, break your mirror.
To be a Californian means to have faults others don't.
To be a human without passion is to be dead.
To be born rich is an accident; to die rich is a miracle.
To be or not to be... What a stupid question.
To be or not to be? Whatever.
To be too clever is to be stupid.
To be trusted is a greater compliment than to be loved.
To be, or what?
To boldly go where no one would want to go ...
To boldly split infinitives that no one has split before
To boldy dial where no modem has dialed before.
To climb a ladder, you begin with the bottom rung.
To cure insomnia, get lots of sleep.
To do injustice is more disgraceful than to suffer it.
To do nothing is in every person's power.
To do two things at once is to do neither
To eat is human. To digest divine.
To Err is Human -- And so much Fun!
To err is human and stupid.
To Err is Human, but very costly in an airplane crash.
To Err is Human, to forgive is not Company Policy.
To Err is Human, to really foul up requires a computer.
To err is human. To moo, bovine.
To err is human. To purr feline.
To Err is Human; to blame it on someone else is politics.
To Err is Human; what's your excuse?
To Err is Human; with blondes it's mandatory.
To establish voice contact, please yell into the keyboard
To every rule there is an exception, and vice versa.
To excel at what you do, you must love doing it.
To excel when you try, always reach for the brass ring.
To get ahead and stay ahead, use your head.
To get back on your feet, miss two car payments.
To give happiness is to deserve happiness.
To Have is to Want more...
To have the last word with a woman - apologize!
To heck with reality ... Where's a good fantasy?
To hell with justice...I want blood...
To hit the target, shoot. Call what you hit the target
To iterate is human; to recurse, divine.
To keep your milk sweet, leave it in the cow.
To know a culture you must dirty your feet in its soil.
To know the road ahead, ask those coming back.
To laugh at men of sense is the privilege of fools.
To Life Immortal!! or we'll kill you! The Advocacy
To live in the hearts we leave behind, is not to die.
To live long, it is necessary to live slowly.
To live now, first come to terms with your past.
To live well, know the difference between good and evil.
To love her was a liberal education.
To love is to be vulnerable.
To make an elephant fly, you first take a long zipper...
To make pleasures pleasant, shorten them.
To not discern the important, makes you unimportant.
To our wives and sweethearts -- may they never meet.
To overvalue something is a form of lying.
To pick a fight with a Silastic Armorfiend, just be born.
To publish is to appear in public with your pants down.
To QWK, or not to QWK. That 'tis the Question!
To really know a relative, divide an inheritance with him
To reform a man, begin with his grandmother.
To refuse praise is to seek praise twice.
To return home, you must walk backwards in time & space.
To revalue the leaf, we will have a defoliation campaign.
To risk nothing is to risk everything.
To Ski or Not to Ski THAT is the Question!
To some, sex is second best to power.
To speak of mere words is like speaking of mere dynamite
To speed is human; to get caught, de fine.
To steal this tagline press <CTL> <ALT> <DEL> now.
To summarize the summary. people are a problem.
To tag or not to tag, that is the question...
To teach is to learn twice...
To the British, George Washington was a terrorist.
To the Caliph I am dirt, but to dirt, I am Caliph.
To the old cat, the tender mouse.
To those who can see, a picture is a wordless poem.
To tolerate everything is to teach nothing.
To understand other's miseries, look at their pleasures.
To use the driver with Win3.x, install MISSDAISY.
To wake a tiger, use a long stick.
To whom should I go to for some self-help?
TOAD - n. What happens to an illegally parked frog.
Toad...Illegally parked frog
Today has been a long year!!!!!!!!!!
Today I have grown taller from walking with the trees.
Today is a "Honey do day" Honey do this, honey do that..
Today is a day for firm decisions ..... Or is it?
Today is not your lucky day. You won't have one this year
Today is the day to bribe a high-ranking public official.
Today is the first day after yesterday.
Today is the first day of the rest of your life.
Today is the first day of the rest of your mess.
Today is the last day of your previous life.
Today is the scene of the accident.
Today is the tomorrow you worried about yesterday.
Today Mickey Mouse denied he wears a Bill Clinton watch.
Today on the menu we feature: pi of the day.
Today's "politically correct" = yesterday's McCarthyism.
Today's special: Misspelt words at no extra charge.
Today's subliminal message is
Today, take an astronaut to launch.
Toil is most pleasant when done.
Tolkien is Hobbit forming!
Tomorrow is another day, but it'll suck too.
Tomorrow never comes.
Tomorrow will be yesterday soon enough.
Tonight's forecast: dark, followed by light.
Tonight's the night: Sleep in a eucalyptus tree.
Tonight, no hostages for you and no prisoners for me.
Tony the Tiger Murdered! Cereal Killer Suspected!
Too bad women don't have pull-down menus and online help!
Too many notes...
Too many pages make a tome.
Too many pieces of music end too long after the end.
Too many pray for peace with their fists clenched.
Too many Thugs..not enough Slugs...
Too many wild asses are not yet extinct.
Too much of a good thing is wonderful.
Too often justice is incidental to law and order.
Too old to know better, too young to resist!
Too stupid to know what I'm involved in.
Too tacky!
Too tame...
Tools do nothing. Tools and a brain build things.
Topologists are just plane folks.
Tornados are both Vortical and Harmizontal.
Totally non-offensive tagline. G-rated.
Toto, I don't think we're in DOS anymore...
Toto, I've a feeling we're not in Kansas any more.
Toughest part of a diet? Shutting up about it.
Tourists: The only foreigners the French ever drove out.
TOWER: "Say position." PILOT: "Position."
TOYOTA: By the same great guys who attacked Pearl Harbor!
Trackman(men) have bigger balls.
Tradition is always the last refuge for the incompetent.
Tradition is no excuse for insensitivity or racism.
TRAMP? But I got out!!! - Kelly Bundy
Transfer Rate: speed cash moves from wallet to vendor.
Transistors blow before a protecting fast acting fuse.
Transporter room, beam that tagline up immediately!
Transporting really is the safest way to travel.
Trapezius - a person who performs on the trapeze.
Trash this, okay?
Travel important today; IRS men arrive tomorrow.
Treat earth as you should have your Mother. It is.
Treat everyone you meet as you want to be treated.
Treaties like roses and girls - they last while they last
Trees moving back & forth make the wind blow.
Trees moving back and forth are what make the wind blow.
Trek Classic -- Who Needs Another Generation?
Trek excuse #1: The Prime Directive clearly forbids it!
Tribble: * Tribble dominatrix: */~~
Tried telling my wife XMS meant 'Xtra Marital Sex'...
Tried to play my shoehorn... all I got was footnotes!
Triumphant: used to drive a Spitfire.
True dignity: Remaining aloof during a prostate exam.
True irreverence is disrespect for another man's God.
True life begins after kids leave home and the dog dies.
True Multitasking = 3 PCs and a chair with wheels!
True multitasking: reading in the bathroom.
True terror: A female Klingon with PMS.
Truncated: What happened to the peanut at the zoo
Trust everyone, but always cut the cards.
Trust in God -- But tie your camel tight!
Trust in God, but backup your hard disk!!!
Trust is the foundation. Without it you don't feel safe.
Trust me, would I lie to you..... again?
Trust requires time -- and experience.
Trust your neighbors, but brand your cattle.
Trust yourself. You know more than you think you do.
Truth is just another misconception.
Truth is shorter than fiction.
Try again.
Try cooling coffee by holding it closer to your heart.
Try DEVICE=MACHINETHATGOESPINGGGG.
Try downloading GETALIFE.ZIP!
Try it, you'll like it!
Try to divide your time evenly to keep others happy.
Try to get rid of junk mail, but income tax forms arrive.
Try to look unimportant...the enemy may be low on ammo...
Trying to find myself...Anyone seen me lately?
Trying to get some sleep here.
Trying to relax is a great strain on my nerves..
Trying to think of a better tagline...
Trying to think of a good tagline...
TTFN!
Tumor - an extra pair.
Turbo mode: Warp speed.
Turn your 486 into a Gameboy: Type WIN at C:\>
Turn your 486/50 into an XT - Run Windows 3.0.
Turtle Wax is expensive because turtle ears are so small.
TV - Time Vacuum
TV advertising is the rattling inside a swill bucket.
TV is a medium; anything well done is rare.
TV is like a steak - a medium rarely well done.
TV sports program: jockumentary
TV: If it's not a hit in 10 minutes, yank it off.
Tweedledum and Tweedledee agreed to have a battle...
Twenty-four hour banking: I just don't have time for it.
Twin tries suicide and kills brother by mistake!
Twinkies have a half-life, but Velveeta is eternal.
Twinkle, Twinkle Little Star, Wonder what you really are.
Twisted mind? No, just bent in several strategic places.
Twit Key - Touch to eliminate static.
Two can live as cheaply as one, for half as long.
Two company, three's an orgy.
Two guys walk into a bar.... *clang* *clang* "OOF!" "OW!"
Two heads are better than none, I think.
