comp.os.os2.setup.misc (Usenet) Saturday, 18-Sep-1999 to Friday, 24-Sep-1999 +----------------------------------------------------------------------------+ From: matthew@nope.psych.mcgill.ca 17-Sep-99 14:32:07 To: All 18-Sep-99 01:08:04 Subj: Re: PCMCIA on a Dell laptops--thanks for help From: Matthew Shapiro Just a note of thanks to all the folks who contributed the information that helped me get my dell-233 inspiron running. Now it all works--pcmcia modem, video (1024x768), sound, and parallel port zip-100 drive (which, BTW, is much faster than with DOS98). The machine is finally useful and stable. All I have to figure out now is why I have ghost drives under os/2 and how to get fat32 access to work properly. --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: News@The-Net-4U.com 17-Sep-99 11:23:12 To: All 18-Sep-99 01:08:05 Subj: Re: Help!!! with Warp 4 install on K6-2 400! From: News@The-Net-4U.com (M.P. van Dobben de Bruijn) > blonketyblonk@yahoo.com (blonketyblonk) wrote: Re-reading my prvious post I think I did not make it clear enough (being trapped in fun about Win unable to do this) that, if you have a backup of the old install, the first thing I would try to do is to move that onto a partition of the harddisk (again) and see if that will boot. In my experience this is most times not a problem, as OS/2 does not tie so much of the systems hardware specs into uneditable registries. Most times if I run in problems with this kind of motherboard swap it can be solved by booting from floppy, adding or removing some drivers or by editing some things in the CONFIG.SYS etc. Regards from Leeuwarden Peter van Dobben de Bruijn --- usethenet.at.the-net-4u.com (at becomes @) ---- --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: TeleKabel (1:109/42) +----------------------------------------------------------------------------+ From: bd83h@bedford.waii.com 17-Sep-99 13:56:03 To: All 18-Sep-99 01:08:05 Subj: Re: Make sure powersaving is disabled in BIOS (n/t) From: Steve Drewell On Fri, 17 Sep 1999, Wim Wauters wrote: î n/t huh? Steve Western Geophysical, Bedford, UK Tel: +44 (0) 1234 224404 Fax: +44 (0) 1234 224517 --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Western Geophysical, Houston, TX (1:109/42) +----------------------------------------------------------------------------+ From: DWAY@satx.rr.com 17-Sep-99 13:05:10 To: All 18-Sep-99 01:08:05 Subj: Re: increasing & moving swap file? From: DWAY@satx.rr.com (Duncan Way) On Fri, 17 Sep 1999 05:26:00, quickdraw@thinnin'.net (El Kabong) wrote: # I just re-installed Warp4 AS over Warp4 client. It runs like a slug # now, & it didn't before. The cpu usage stays pegged at 100%. # # config.sys says: # diskcache=64,LW,16 # memman=swap,protect # swappath=d:\os2\system 2048 2048 | Change to swappath=e:\ 2048 32000 (or whatever size you want) Reboot Delete the old swap file # ( I'm running 'cache386.exe' ) # # I THINK I want to put a big swap file on a different spindle (I've got # room on E:, HPFS different disk) but haven't the foggiest notion how. # # Any tips or pointer's to doc's? # --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: gmezero@gz.bomb.com 17-Sep-99 13:23:12 To: All 18-Sep-99 01:08:05 Subj: Re: Help!!! with Warp 4 install on K6-2 400! From: gmezero@gz.bomb.com (Bryan aka R.I.P.) On 17 Sep 1999 11:23:24 GMT, News@The-Net-4U.com (M.P. van Dobben de Bruijn) wrote: >> blonketyblonk@yahoo.com (blonketyblonk) wrote: > > >Re-reading my prvious post I think I did >not make it clear enough (being trapped in >fun about Win unable to do this) that, if you >have a backup of the old install, the first thing >I would try to do is to move that onto a partition >of the harddisk (again) and see if that will boot. In >my experience this is most times not a problem, as >OS/2 does not tie so much of the systems hardware >specs into uneditable registries. Most times if I run in >problems with this kind of motherboard swap it can be >solved by booting from floppy, adding or removing some >drivers or by editing some things in the CONFIG.SYS etc. > >Regards from Leeuwarden >Peter van Dobben de Bruijn >--- >usethenet.at.the-net-4u.com (at becomes @) >---- Hmmm... ok, thanks for both posts... I'll