Two is company, three is an orgy.
Two men walk into a bar. You'd think one would notice.
Two most common elements: hydrogen, stupidity
Two new faces to be placed on Rushmore: Bill Clinton
Two of perfect virtue: one dead, the other yet unborn.
Two sexes. One works hard, the other is female.
TWO THINGS ARE UNIVERSAL. HYDROGEN AND STUPIDITY.
Two thumbs down!
Two thumbs up!
Two Truths: 1. There is a God. 2. You're not Him.
Two Wongs can't make a white.
Two writes don't make a novel.
Two wrongs are only the beginning!
Two wrongs do not make a right, it takes three or more.
Two wrongs don't make a right. Try three.
Two wrongs won't make a right, but three lefts do!
Two's company. Three's an orgy.
Typing tutorial programs; mice killers.
Typos? Blame my cat.
UART my baud and my path, they comfort me.
UART my sunshine, my only sunshine. You make me happy...
UART the sunshine of my life...
UART what you eat.
UART?.. Me Science?
Ubiquity immediately precedes obscurity.
UFO's are for real: the Air Force doesn't exist.
UFO's are real. The Air Force doesn't exist!
Uh oh. Your zip file is open!
Uh, forget the rope Luke... I thank he's already dead.
Uh, yeah...I MEANT to do that!
Ultimate office automation: networked coffee machines.
Um, l-look, if we built this large wooden badger....
Umbilical cord - part of a parachute.
Unable to find Jolt Cola and twinkies! Programmer Quits!
Unable to load REALITY.SYS -- Invalid Parameter: /UTOPIA
Unable to locate Coffee -- Operator Halted!
Unable to locate Pepsi -- Operator Halted!
Unable to locate TEAEARLGREY.HOT -- Enterprise halted!
Unattended maidens will be ravished...(sign in biker bar)
Unauthorized amphibians will be toad away!
Unbelief in one thing springs blind belief in another.
Unbelievably, this BRAND NEW tagline has NOT been stolen!
Under these clothes I am totally naked...
Undetectable errors are always infinite in variety.
Uneasy lies the tooth that wears a temporary crown.
Uninsured? Call San Andreas Equity at 310-NO-FAULT.
Uninterested Test Version
Universal extinction eminent... please log off now...
UNIX are lousy lovers.
UNIX, the MF of all DOS's.
Unix? I can't even do ONE thing at once.
Unless to thought is added will, Apollo is an imbecile.
Unofficial host of the Off-Topic conference.
Unrecoverable Application Error - Detonation follows.
UNRECOVERABLE USER ERROR - Terminating current user
Unregistered Evaluation Copy -- WHAT'S IT TO YOU?
Unregistered Evaluation Tagline
Unstable condition, a symptom of life.
Until Eve arrived, this was a man's world.
Until he made Colonel he was a Major Payne.
Unzip..Expand..What kind of pervert came up with THAT?
Up against the wall red-necked mother...
Up late? COPY caffeine.com C:\nervous\system
Up Thine!
UpLode, DownLode, ImpLode, ExpLode!
UPS: Unintelligible Procomm Script
Urine - opposite of your out.
Urine: Baseball term: Opposite of "Your out."
Urine: Opposite of you're out
Ursa Minor Beta, the most appalling place in the universe
USA - at times is seems to be a subsidiary of Japan, Inc.
USA in Wonderland. Vote Tweedledum (R) or Tweedledee (D)
USAir = (U)nderwater (S)eating (A)vailable (I)n (R)ear.
Use credit cards for convenience, never for credit.
Use DEVICE=EXXON to screw up your environment.
Use it up, wear it out, make it do, or do without!
Use it, or lose it.
Use PsychoModem, the telepathic protocol!
Use Saddam Condoms, for those who always pull out late.
Use tasteful words, you might have to eat them later
Use the brains IBM gave you!
Use Your Head...It's the little things that count.
Use your own tagline, this one's MINE!!
Use your wit to amuse, not abuse nor confuse the stupid.
Used Car: Not what it is jacked up to be.
Used Iraqi rifles for sale: Dropped once, never fired...
Used Iraqi rifles for sale: dropped once, never used.
User - a technical term used by computer pros. See idiot.
USER ERROR: Replace user and press any key to continue.
User Error: Replace user, hit any key to continue.
User Friendly, if you don't use it - its friendly.
User Friendly: Never having to say "I read the manual."
USER: word computer pros use when they mean "idiot."
Users: Keep them dry and don't feed them after midnight.
Users: To keep them dry don't water them after dinner.
Usually insane; in lucid moments merely stupid.
Tired of the same old crap? Eat more corn...
Valuable things are not cheap.
Value of program is proportional to weight of its output.
Vamoose ya little varmint! - Data
Varicose veins - veins which are very close together.
Varicose veins: Veins that are very close together.
VCR's are a way to defeat time.....
Vegetarians eat vegetables; I am a humanitarian.
Velcro, super glue, duct tape, post-its, and OS/2.
Venality - the study of veins.
Veni, Vidi, Visa - I came, I saw, I shopped.
Verbosity leads to unclear, inarticulate things - Quayle
Vini, Vidi, Velcro...I came, I saw, I stuck around.
Virgin Wool: Wool from UGLY Sheep!
Virginity like balloon. One prick, all gone.
Virtual reality is a contradiction.
Virtual: not knowing where your next byte is coming from.
Virtue has Never been as respectable as money.
Virtue is easy for an ugly woman.
Virtue is it's own punishment.
Virus successfully installed. Trash FAT now? (Y/N)
Virus writers: Impotent programmers.
VirusScan - "Windows found: Remove it? (Y/y)"
Visualize Whirled Peas
Vitamin C deficiency is apauling.
Voce e' fiscal de taglines o o que?
Vodka + milk of magnesia: Phillips screwdriver
Vogon poetry is the third worst in the universe.
Void where prohibited.
Volksmodem is down. In fact, it's fahrfromwurken...
Volume in drive C: is TOO LOUD!
Don't blame ME! I voted "None of the Above" for President.
Vote --> "Deport all of the above" in `94.
Vote anarchist
Vote early, and vote often.
Vote for abolishment of public display of butt-cracks.
VP in Charge of Naughty Bits: Puzzle-A-Puma, LTD
Vujà Dé: The feeling that you've never been here before.
Klingons NEVER bluff.
Vulcans NEVER bluff.
Vulgarity: The conduct of others.
Vultures only fly with carrion luggage
VîτÜε¿!¿ Wε dÖÑ't gÖt ÑÖ tîÑkîÑg vîτÜε!!!
W)here Y)our S)tupid I)nterface W)eathers Y)our G)enius.
W-E-A-P-O-L-O-G-I-Z-E-for-the-I-N-C-O-N-V-E-N-I-E-N-C-E
Waffle softly and talk a bit slick--W.J. Clinton
Wagner's music is better than it sounds.
Wait minute, I'm talking to Bill Gates.
Wait till I've found my bearings, then I'll panic.
Wait. That's the FORBIDDEN dance.
Waiter, I'll have what the guy writhing on the floor had.
Waiting to overcome all objections, results in nothing.
Wake me for the second reel.
Walk like an encryption.
Walk softly and carry a megawatt laser.
Walk through doors, don't crawl through Windows.
Walt Disney is in suspended animation.
Wanna Be a Psychopath? Read Dianetics, or ZMODEM.DOC.
Wanna byte my bit?
Wanna put a little ZIP in your ARC?
Want to see a quieter way of life? Visit Forest Lawn.
Wanted: Female 21+ able to put up with me and computer!
Wanted: Programmers. Some Assembly required.
War is the most successful of our cultural traditions.
War never decides who is right, only who is left.
War on Puberty: New program to eliminate teenage crime.
War: the end of diplomacy.
Ward, I'm worried about the Beaver.
Ward, I've been worried about the Beaver...
Ward, you were a little hard on the Beaver last night.
Ware-o-ware has my OS/2 gone?
Warm, wet and wild --- just my natural state!
Warning - This message may be harmful to your ego.
Warning blow up eminent!
Warning! COLDBEER.CAN found, programmer probably loaded.
WARNING! No user-serviceable characters in this tagline!
WARNING! TAGLINE THEFT ALARM IN USE.
Warning! Incomprehensible action is about to occur.
Warning! Incomprehensible source follows.
WARNING! Removal of this tagline prohibited by law!
WARNING! This messages exceeds your available memory!
Warning! This tagline fails CRC check!
Warning!!! CONDOM.ZIP is a trojan!!
WARNING!..Carnivorous Tagline...do not approach !
WARNING!: Bibliovore sighted, browse at your own risk.
Warning, do not download SAFESEX.ZIP it is a trojan.
Warning, I byte!
WARNING... drinking tap water may kill your thirst!
Warning: All prosecutors will be violated.
Warning: Any tagline I see is fair game.
Warning: Do not reuse tagline. Discard safely after use.
Warning: I'm stealing your Tagline!
Warning: Inside Joke Alert.
WARNING: MYERS.RUM empty, (R)efill (B)elch (P)assout ?
Warning: Politicians can damage your wealth.
WARNING: Programmer X-ing
WARNING: System Revolt Imminent!
WARNING: Writer of this message has a .QWK Wit...
Warp 5 ... engage. No, no, Mr. Data, more clutch!
Warrants? We don't need no steenkin' warrants!
Was Ann Magnuson TV last night?
Was Anne Archer than usual? Seemed angry to me.
Was Beethoven's 1st movement done in the toilet?
Was Beverly D'Angelo the manger the first Christmas?
Was General George Custer an aficionado of arrow shirts?
Was Jimi Hendrix's Modem A Purple Hayes?
Was Ruth Roman aimlessly?
Was Sissy Spacek on her space shuttle ride?
Was Sue Lyon about her age in Lolita?
Was Tasha Yar the Enterprise's expert on Data entry?
Was Teresa Wright or wrong?
Was that message as confusing as it shouldn't have been?
Was That Your Wife I Saw In a GIF the other day?
Washing your car to make it rain doesn't work.
Washington never told a lie? How'd he get to be Pres.?!?
Waste is a terrible thing to mind.
Wasting away in Margaritaville.....
Wasting time is an important part of living.
Watch a sunrise at least once a year.
Watch closely as Stefanie Powers up her Porsche.
Watch it - You're trying my infinite patience
Watch it Buster - You're trying my infinite patience.
Watch me pull a rabbit out of my hat! - B. Moose.
Watch out everyone, Guy's gonna upload...
Watch out! Anything you say may end up as my tagline.
Watch out! I'm having my 19th nervous breakdown!
Watch out! There's a tagline pirate about!
Watch out...Your next witticism may end up as my tagline
Watch out..the paranoids are after you.
Watch where you go... remember where you've been...
Watching the World pass us by
Water in the West runs uphill toward money.
Water taken in moderation, cannot do very much harm.
Water, in moderation, cannot hurt anybody.
We all have our opinions, but mine is RIGHT.
We all live in a glass house.
We all live in a yellow subroutine.
We all see the same sky but different horizons.
We apologize for the repetition in the show...The BBC.
We are all lost messages in the Relaynet of Life
We are all related...relatively speaking.
We are all travelers, from our birth until our death.
We are as made by God, and often a great deal worse.
We are Borg. We are Hugh.
We are but eight score young blondes and brunettes . . .
We are given children to test us & make us more spiritual
We are going to have peace even at the price of war.
We are His partners in completing the creation.
We are immortal, but only for a very limited time.
We are in bondage to the law so that we may be free.
We are Novell-you will be networked-resistance is futile
We are sorry, the number you reached is not in service.
We are the Knights who say "Ni!"
We are the most intelligent planet on earth" - Dan Quayle
We are the people our parents warned us about.
We are what we pretend to be.
We ask advice but we mean approbation.
We buy Junk and sell Antiques!
We can't go back, and we can't stay here.
We can't leave the haphazard to chance -- N.F. Simpson
We come in peace, shoot to kill.
We could have a conversation, would you like that?
We demand rigidly defined areas of doubt and uncertainty.
We didn't enjoy doing that at all.
We do what we can but it's never enough.
We don't care. We don't have to. We're the Phone Company.
We don't make personal friends, we don't have the knack.
We don't stand a whelk's chance in a supernova.
We found our cleaning staff had been dead 30,000 years.
We got rid of the kids -- the cat was allergic to them!
We had a meeting of the minds, but his didn't show up.
We had a meeting of the minds, but mine didn't show up.
We hang tagline thieves around here, stranger.
We have engaged the Borg. The wedding is Friday!
We have met the enemy, and he is us.
We have met the enemy, and he's all yours.
We have resumed control...we have resumed control...
We have standards and expect you not to exceed them.
We have this bomb you see, it's just a little one.
We have to go and save the universe, you see.
We have two ears and one tongue, use them likewise.
We learn from experience we never learn from experience.
We learn from history that we do not learn from history.
We make our own fortunes and call them our fate.
We may be lost, but we're sure making good time.
We may need to photograph you under a garden shower.
We most firmly believe what we least know.
We must believe in free will - we have no choice.
We must go to the party to drink and dance with girls.
We must laugh at man, to avoid crying for him.
We need more unemployed politicians.
We need robot toys that pick themselves up off the floor
We NEVER grow up, we just get older, and older.
We now return to our regularly scheduled flame-throwing.
We now return you to the musical portion of our program.
We of small mind are easily amused.
We owe Mr & Mrs Meek an apology for the mess we left.
We read to say that we have read.
We replaced THEIR coffee with dilithium crystals.
We shall find no ancestor before his time.
We should go metric every inch of the way!
We tend to forget that our birthplace was never an Eden.
We thank you for your support.
We walk on like an elephant and back off like a giraffe.
We want others to see us as wise, not foolish.
We want to eat, not make a meal of the issues.
We will find no ancestor before his time.
We will release no software before its time.
We'll call it something you can't fathom or pronounce.
We'll get along fine as soon as you realize that I'm God!
We're all beta testers on this bus.
We're all bozos on this bus.
We're all different, but then again we're all the same.
We're all in this alone.
We're all naked underneath it all.
We're all nudists underneath it all...
We're asking you now, metal man.
We're beating the bushes in search of a president.
We're born free and taxed to death.
We're from Liars Anonymous. No we're not!
We're going to have peace even if we have to fight for it
We're kick'n some ASCII now
We're living in a powder keg and giving off sparks...
We're looking for a few good men. - B. Cassidy
We're lost but we're making good time.
We're not retreating! Just fighting in another direction.
We're off to see the wizard, he's sure to have an answer.
We're running out of barrier cream.
We're sorry, reality is not in service at this time.
We're sorry. Your call cannot be completed as dialed.
We're trapped now, aren't we?
We've engaged the Borg, the wedding will be Friday.
We've got an unbeatable team! - Sauron
We've got to encourage them to evolve, to develop.
We've missed you; we'll aim better next time!
We've replaced the Dilithium with new Folger's Crystals.
Wear old clothes when you fight for truth and liberty.
Wear short sleeves: Support YOUR right to bare arms!
Weather forecast for tonight: dark.
Wedding: A funeral where you smell your own flowers.
Weeeeeehaaaaaah!
Welcome to California where Noah started his journey!
Welcome to California. Now please go home.
Welcome to L.A. Would you prefer smoging or non-smoging?
Welcome to Waco. Would you prefer smoking or non-smoking?
Welders do it in all positions.
WELFARE: Legalized con to deprive taxpayers.
Well begun is half done.
Well I never! (But I'd like to......just once.)
Well maybe so, but schizophrenia beats living alone.
Well said is quickly said.
Well what I'd like to know, is just what do they alter???
Well, excuuuse me!
Well, I did a backup three weeks ago...
Well, I do have one reliable gentleman caller...
Well, I'll be a monkey's Uncle!
Well, isn't THAT special?
Well, it seemed like the thing to do at the time.
Well, that would appear to be that.
Well, that's bureaucracy for you,
Well, that's good-bye Galaxy, then.
Well-adjusted: making the same mistakes and still smile.
Well...maybe.
Well...my Cray is in the shop.
WELL: Deep subject for a shallow mind like yours.
Wench: what you use to turn the head of a dolt.
Werhner von Braun settled for a V-2 instead of a V-8.
Wesley Crusher? Great idea. Turn it on!
Whaddya mean you don't STAPLE diskette labels on?
Whales are a lot like humans. Only they mate for life.
What a day may bring, a day may take away.
What a long, strange trip it's been...
What a moniker!
What a senseless waste of human life.
What a strange person.
What a wonderful world it is that has girls in it!
What Admiral Nagumo found at Pearl Harbor: NO CARRIER
What am I doing here?
What an exciting cough, mind if I join you?
What are friends for? - R.M. Nixon
What are we going to do tonight Brain?
What are you doing?!? The message is over!! GO AWAY!
What are you looking at? Get your own tag line!
What Are You Looking For? Nothing's Here!
What can you compare the universe with?
What can you do at 3 AM? Psssttt - got a modem??
What CAN you get a nudist for Christmas?
What color is a chameleon on a mirror?
What color is the sky in your world, @TOFIRST@?
What comes around goes around.
What did Harry Carey?
What did the blonde name her pet zebra? Spot.
What did we do before faxes? Get work done on time.
What diet is best for my FAT table?
What do Aggies say before picking their noses? Grace.
What do orientals do during ERECTIONS? VOTE!!!
What do you call 20 blondes in a Freezer? Frosted Flakes.
What do you call a blonde with half a brain? Gifted!
What do you call a smart blond? A labrador.
What do you call a woman with one leg? Alan
What do you call prostitutes' kids?... Brothel sprouts!
What Do You Expect From A Day That Begins With Getting Up
What do you get if you multiply 6 by 7?
What do you mean "WE", white man?
What do you mean 'WE', Kemosabe?
What do you mean by Ultimate?
What do you mean that I need a license to do that?