give that a try. I'll have time again to work on this this weekend. Thanks... (btw, sorry for the change in e-mail/name between posts, I'm not really trying to confuse anyone) --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Frontier GlobalCenter Inc. (1:109/42) +----------------------------------------------------------------------------+ From: quickdraw@thinnin'.net 17-Sep-99 13:55:25 To: All 18-Sep-99 01:08:05 Subj: Re: increasing & moving swap file? From: quickdraw@thinnin'.net (El Kabong) On Fri, 17 Sep 1999 13:05:21 GMT, DWAY@satx.rr.com (Duncan Way) wrote: >Change to swappath=e:\ 2048 32000 (or whatever size you want) >Reboot >Delete the old swap file Thanks. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Randori News -- http://www.randori.com (1:109/42) +----------------------------------------------------------------------------+ From: piquant00@uswestmail.net 17-Sep-99 14:58:16 To: All 18-Sep-99 01:08:05 Subj: Re: increasing & moving swap file? From: piquant00@uswestmail.net (Annie K.) On Fri, 17 Sep 1999 05:26:00, quickdraw@thinnin'.net (El Kabong) wrote: :I just re-installed Warp4 AS over Warp4 client. It runs like a slug :now, & it didn't before. The cpu usage stays pegged at 100%. : :config.sys says: :diskcache=64,LW,16 :memman=swap,protect :swappath=d:\os2\system 2048 2048 :( I'm running 'cache386.exe' ) : :I THINK I want to put a big swap file on a different spindle (I've got :room on E:, HPFS different disk) but haven't the foggiest notion how. Type HELP SWAPPATH at a command line. -- Anthropomorphic Hamburger --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Team OS/2 (1:109/42) +----------------------------------------------------------------------------+ From: saliha@bigfoot.com 17-Sep-99 17:49:25 To: All 18-Sep-99 01:08:05 Subj: Hard Drive bigger than 8 GB From: Salih Albayrak I have a 16 GB Hard drive. OS/2 W4 utilizes it's 8 GB. I can't create any more partitions. How can I use the rest of the drive? --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Total Oil =??Q?T=FCrkiye=20A=2E=DE=2E?= (1:109/42) +----------------------------------------------------------------------------+ From: horseman@ibm.net 16-Sep-99 15:56:05 To: All 18-Sep-99 01:08:05 Subj: (1/2) Re: dire need of HELP! From: Tony Wright Raphael Tennenbaum wrote: > In article <37DFD743.FE7F9382@ibm.net>, Tony Wright wrote: > >Raphael Tennenbaum wrote: > > > .snip on tale of woe>> snip my superfluous garbage as well ... > > > >Speculatively the symptoms are indicative of progressive HDD failure > >and/or MBR corrupt. > >Although if W95 is not exhibiting any symptoms(but as it's on C primary > >and probably physically contigous with MBR it may not for some time) > >and is presumably on same physical HDD and is relatively close/adjacent > >to first failing OS/2 partition on what is (proportionately) a much > >larger overall HDD size than these two partitions combined then I'd look > >at RAM/L2/CPU in that order..... depending on the feasability of > >available compatable swaps. > > I'm afraid this is a very cogent observation, I'm sorry to > say. And now that I think of it (god, I'm a classic > computer dope) one recent chkdsk.log on the root of my warp4 > partition looked so long to me -- *way* above the usual 24k > size -- that I actually dug up the IBM utility to read it. > I thought it had indicated it had fixed things, but maybe I > was thinking wishfully. Ok I appreciate you're in "fire fighting" mode at the moment... but when the "heats" off you should really look at analysing what ever logs you have to see if you can ascertain whether this is a progressive failure and when it originated and/or repeated. Although the newer 32 bit chkdsk reputably is more efficient at analysing/fixing in a single pass, it hurts not to boot from another partition(sorry you havn't got one have you) or OS/2 diskettes and run this at least once more after an alleged clean run. On previous versions it was always advisable to do this to ensure "secondary" structures were fixed. You also need to ensure that CHKDSK has had the opportunity to resolve all "inconsistencies" prior to using Partmagic,HPFS utils etc..... > > > >Unfortunately you need to expand a bit more on