What do you mean that my urine sample is too small?
What do you mean, QWK? It took me over an hour to read!
What do you mean, QWK? It takes hours to read everything!
What do you mean, you formatted the cat?!?!
What do you mean, you've never been to Alpha Centauri?
What do you mean? You actually read this tagline?
What do you suppose gives Stephen King nightmares?
What do you think?
What does sundive mean?
What does this key do? %!!^%!$%$&*^%=+
What doesn't destroy me makes me stronger.
What ever happened to "Spuds McKenzie"?
What fools these morals be!
What garlic is to salad, insanity is to art.
What good does it do an ass to be called a lion?
What grammar is to speech, logic is to reason.
What Greenhouse Effect? Hey, is it warm in here or what?
What hallucinations were those exactly?
What hallucinations?
What happened to my tagline?
What has 4 paws & 1 big toe? A killer attack kitten.
What has alchemy got to do with losing weight?
What has eight legs and a fast draw ? Billy the Squid!
What has four legs and an arm? A happy Pit Bull.
What I need is a strong drink and a peer group.
What if all speculation is futile???
What if Joanne Dru pictures instead of making them?
What if there was a sexual revolution but no one came?
What if there were no hypothetical situations?
What if they gave a war and only one side came?
What if we put bandaid on the Panama Canal and it healed?
What in the name of zarking fardwarks is the fool doing?
What in the world are you doing here?
What is a computer's worst nightmare? A New user!
What is a lie but the truth in drag?
What is art but a way of seeing?
What is invisible might as well not exist.
What is the was of what will be...
What is learned in youth is understood in age.
What is so great about being stuck in a dust cloud?
What is the sound of one hand clapping? -- Zen Buddhism
What is the world to a man when his wife is a widow?
What is this thing anyway? The Discordian Society?
What is worth doing is worth finishing.
What kills a skunk is the publicity it gives itself.
What kind of cars do Proctologists drive? Ford Probes.
What light speed? I can even surpass dark speed.
What man doesn't like to stare once in a while? ■ O'Brien
What money won't buy, it'll rent
What orators lack in depth they make up in length.
What part of "NO!" didn't you understand?
What part of "ten-item limit" don't you understand? ■
What results were obtained with Love Potions 1 thru 8?
What Saddam Hussein's mom said: Abort, Retry, Fail?
What SHOULD be an endangered species: Parolees.
What should my fantasy be?
What should you give a nudist for Christmas?
What soberness conceals, drunkenness reveals.
What the !@#$ were you expecting for me to put here?
What the coyote saw: \......\.....\...\..\.\...>->
What the heck happened here??!!
What the hell is opposite sex?
What the hell, go and put all your eggs in one basket.
What the text giveth, the footnote taketh away.
What the world needs is more love and less paperwork.
What this country needs is a good five cent ANYTHING!
What this country needs is a good five-cent nickel.
What this country needs is a good vegetarian mosquito.
What time is it at the North Pole?
What two things in the air get a woman pregnant? Legs.
What use is magic if it can't save a unicorn?
What was entertainment deteriorated into mere abuse.
What was the best thing BEFORE sliced bread?
What was the name of the Unknown Soldier?
What we have here is a failure to communicate.
What we have here is a failure to mutate.
What we have here is a failure to mutilate.
What we need are 0-wait-state shopping lines....
What we need is more free speech worth listening to.
What were once vices, are now habits.
What wisdom can you find that is greater than kindness?
What would *YOU* do for a Klondike Bar?
What would McGyver do now?
What you want, must, and need to do are seldom congruent.
What youth deemed crystal, age finds was dew.
What's 20,000 lawyers rotting in a swamp? A GOOD START!
What's 20/20? IQ of twin blondes.
What's a bigamist? Foggy weather in Italy.
What's a blond virgin? An ugly 3rd grader.
What's a cubit?
What's a honeydew list? Honey do this, honey do that..
What's a nice girl like you doing in a place like this?
What's A Tagline?
What's a tuba for? Why, 1½" x 3½", of course.
What's all this fuss about endangered feces?
What's all this fuss about youth in Asia?
What's another word for Thesaurus?
What's in a name, anyway? Everything and nothing.
What's in a name? Money if it says 'Lotus-like'.
What's past is prologue, search for the truth.
What's shorter then a weekend? A Vacation.
What's so unpleasant about being drunk?
What's that grinding noise?
What's the point-spread on World War III? - Clinton
What's the world coming to when your monitor stares back.
What's up doc?
What's Up? A two-letter word.
What's Up? The ceiling.
What's Victoria's secret? She likes to dress like a slut!
What's white and tastes like bananas? Monkey spit.
What's WRONG with it? It's Wordstar!
What's wrong with your feet is they don't touch ground.
What, me ambivalent? Well, yes and no.
What, me worry?
What? You were expecting something clever?
What?!? This isn't the Files section?!?
WHAT??? Give up C:\> for silly ICONS?
Whatever advice you give, be brief.
Whatever blows your dress up!
Whatever happened to "Why is the sky blue?"
Whatever hits the fan will not be evenly distributed.
Whatever is well conceived can be well expressed.
Whatever it is, whenever it occurs, I'm against it.
Whatever you delete today, you desperately need tomorrow.
Whatever you do, you'll regret it.
Whatever you have, spend less.
Whatever you say about pornography, sex is here to stray.
Whatever.
WhatIAmIsWhatIAmAreYouWhatYouAreOrWhat?
Whatsa matter Colonel Sanders.......CHICKEN?
Whatsamata? Miss da boat?
When a cow laughs, does milk come out its nose?
When a dog runs at you, whistle for him.
When a man's willing and eager, the gods join him.
When a subject becomes obsolete, it becomes required.
When agnostics die, do they go to the Great Perhaps?
When all else fails, blame it on the guy next to you!
When all else fails, call a twelve year old.
When all else fails, consult Jack Daniels.
When all else fails, DEL *.*
When all else fails, dig out the dusty user's manual.
When all else fails, follow instructions.
When all else fails, give up and grab a beer.
When all else fails, I STILL refuse to read the docs.
When all else fails, quit.
When all else fails, read the instructions.
When all else fails, take a nap!
When all else is lost, the future still remains.
When all is said & done, people keep saying & doing.
When all think alike, then no one is thinking.
When an agnostic dies does he go to the Great Perhaps?
When angry, count four; when very angry, swear.
When childhood dies, its corpses are called adults.
When choosing between two evils, select the newer one.
When comparing Apples to Apples you still get a Mac.
When cows laugh, does milk come out of their noses?
When CPR fails, does the doctor order "Barium?"
When dangling, watch your participles.
When do I get to be what I wanted to be when I grew up?
When down in the mouth, think of Jonah, he came out OK.
When everyone thinks alike, then everyone is stupid.
When everything comes your way, you're in the wrong lane.
When facts meet the legend, go with the legend.
When God made man, She was joking.
When guests stay too long, treat them like family.
When guns are outlawed, how'll we kill liberals?
When I eat a biscuit it stays eaten.
When I play in the sandbox the cat keeps covering me up.
When I stop and think, I get an urge to stop thinking.
When I want your opinion I'll beat it out of you!
When I was a kid, I was an imaginary playmate.
When I win the lottery, I'll start my own hair club.
When ideas fail, words come in very handy. -Goethe
When in charge, ponder.
When in Chicago you must vote early and vote often.
When in danger,when in doubt,run in circles,yell & shout!
When in doubt stop thinking and all doubt will go away.
When in doubt, ask someone a hypothetical question.
When in doubt, blame the computer.
When in doubt, DON'T!
When in doubt, duck.
When in doubt, HAVE A BEER and think about it!
When in doubt, make a backup.
When in doubt, make it sound convincing.
When In Doubt, Mumble; When in Trouble, Delegate.
When in doubt, predict the present trend will continue.
When in doubt, run in circles, scream and shout!
When in doubt, SHOUT!
When in Doubt, stay at the luxurious Doubt Resort & Spa.
When in doubt, use brute force.
When in doubt... No, don't do that either.
When in doubt; Cheat !
When in trouble, delegate.
When in trouble, mumble.
When is the last time the Haggis Fairy visited you?
When it comes to giving, some people stop at nothing.
When it comes to humility, I'm the very BEST there is!
When it doubt, fake it.
When it doubt, make it sound convincing.
When it's all coming your way, you're in the wrong lane!
When life deals you lemons, make lemonade.
When Marriage is Outlawed, Only Outlaws will have Inlaws.
When men were men, and sheep were nervous....
When my ship came in, I was at the airport.
When no wind blows, even the weather vane has character.
When opportunity knocks, ask it to stay for dinner.
When people set aims in life, most aim too low.
When puns are outlawed only outlaws will have puns
When seeking love give nothing. Finding love give all.
When someone turns things around, don't get run over.
When something important is going on, silence is a lie.
When the bad combine, the good must associate.
When the dream is BIG enough the facts don't count.
When the eagles are silent the parrots begin to jabber.
When the going gets tough, find somebody to blame.
When the going gets tough, the smart get lost.
When the going gets tough, the tough go drinking.
When the going gets tough, the tough go shopping.
When the going gets weird, the weird turn pro.
When the horse is dead, it's best to get off it!
When the ship lifts, all bills are paid. No regrets.
When things go wrong, don't go with them.
When we are not sure, we are alive.
When we can't dream the time for death has arrived.
When you are in it up to your ears, keep your mouth shut.
When you are over the hill, you pick up speed...
When you care to give the very best!
When you castrate a "Q", do you get an "O?"
When you deal with the insane, always pretend you're sane
When you discover you are dead, avoid driving a car.
When you do not know what you are doing, do it neatly.
When you do nothing, can you know when you're finished?
When you don't know what you're doing...Do it neatly.
When you find anything that works, it usually fails.
When you get there, there's no there there.
When you go out to buy, don't show your silver.
When you go to the market, use your eyes, not your ears.
When you gotta go, you gotta go!
When you have the facts, you don't need an opinion.
When you illegally park a frog, it gets toad away.
When you say you're off, what do you mean exactly?
When you see a snake, never mind where he came from.
When you shoot a mime, should you use a silencer?
When you slip on a banana peel, land on your funny side.
When you try too hard to save face, you lose your ass.
When you're over the hill, you begin to pick up speed.
When? Where? Why? Who? and above all, HOW?!?!
Whenever possible, put people on hold.
Where are all the flashbacks they promised?
Where are the Taglines?
Where are we going, and why am I in this handbasket?
Where can I find a synonym, for "thesaurus?"
Where can I fnid a spell chequer for taglnies?
Where citizens count, subjects are slaves.
Where did we all come from in the first place?
Where do 'cannot' and 'must' meet on this graph?
Where do honey bees go potty? At a BP station naturally.
Where do they go now that they've gone too far?
Where do you find the time to not read so many books?
Where do you go to catch anorexia?
Where dos AVON find so many women willing to take orders?
Where ever you go, there you are.
Where have all the taglines gone?
Where HHG is inaccurate, it is definitively inaccurate.
Where is Carmen San Diego? Who cares?
Where is everything? All I typed was "Format c:".
Where is the STUN setting on a Laser Printer?
Where is the tagline supposed to go???
Where law ends, there tyranny begins.
Where men are outlawed, only outlaws are men.
Where no feline has gone before...
Where no man has.. where no ONE has.. ah, to hell with it.
Where quality is just a word we like to use.
Where should we have lunch?
Where the #@!% IS Carmen SanDiego?
Where the men are men and the sheep are nervous.
Where the users are USERS, and the taglines are afraid!
Where the zarking photon have you been?
Where there is a will, I want to be in it.
Where there is no shame, there is no honor.
Where there's a will, there's an inheritance tax.
Where there's a will, there's relatives
Where we operate at is a 90° angle to reality.
Where we're going, we don't need roads!!
Where would I be without my sense of direction?
Where would we be without any problems? BORED!
Where you stand depends on where you sit.
Where you've been means much less than where you're going
Where's the "ANY KEY"?
Where's the beef?
Where's there's smoke, there's toast.
Wherefore art thou Romeo?
Wherever you came from, you're not there now.
Wherever Yugo, I go.
Whether it's good or bad, publicity is PUBLICITY!
Which gets you to NY faster? The 16 bit bus or the 8 bit?
Which is better: Vulcan Humor, or Klingon Opera?
Which one is the non-smoking lifeboat?
Which way you reckon, Zaphod?
While (!cat) play (mouse);
While eating an elephant advance one bite at a time.
while(math_teacher() == talk) fall_asleep();
Whip me, beat me, crush me, is this wrestling or what?
Whips and chains? Sorry, sounds like a hardware problem.
Whiskey bent and hell bound
Whistler's mother is off her rocker.
White belt + white shoes = a "full Cleveland."
White dwarf seeks red giant for binary relationship
Who am I? What have I achieved? Am I doing well?
Who are we kidding?
Who can rule if no one who wants to can be allowed to?
Who can say what's around the corner?
Who cares if Marie Windsor or loses, she's still tops!
Who cares, we go where we go.
Who do you call to exorcise software??
Who gives a damn about apathy?
Who has the bread makes the laws.
Who is General Failure and why is he reading my disk?
Who is on 1st. What is on 2nd. I Don't Know is on 3rd.
Who is the Grateful Dead, and why do they follow me?
Who is worse shod than the shoemaker's wife?
Who needs a house out in Hackensack?
Who needs comedians? Journalists are much more laughable
Who said "Nice Planet", and why?
Who says you can't have it all?
Who shall stand guard to the guards themselves? -- Juvena
Who started this mess anyway?
Who the *&^%$#@! *is* Ivo Andric, anyway?
Who the Dickens wrote "Oliver Twist", anyway?
Who to himself is law, no law doth need.
Who was that masked man?
Who would understand youth must know old age.
Who's buried in the tomb of the Unknown Solider?
Who's the designated driver? This mouse is loaded.
Who's the Round Table's roundest knight? Sir Cumference.
Whoa... I'm detecting some hostility here...
Whodunit readers are just Spillaine folks.
Whoever came up with that idea ought to be SHOT!
Whom to marry: most important decision you'll ever make.
Whose woods these are, I think I know.
Whoso diggeth a pit shall fall therein.
Why are elves chaotic? Brownian movement.
Why are there no blue M&M's?
Why are there no PURPLE M&M's?
Why are there so many fools on the road?
Why are there so many gnarly limbs on my family tree?
Why are you glowing in the dark?
Why are you looking here? The message is up there ^!
Why are you wasting your time reading taglines?
Why argue? I'm always right!
Why blame God? He may be as sad about us as we are.
Why Blondes have TGIF on their shirts; Tits Go In First.
Why Blondes have TGIF on their shoes; Toes Go In First.
Why bother? Nothing is worth getting involved in.
Why buy a cow when the milk is free?
Why buy shampoo when real poo is still free?
Why call them "apartments" if they're all together?
Why can't dogs dance? They have two left feet.
Why can't I use my A.M. radio in the afternoons!?!
Why can't women put the toilet seat back up?
Why can't you be a non-conformist like everyone else?
Why did CNN cancel that cool "Desert Storm" show?
Why did I ever start this, anyway?
Why did the gazelle win? Cheetahs never win.
Why didn't I at least grow up to be Atticus Finch?
Why do blondes drive VW's? They can't spell PORSCHE!!
Why do I always shrug my shoulders? I have no idea.
Why do kamakazi pilots where helmets?
Why do shipments go by car and cargo by ship?
Why do the Kennedy's cry after sex? ..... Mace!
Why do they call it a TV set when you only get one?
Why do they call them briefings when they take so long?
Why do we get so old before we learn how to be young?
Why do we park in the driveway and drive on the parkway?
Why do we seem to operate best at a 90° angle to reality?
Why do you drive on a parkway, but park on a driveway?
Why do you think they call it DOPE....?
Why does Carl Sagan never sit down? Asteroids.
Why does sour cream have an expiration date?
Why does the person that snores always fall asleep first?
Why don't cats like to swim? Why don't many fish fly?
Why don't lawyers lie on the beach? Cats would bury them.
Why don't they print laws on 4"x4" soft paper squares?
Why don't you come up and see me sometime?
Why don't you come with me on a magic carpet ride?
Why don't you pull your lip over your head and swallow?
Why don't you take a long walk on a short pier...
Why experiment with animals? Use lawyers!
Why give the airport temperature? Nobody lives there.
Why in the world would you want to go THERE!?!?
Why is "abbreviated" such a long word?
Why is "easy listening" so hard to listen to?
Why is bread so dear and flesh and blood so cheap?
Why is Helen Keller's leg yellow? Her dog's blind too.
Why is it called a 'tallywhacker'?
Why is it that if you leave the room, you're elected?
Why is it that there are never enough days in a weekend?
Why is nothing is quite so unexpected as the truth?
Why is the alphabet in that order? Because of the song?
Why is there a "permanent press" setting on the iron?
Why is there a sofa in that field?
Why is there air?
Why isn't phonetically spelled that way?
Why isn't there a special name for the tops of your feet?
Why isn't there another word for thesaurus?
Why not go mad?
Why not go out on a limb? That's where the fruit is.
Why not upset the apple cart? They'll rot anyway.
Why resist temptation? It may never come your way again.
Why should I have to pay a troll just to cross a bridge?
Why solve problems you can bypass with a GOTO?
Why USA fails? Radio Shack=USA's Technology Store!!
Why use a big, long word when a diminutive one will do?
Why waste time learning, ignorance comes with the turf?
Why would a wood chuck want to chuck wood anyway?
Why would I want to look at the docs? Nurses are cuter.
Why yes, they are Bugle Boy beans.
Why's this fish so bloody good?
WHYME.EXE Fatal character flaw. Kick in ASCII? (Y/N)
Wie geht's dir heute?
Wife for sale - no money down; take over payments.