what diagnostics you have > >tried? > >Personally I would : > >1. temp remove any adapter cards.... and to rack my brains as to when or > >how long since I replaced my CMOS/BIOS backup battery (a relatively > >cheap lithium cell or whatever is probably the cheapest pre-req to any > >other hardware change and time involved in repeating any/all of > >following)..... A failing battery can be preceded by random > >obscure and apparently unrelated errors such as yours way before a > >specific 162/163/165 (or your mobo equivalent) POST bios error message > >is posted.... > > The box is but two years old, along with the ASUS P2L97. > The battery *looks* okay, though I know this doesn't mean > all that much. Not a lot unless you use the term "look" metaphorically (and not just in a visual context), and back this statement up with some quantatitive analysis.... checked terminal voltage(on load) etc.....? I doubt very much this is in anyway your problem but for the cost of a couple of bucks and 30 secs to pop it in (fat thumbs/fingers not withstanding) it makes sense from a PM point of view as dependent on Power on/off ratio/cycles these sometimes have a varied life from 18months to 5 years! You will need to diligently record any bios settings deviating from default to re-configure after. Unless you do it with power on-Which I don't recommend(but often I don't practise what I preach)! > >2. Run self test diags for my system board(inc RAM/cache) + HDD, > >assuming one still has ones original diskettes? or is this the problem? > > Don't think diagnotics that came with, but if there were > they're at the bottom of something, somewhere. I've managed > to hang on to the Adaptec driver disks that came with it. > > >3. Then any non destructive SCSI adapter tests, ensuring my > >passive/active termination and SCSI ID's had not mysteriously changed or > >ribbon cables become loose/damaged or in too close proximity to a > >RF/power source..... > > I switched out my wide SCSI cable this afternoon just to > check -- no difference. I doublechecked all the connections > as well. I suppose if I can get this fixed easily (and > cheaply) enough I may resolved to get new cables. > > >4. followed by something like PC Checkit to soak test the > >HDD,adapter,mobo and memory for a few hours..... > > If anyone's got a pointer to a shareware source for this I'd > certainly appreciate it. It's(PC Checkit) not (legally) shareware but there are other utils around although I confess I have had no need to search Hobbes and it's ilk to evaluate any alternatives.... Hopefully others will offer pointers/recommendations, but if you can't replace your specific PC model diags from manufacturers website then paying a few bucks(might be a tad more on reflection) for a generic diag suite appears to be prudent if, as you intimate in other posts, you prefer to be self supporting in both s/w support and hardware servicing roles? You havn't yet(had time to) posted the Adaptec chipset(you inferred it was SCSI on mobo?) so it's difficult for me to ascertain what(if any) adapter diags are built in..... Perhaps others with your mobo can advise more definitively. > >5. Re-insert adapters and re-run basic mobo + HDD tests + any adapter > >tests available(If this passed I'd be tempted to remove adapters and > >only re-install after OS/2 was up and stable) > > It's down to the video card and the modem at this point; > scsi adaptor is onboard. Again right now I've only got time > to formulate a strategy, I'm not going to jump in right away > -- I'll check the HDs first, because they're looking the > most suspicious at this point, then I'll pull those cards. Still not clear (personally) what diags(if any) you have run and thus how you "qualify" the statement "it's down to video card and modem".... but I've probably laboured the point sufficiently to annoy you already.... > >6. If we got this far successfully then I'd boot from OS2 diskettes and > >CHKDSK (preferrably the 32bit later version) on OS/2 partitions. Noting > >any errors I'd then rename any chkdsk.logs.... > > In fact I had renamed the one on my boot partition when I > first saw the alarmingly-sized ones, but then the whole > partition got wiped out. At