Wife says I never listen to her, or something like that.
Wife says it's either her or the computer. She's history!
Wild asses are not yet extinct.
Will Barbara Hale the passing ship or stay on the island?
Will Barbara Stock videos of her old movies?
Will Global Warming cancel Nuclear Winter?
Will he Mary Martin?
Will Judy Canova for test tube babies?
Will Judy Landers Elf a sitcom?
Will Julie Harris crew, director or producers?
Will Karen Black her eye with more bad movies?
Will Monica Seles her tennis racket?
Will Pamela Sue Martin?
Will people in the CIS be known as sissies?
Will Rogers never met Muy Groso.
Will Rogers never met Rush Limbaugh.
Will Rogers never met Saddam Hussein.
Will someone please bind and gag the moderator!
Will trade cranky dishwasher Sarah for a GE that works.
Will work for beer.
Will your great-grandchildren know you existed and how?
Willi Makit? or Betty Wont?
Win or lose, I'm never going to live it down, am I?
Win or lose, you lose.
Window Cleaner: Your Pane is Our Pleasure
Window-screen: An arrangement for keeping flies in.
WindowError:005 Multitasking attempted. System confused.
WindowError:01F Reserved for future mistakes
Windows - From the people who brought you Edlin
Windows 3.0 - The best $89 solitaire game you can buy.
Windows and Icons and Mice -- OH MY!
WINDOWS ERROR 44:..File not found...Wanna play solitaire?
Windows Error: 004 -- Operator fell asleep while waiting.
Windows Error: 004 -- User fell asleep while waiting.
Windows has crashed more systems than Michelangelo...
Windows is a conspiracy between MS & the RAM manufacturer
Windows is a disease - but is OS/2 v2.0 the cure?
Windows is a real pane ;{
Windows is a seven letter four letter word.
Windows is for fun, DOS is for getting things done.
Windows NT - No Thanks! (Gates named it right)
Windows NT: The best vaporware currently unavailable!
Windows NT: [N]ot [T]oday, [N]ot [T]omorrow, either!
Windows swaps memory to disk...I knew it was perverted.
Windows UPB: Unrecoverable Pain in the Butt
Windows would be better with curtains.
Windows! The best $99 Solitaire Game you can buy!
Windows, icons, mouse and pointer = WIMP.
Windows, Just Say No.
Windows: 80486 to 8088 conversion made painful...
Windows: A colorful clown suit for DOS.
Windows: An answer to a question nobody has ever asked.
Windows: An Unrecoverable Acquisition Error!
Windows: From the people who brought you the 640K limit.
Windows: Just another pane in the glass.
Windows: the solution to a problem that didn't exist.
Windows: what you throw your computer out of.
Windows? !Por Favor, No Rompa Mis Cojones! Gracias!
Windoze 3.1 ... XT power for a '486!
Winners grin; Losers weep
Winning is a habit. Unfortunately, so is losing.
Winning isn't everything, but then losing is nothing.
Winning isn't everything, but wanting to win is.
WinQwk is not the only offline reader for Windows.
Winter in Arizona falls on a Tuesday this year.
Winter is nature's way of saying "up yours".
Winter is not a season; it's an occupation.
Wisdom consists of the anticipation of consequences.
Wisdom is knowing what to do with what you know.
Wisdom of many and the wit of a half.
Wisdom often never comes; don't reject if it comes late.
Wise men in love act the fool.
Wise men learn much from fools. Wise guys don't.
Wish all the tabloids would just upChuck and Di......sigh
Wit is educated insolence.
Wit is the spice of conversation, not the food.
Witches who misbehave are sent to their broom.
With a bit of luck, the phone bill will bankrupt them.
With a Blue Wave of my hand I cleared away the SLMR!
With all due respect, I'd like to go for a swim. ■ Riker
With all this horse manure, there HAS to be pony in here!
With clothes the new are best, with friends the old.
With consequences, the unexpected always predominate.
With every wish there comes a curse.
With foxes we must play the fox.
With fronds like me, who needs anemones?
With fronds like you, who needs anemones?
With my sense of humor, no wonder I have no friends!
With my Stealth Modem, you'll never see me coming!
With our judgements as our watches, none go just alike.
With people, reach should exceed grasp. Try for heaven.
With sin, a human falls into it, a saint grieves at it.
With some foreign food the less authentic, the better.
With some it isn't the thought, it's the gift behind it.
With two ways to spell a word, the wrong one will be used
With users like me, what Sysop needs bugs?
without C, We'd have to write in Basi, Pasal and Obol!
Without creation there could be no destruction.
Without death, life has no meaning.
Without fingers you cannot even thumb your nose.
Without fools there would be no wisdom.
Without love and trust all you can be in life is alone.
Without my ignorance, your knowledge would be meaningless
Without proper programming anything could happen.
Without the last minute, how much would ever get done?
Without time everything would happen at once.
Without your ignorance, my knowledge would be meaningless.
Witnesses saw Amy Steel the car in broad daylight.
Witty tag line placed here. -->
WOM - Write only memory
Woman who cook carrots and peas in same pot not sanitary.
Woman who get laid in strawberry patch get ass in jam.
Woman who goes to man's apartment for snack gets tit-bit.
Woman.zip - great program, readme.1st file is missing.
WOMAN.ZIP - Great program. No Docs, but fun to UNZIP.
WOMAN.ZIP -- Great SOFTware. Won't do Windows....
Womb - the sound an elephant makes passing gas.
Women & elephants never forget real or imagined injuries.
Women and children first (to see if it's safe).
Women and children first -- feminist theory of evolution.
Women are like programs. A smart man keeps a backup!
Women do come with instructions, ask them!
Women don't HAVE heart attacks -- they CAUSE them!
Women go on diets. Men just eat less... and grow fat.
Women have clean minds cuz they change'em so often
Women love to be flattered. So do men.
Women should be obscene and not heard.
Women take to good hearted men. Also from.
Women with double first names make great peach cobbler.
Women's clothes: Go to extremes, seldom to extremities.
Women's Studies 103: Neat Is Not Necessarily Organized.
Women. Can't live with em, can't shoot 'em!
Words and ideas are what change our world.
Words are not food, though sometimes we must eat them.
Words are the voice of the heart.
Words can sometimes attain the quality of deeds.
Words DO NOT have meanings, people do.
Words mean exactly what I say they mean and nothing more.
Words must be weighed, not counted.
Words, 25¢ ea. Better quality words, 50¢ ea.
Words, words, words. And no place to put them all.
WORK HARDER!... Millions on welfare depend on YOU!
WORK is another dirty four-letter word.
Work is for those who have nothing better to do.
Work is the curse of the partying class!
Work never killed anyone -- but why take a chance?
WORK.COM Interrupt process? (Y/N)
Working on my second million. Gave up on the first
World ends at 3pm; details at 5....
World peace will only come when patriotism is forgotten.
World War IV will be fought with sticks and stones.
Worms, the only way to recan them is to use a larger can.
Worry is the interest paid on trouble in advance.
Worst case scenario: an Optimist Pessimist's viewpoint.
Worth seeing? Yes, but not worth going to see.
Would it give you a lot of pleasure?
Would it help if I said, "Please?"
Would she be happy with a Pet Rock instead?
Would you believe...?
Would you like me to stick my head in a bucket of water?
Wouldn't know what to do with it if I had it.
WOW!!! California earthquakes are cool. Try one.
WOW, what did I win, a refrigerator? :-)
Wrap both arms around yourself & call it a HUG from me
Write back! I think we can have some fun!
Write injuries in sand, kindness in marble.
Write your complaints in this box-----> []
Writer's Rule #2: About those sentence fragments.
Writing to Washington won't help ─ he's dead!
Written on a Cray Laptop
WWhhaatt ddooeess ""DDUUPPLLEEXX"" mmeeaann??
wwhhaatt ddooeess ffuull dduupplleexx mmeeaann??
Wyszowski's Law: No experiment is reproducible.
WYTYSYDG - What you thought you saw, you didn't get.
X minus 6 weeks and counting.
Xerox never comes up with anything original anymore.
Xpress yourself.
XT at 8 Mhz. = 386 at 25 Mhz. + Windoze !!!
Y'ever park your hard drive and leave the keys inside?
Ya gotta be subtle! - M. Hammer
YaknowwhatImeanVern?
Yawn a more Roman way.
Yawn error #30 - CPU Tired.
Yawn: The only time some men get to open their mouths.
Ye shall know the truth - and it will make you mad
Yea, yea..once a hobby, now an expensive addiction.
Yeah, but what's the speed of DARK?
YEAH, I MAINLINE CAFFEINE!!! SO?!!! WHAT'S IT TO YOU?!?!
Yeah...and some day the sun will die out.
Yeah? And you're another one!
Yeah? Well, tell that to her parents. ■ Geordi
Year: A period of 365 failures and disappointments.
Yeech!
Yes Dear, just a few more minutes....
Yes my son, long ago mail was read 1 packet at a time
Yes Sir! No Sir! No excuse Sir!
Yes, dear, with Robocomm I now have time for a QWKie
Yes, I admit, *I* steal taglines!?!?!
Yes, I know I'm off-topic. Thank you for your concern.
Yes-men: Fellows who hang around the man nobody noes.
Yesterday I saw a man with a wooden leg, and a real foot.
Yesterday the planet seemed to be going so well.
Yield to Temptation -- it may not pass your way again.
Yo-del-ay-hee-narf!
You ain't learning nothing when you're talking.
You always find it in the last place you look.
You always swat where he's not, or if he is aha! a spot.
You and the horse you rode in on!
You are a final product of that computer matrix.
You are always entitled to your own stupid opinion.
You are an example of why some animals eat their young.
You are entering another dimension. A dimension of szzzt!
You are IT! Really now... I'm not kidding here...
You are magnetic in your bearing.
You are not entitled to an opinion.
You are now entering a Mental State...Please show ID.
You are now entering The Twilight Zone.
You are only young once, but it is easy to stay immature.
You are only young once, but you can be immature forever.
You are smart. Can you make us go?
You are so unhip it's a wonder your buns don't fall off.
You aren't born happy, you must make it for yourself.
You aren't here forever, enjoy each day as a miracle.
You bet your bippy!
You bought a computer to do this?
You can always easily find anything you don't want.
You can always make room for one more. Except a new baby.
You can choose your friends, but you only have one mother
You can close your eyes to reality but not to memories.
You can fly, but that cocoon has to go.
You can fool all people, except but you can't fool Mom.
You can get anything you want at Alice's Restaurant...
YOU can help wipe out COBOL in our lifetime.
You can judge a man by how he keeps his golf score.
You can judge the success of a man by his bodyguards.
You can lead a carp to water, but be quick or he'll die!
You can lead a horticulture, but you can't make her think
You can learn a lot just by watching -- Yogi Berra
You can let bad times make you bitter--or better.
You can love four girls at the same time.
You can love humans if you don't know them too well.
You can multi-task on C-64s... keep a multitude of them.
You can never discard too many bad ideas.
You can never get rid of a bad temper by losing it.
You can never stand still nor go backwards in time.
You can observe a lot just by watching.
You can only be truly free if everyone else is truly free
You can pretend to be serious, but not witty.
You can say you're (excrement) out of luck!
You can say you're (expletive) out of luck!
You can teach an old dog new tricks, under protest.
You can tune a piano but you can't tuna fish.
You can visit Milliway's as many times as you like.
You can't act like a skunk w/o someone getting wind of it
You can't build a reputation on what you are going to do.
You can't call PTL, NOW! I'm downloading!
You can't do that. It's been digitally cursed.
You can't eat your friends and have them too.
You can't fall off the floor.
You can't fold drive mappings either.
You can't fool me, that's DIRTY DANCING, I see.
You can't get there from here.
You can't have everything...where would you put it?
You can't hide broccoli in a glass of milk.
You can't hug your children with nuclear arms.
You can't hug your kids too much.
You can't judge a book by the way it wears its hair.
You can't jump a canyon in two leaps.
You can't learn anything with your mouth open.
You can't leave, you're entwined in a improbability field
You can't lie in front of the bulldozer indefinitely.
You can't solve problems with just potatoes.
You can't step twice into the same river.
You can't teach a old dog new tricks if you don't try.
You can't underestimate the intelligence of the Public.
You can't win. You can't break even. You can't quit.
You cannot be too careful in the choice of your enemies.
You cannot kill time without assaulting eternity.
You cannot kill time without injuring eternity.
You cannot step into the same river once -- Cratylus
You cant throw us into space,we're trying to write a book
You cheated - you read the documentation!
You chose a cold night to visit our dead planet.
You could say I'm more differed from than differing.
You could see everything...she wore two-jump jeans!
You deserve the gods you worship.
You disagree? May I plead guilty by reason of sanity?
You disgust me, do it some more........
You do have a Kill-O-Zap blaster pistol in your hand.
You do not have to answer the above if you don't want to.
You don't have to explain something you never said.
You don't have to offer a reward to find lost weight.
You don't have to think too hard when talking to teachers
You don't want to know how sausage or laws are made.
You get the most of what you need the least.
You get what you pay for.
You go to pieces so fast people get hit by the shrapnel.
You got a towel with you?
You got the right one, baby!
You got to be kidding!
You got to start somewhere if you're gonna end elsewhere.
You gotta know when to code 'em, know when to modem.
You gotta know when to hold 'em, know when to fold 'em.
You gotta stop screwing around, daddy.
You grow old when you stop laughing.
You have a face like a saint. A Saint Bernard.
You have a lot of class -- all of it low.
You have a wonderful way with 57 characters.
You have been accused of Mass Mental Cruelty.
YOU HAVE BEEN DIVERTED
You have been selected for a secret mission.
You have no conception of modern business methods.
You have PMS and a handgun? I'll go quietly.....
You have to be an antique to appreciate them.
You have to get old before anyone says you look young.
You haven't lived until you've experienced a body cavity.
You just come along with me and have a good time.
You just wasted 4 sec. reading this tag line
You Klingon son, you killed my bastard! Got that wrong.
You know Traci Lords it over her fellow actors.
You know you're dieting when postage stamps taste good
You know you're OLD when you stop buying green bananas.
You know, it's not as big as I expected.
You learn as much by writing as you do by reading.
You learn something useless every day.
You live and learn, or you don't live long.
You live and you learn - or you don't live long.
You lost it and found it, I found something and lost it.
You make it, we take it: IRS
You may be a loser for a long time before you realize it.
You may be a lover, but you ain't no dancer...
You may be recognized soon. Perhaps you should hide?
You may be recognized soon. Hide.
You may be sorry for much, but never for being kind.
You may be Southern -- but you're no Comfort.
You may have to fight a battle more than once to win it.
You may say I'm a dreamer, but I'm not the only one...
You may use this tagline 30 days before registering.
You mean I'm supposed to read the *messages*?
You mean this ISN'T the holodeck? oops.
You mean you do this for fun?
You mean you've got a hold full of frozen hairdressers?
You might not be young, but you can still be immature.
You might say I'm a dreamer, but I'm not asleep.
You might want to get a band-aid for that.
You must know much before you know how little you know.
You must know your limits to break through them.
You must realize: Sweatwork is the only road to fitness.
You never find a lost article until you replace it.
You never get a second chance to make a first impression.
You never have to explain things you never said.
You never know unless you ask, answer not guaranteed.
You never know when you're making a memory.
You obviously mistook me for someone who cares.
You obviously mistook me for someone who knows.
You Passed Wierd Six Months Ago
You probably won't read this, but it's here anyway.
You realize how short a month is when you pay alimony.
You say I've lost it ? Well I say I've never had it!
You should be prepared to take the helm, if necessary.
You should hardly ever equivocate.
You should know better than to trust a strange computer.
You should presently be able to deal from a full deck.
You should restrict that remark to something artistic.
You should've heard me before you got here. ■ Ro
You showed admirable restraint for one so small. ■ Worf
You snooze, you lose -- I know, I lost when I snost!
You spotted snakes with double tongue... be not seen.
You tell 'em Bald Head, you're smooth.
You tell 'em Banana, you've been skinned.
You tell 'em Bank, you're safe.
You tell 'em Bean, He's stringing you.
You tell 'em Brake, you've got the drag.
You tell 'em Butcher, you've got a lot of tongue.
You tell 'em Cabbage, you've got the head.
You tell 'em Calendar, you've got lots of dates.
You tell 'em Cashier, I'm a poor teller.
You tell 'em Cat, That's what you're fur.
You tell 'em Cemetery, you are so grave.
You tell 'em Chloroform, you can put them to sleep.
You tell 'em Church Bell, I told you.
You tell 'em Cigarette, you're lit up.
You tell 'em Clock, you've got the time.
You tell 'em Cucumber, I've been pickled.
You tell 'em Custard Pie, you've got the crust.
You tell 'em Dentist, you've got the pull.
You tell 'em Dictionary, you're full of information.
You tell 'em Doctor, you've got the patience.
You tell 'em Dough, you're well bred.
You tell 'em Electricity, you can shock 'em.
You tell 'em Envelope, you're well posted.
You tell 'em Gambler, you've got winning ways.
You tell 'em Goldfish, you've been around the globe.
You tell 'em Hard-Boiled Egg, you're hard to beat.
You tell 'em Horse, you carry a tale.
You tell 'em Hunter, I'm game.
You tell 'em June, And don't July.
You tell 'em Manicurist, I've been trimmed.
You tell 'em Moon, you're out all night.
You tell 'em Mountain, I'm only a bluff.
You tell 'em Operator, you've got their number.
You tell 'em Piano, you're upright and square.
You tell 'em Playing Cards, you know the joker.
You tell 'em Printer, I'm not your type.
You tell 'em Railroad, It's not along my line.
You tell 'em September Morn, no one has anything on you.
You tell 'em Shoemaker, you know awl.