this point, chkdsk doesn't even > recognize the K: drive as a HPFS drive. So does it say "unrecognised file system" or similar? If so partition tables are likely hosed or that damn W95 virus has been interfering with FS type entries in them! Again (I'm really starting to annoy you now...) you need to do a FDISK /QUERY and post it here! > >7. From boot diskettes run Partition Magic preferrably followed by your > >GLU utils and/or at least FDISK /QUERY > >8.Depending on results and what Bootmanager you had and any errors > >pertaining to partition.... I might be tempted to do a FDISK /NEWMBR > >and re-menu my boot partitions. > > This is starting to seem my next step. Let me ask -- though > this is one of those things I ought to have known for a > long, long time: how destructive is FDISK /NEWMBR? Will it > simply analyze my boot record and adjust the partitions > carefully, in a way that I won't have to recreate all the > data on each of them, or will I have to re-back up all my > HDs afterward? Oh hell! Talk about putting my head on the block! I'm in no position(unless you want to fund my airfare/hotel) to make any guarantees that there is not the remotest possibility that the remaining partitions might not get totally shagged! That said I've never yet (for what little that's worth) replaced MBR and found previous partitions now unaccessable. It's only got what 64 bytes (4 x 16bytes per entry) and I can't see how it could "alter" existing partition start/end sectors! On HPFS replacing MBR is usually most expedient solution when a "boot sector" virus gets confused on a unrecognised FS type and corrupts the MBR. It should only need you to replace the BM menu entries and any "startup" defaults but that is trivial..... However if the original MBR/part tables were somehow "skewed" because of existing (or now other) drive geometry/translation problems then who the hell can tell? If you have vital data and are not ABSOLUTELY sure about the integrity of your backups then I suggest (failing a spare SCSI drive to temporarily insert) you Laplink the system to your Thinkpad and transfer/backup all business critical stuff first. > > > >- - - - - - - break for coffee (pass on the decaf for once) - - - - > >and to reflect on any results and the fact that an apparent fault that > >affects more than one bootable partition can only be partition table > >corruption or an external common cause that is unlikely to be resolved > >by further re-installs into existing partitions! > >One now has to evaluate the feasability of diagnosis by replacement > >compared to the potentially wasted effort/elapsed time of continuing > >through 9 -13 below. Potentially first moving HDD to equivalent PC > >expediently resolves partiton table corruption and SCSI/HDD error. > > Alas, prior components are in a box in a basement 100 miles > away, but I may be able to get to them in a few days. > > I don't suppose there's much chance, in case I do get my > partitions properly reconstituted, that whatever um, fudged > my HD might have just been a fleeting anomaly? I see - Ray the eternal optimist meets Tony the eternal pessimist Personally I don't believe (completely) in "fleeting" anomalies or coincidences as once ignored they always inevitable tend to return with a savage and vengeful tenacity eventually to "bite you in the bum" at the most inconvenient and inappropriate moment.....YMMV .....so keep hold of those rose tinted glasses and the lucky "rabbits foot"..... It's not the hardware/software that's the most expensive(although you might think so) but your DATA and the ability to use the tool to further your business! I've no idea what business you're in (and it's none of mine either) but I'd be surprised if this existing problem (and any potential ones if it's not resolved correctly) doesn't impact your "profit" line sufficiently to easily justify several new HDD's if not another PC! That said it's a little premature to knee-jerk into that mindset as a convenient solution to your existing problem. > >Followed by RAM/L2/CPU...... and of course one still has to > >check/compare all those Bios settings, disk data transfer rates etc even > >if one has diligently backed up ones previous working settings. > >However if one does not have the luxury of this comparative technique > >one may be forced to discard the remnants of ones now stone cold coffee > >and continue....after further thought as to whether one did actually do > >a LLF initially when presenting both HDD + SCSI adapter together for the > >first time all those many moons ago....