You tell 'em Simon, I'll Legree.
You tell 'em Skyscraper, you have more than one story.
You tell 'em Submarine, I can't seaplane.
You tell 'em Teacher, you've got the class.
You think it's the sort of thing you are likely to say?
You think paying an expert is expensive? Try an amateur!
You think you have troubles? Even my sundial is slow.
You touch my tagline, and I'll slap you into next week!
You wake me up from my dream to show me someone else's?
You want me to come and lie there instead of Mr. Dent?
You want me to drive on WHICH side of the road?
You want original taglines? Make one up.
You want programming jokes? Ok: Pascal, COBOL, ...
You were always one for the superintelligent question.
You were conspicuous by your absence -- Lord John Russell
You will be a winner today. Fight with a four-year-old.
You win some and you lose some. But think qualitatively.
You wore blue, the Germans wore grey.
You'd make a perfect stranger.
You'll always overlook one of those pins in a new shirt.
You'll get what's coming to you . . . unless it's mailed.
You'll have to excuse me, I'm terribly happy.
You'll like the bypass.
You'll need to have this fish in your ear.
You'll never be the man your mother was!
You'll never find it in all that loose clothing.
You'll never know until you ask the right source.
You'll stay young if you form new habits.
You're a jerk Dent, a complete kneebiter.
You're a load of useless. bloody loonies.
You're an accident looking for a place to happen.
You're being followed, cut out hanky-panky for a few days
You're full of BBS!
You're going to need a very stiff drink.
You're here.... where am I?
You're never a loser until you quit trying.
You're never alone with a schizophrenic.
You're never as good as others say--or as bad.
You're Never To Old To Learn Something Stupid...
You're never too old to do goofy stuff!
You're never too old to grow up.
You're NOT dealing with AT&T...
You're on report, Ensign. My quarters, 1900 hrs. ■ Riker
You're one donut shy of a dozen.
You're one to tell me what I can and can't sense. ■ Troi
You're only young once. You're immature forever.
You're really hard up if you steal *this* tagline.
You're so out to lunch, you make me hungry.
You're sober, but you're not everyone. Have a safe NYE!
You're standing where I want to pee.
You're surrounded by idiots! Come out with your hands up!
You're twisted, perverted, & sick. I like that!
You're Ugly And Your Mother Dresses You Funny
YOU'RE Zaphod Beeblebrox? THE Zaphod Beeblebrox?
You've been leading a dog's life. Stay off the furniture.
You've been smoking that stuff again, eh?
You've been smoking that stuff again, uh?
You've been to California, you know what they do there?
You've got more guts than road kill.....
You've gotta stop taking ego trips without any luggage.
You've obviously mistaken me for somebody who cares.
Young at heart ... Slightly older in other places.
Young gorillas are friendly, but they soon learn.
Youngsters remember anything if it happened or not.
Your 15 min of Fame is up -- please return to reality...
Your anus - the seventh planet in the solar system.
Your best response: Seethe and fume and throw a tantrum.
Your brain rattles around like a BB in a box car.
Your brain shrewdly elects to remember useless things.
Your brain was an organic part of the computer program.
Your call will be answered in the order it was ignored.
Your cat's missing? Have you checked my bumper?
Your choice: 1. Heavenly Upload 2. Hellish Download
Your code is theoretically beautiful, but it won't work.
Your E-Mail has been returned due to insufficient voltage
Your epidermis is showing!
Your freedom to swing your fist ends where my face begins.
Your future history has already happened.
Your future, with the Maker or the Baker is up to you.
Your history is a series of freakishly impossible events.
Your Honor, that's bovine fecal matter!
Your karma just ran over my dogma.
Your life would be simpler if you bought an address book.
Your lucky color is fading.
Your mileage may vary.
Your motherboard wears combat reboots.
Your planet is one of those scheduled for demolition.
Your sin, was it of omission, commission, or emission?
Your solution stinks. The problem is very interesting.
Your statement fully describes the situation partially.
Your sweet words suck a morning dew off the honeysuckle.
Your tagline has been assimilated. - BorgReader
Your trouble is that your absence makes good company.
Your Yin and Yang are no longer on speaking terms.
Your Zip file is open.
Yours 'til the butterflies...
Youth + confidence + myopia = naivete.
Youth is a gift of nature...Middle age is a work of art
Youth is wasted on the young -- G.B. Shaw
Youth isn't a time of life, but a state of mind.
Youth, a habit of hers so long she couldn't part with it.
Youth: wasted on the young. Wealth: wasted on the rich.
Youthful figure: What you get when asking a woman's age.
Zaphod loved effect: it was what he was best at.
Zaphod sauntered over to the bar and bought most of it.
Zaphod was so surprised they had to shoot him again.
Zarquon has come again.
Zeus gave Leda the bird.
ZIP me, PAK me, make me compress my bits... ARJ!
Zippy the Pinhead in '96! "Am I elected yet?"
Zippy the pinhead is a twit.
Zmodem has bigger bits, softer blocks, and tighter ASCII
Zmodem: Big BITS, nice BAUD, and a tight ASCII.
Zucchini: dense, flavorless vegetable useful as ballast.
[ OUT OF TAGLINES, PLEASE ORDER MORE ]
[ Tagline removed for lack of political correctness ]
[ This space for rent ]
[ ] <--Check here if payment included with upload
[... text deleted for brevity ...]
[dignified silence]
[D]inner not ready! [A]bort [R]etry [P]izza
[Insert generic tagline here]
[Place commercial here]
^ô^ <- Viking Tribble
`:-| 'Fascinating, Captain!' - Spock
`NO GUTS NO GLORY' `NO FEAR'
`scuse me fer askin'... I just be a bit ignant...
ïm ån åbûséd τáÇ£ìnê - nëèd â néw u$ë╔ ïmmÉdîÄtε£ÿ!!HÉ£₧
ö≡ ö≡ ö≡ <-- Tribbles listening to rock music.
¿Como friole? Spanish for "How you bean?"
¿lamron eb yhW
«-------- The information went data way --------»
»»════ Cruising at 14,400 bps V42bis ═══════>
»∞√╘╘h╖ñ ÄC■hanks for hanging up, dear.
▓▓▓▓▓ !ym ho ,srood 'n' sredaer 'n' stekcaP ▓▓▓▓▓
▓▓▓▓▓ BACKOFF..!!! I'm ßeta Testing!! ▓▓▓▓▓
▓╚µδ⌡ ≡ ¢á ¡ ú╚╔▄¿╞░ <--- OOPS! My buffer barfed!
│║▐║│║│█│║▌│║▌││ <- Will "Hooked on Phonics" teach this?
║║_____«o■■o≡_∞_∞_∞_________ <-- Rocket sled test
├÷µï╚R2÷╤Γ╤Γï┬╤Γ+SQmαTï≤Ñg is eating my brain!
──-ww-°U°-ww──- Kilroy was here.
────≡∩╫███████▓▓▒▒▒▒│╞════▌ Injectable Tagline!
╚╩╩╩╩╝ Hey Rocky, watch me pull a tagline outta my hat!
╤hïs ╤aÇlì∩ε hä$ â √îrÜ$ ìn ït - dφnt $tèål íτ!!!!
╙*╜ ╙*╜ ╙*╜ <- terrifying flying tribbles
█T█H█E█F█T██R█E█S█I█S█T█A█N█T██T█A█G█L█I█N█E█!█
██▓▓▒▒░░ IN STEREO WHERE AVAILABLE ░░▒▒▓▓██
██▓▓▒▒░░ PanaVision SVGA ░░▒▒▓▓██
█▄▀▄▀▄▀▄▀▄▀▄▀█ Urk! I just got run over
▄▀▄▀▄▀▄ ■ Let's go RACING! _/0--'-0/=~~~
ß late than never
ßeta Testers - On The Bleeding Edge of Technology!
τhï ï ¥öÜΓ möδεM Θ∩ δΓÜgs
τh¡$ ís ¥ΘüΓ ταG£¡ⁿε εⁿÇΓ¥₧εδ
τÖÖ ┌┬┐ûÇ├┐ $εx Å⌠⌠ε¢τ$ ¥ÖÜr εÿε$íg├┐τ....
τ╫É ÄÑswÉΓ τφ └ïƒÉ, τ╫É µÑ¡vÉΓsÉ, ÅÑd εvÉΓÿτ╫¡Ñg ïs 42
ΩΩΩΩΩΩΩΩΩΩΩ «───── A condom chorus line
∞∞∞∞∞∞∞∞∞∞ SAVE THE HUMANS ∞∞∞∞∞∞∞∞∞∞
÷÷÷÷÷÷÷÷÷÷÷ Steal this one, you punk. ÷÷÷÷÷÷÷÷÷÷÷
■ Beam me up..uh..uh:Spock what's that guys name again?
■ Q-Tip: When a really powerful alien gives you advice.
■▄■▀■▄■▀■▄■▀■▄■▀■▄■▀■ OH NO, a worm in my tagline!