(but one was persuaded by the > >"expert" that said it was uneccessary because he'd done it for years > >through all SCSI/HDD models except coincidentally your exact combination > >perhaps) ....and besides it's been working ok for ages!(Ha! - servo data > >drift mumble mumble.... servo writer on edge of it's calibration who > >knows?) ....... :-( > > No, I did it all by the book -- and it's only five months > ago. It's a big IBM somethingStar SCSI drive, bought new, > and I've been using it fairly carefully. I suppose heat > buildup is a possibility. Who's book?(sorry)... still 5 months might not fall into category of early life failure and god knows what "using it fairly carefully" means?(Presumably you havn't played baseball with it or decided to check if it's G force rating was upto spec on a vibration/shock test rig?). Can't comment on heat but with with previous experience of IBM drives you can cook an egg on some of them(over easy? is that correct Americanism?)...thus the rest of your PC will probably melt first! Dammit - we'll be digressing thru thermal dynamics and entropy next..... Seriously you have to look at spec and monitor your in-case temperature if you are concerned and/or think that subjectively something feels more than just quite warm! IBM are fairly fastidous/ingenious about incorporating a hidden partition (for want of a better word) which you can't access without special utilities that gives a lot of diagnostic information (on IDE drives this is where the Smartdrive predictive failure analysis stuff comes from and this will soon be available on SCSI once they finish the PDF front end for SCSI bit). I remember this on even the old Type 663/664 (3.5 full form factor) corsair/alleycat drives of 5 years ago and before.... That said some of the interfaces are standardised such that Gammatech (and others) can access some of this data or at least display "hot mapping" bad sector details etc..... Like I said to extract the "tuple" code and diagnostics/stats completely you might need some expensive utils(outside of Netfinity/Tivoli add-ins) but ingenious people out there may have some workable alternatives.... > >- - - - - - -return to work via mens room - damn coffee - - - - - - - > > > >9. If I got this far then I might find I now have to do a SYSTINSTX cos > >partition doesn't boot at all or have FORMAT /L /FS:HPFS and reloaded > >from backup if there was evidence of massive corruption or lengthy > >chkdsk errors... > >10. If the WPS/Desktop is up and I've bypassed(or remmed) the obvious > >config errors for adapters I've removed.....then either I'm working and > >ready to re-insert adapters individually or staring at a now familiar > >Trap screen. :-( > >11. If I've trapped then I diligently note ALL the register details and > >any hints to failing module. If it's Trap 3 (breakpoint left by > >developer in application code) then I'd be looking at specific > >application(if I could tell) that possibly now has configuration file > >out of synch. > >If it's TrapD (pmmerge included) then I'd look again at what > >diagnostics(if any) I'd run on my video adapter. I'd then revert to VGA > > Was the first thing I tried, and the most alarming failure > of all. Well again without specific failure details the rest is just conjecture..... You alluded somewhere in another post I believe to possibility of "lightning" strike zapping your original sound card.... I don't know whether this was purely speculative or circumstantial from observing a --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Equi-Tek CompCon (1:109/42) +----------------------------------------------------------------------------+ From: horseman@ibm.net 16-Sep-99 15:56:05 To: All 18-Sep-99 01:08:05 Subj: (2/2) Re: dire need of HELP! "brownout" or "blackout" on the grid during an audible thunderstorm. You would have to be fairly unlucky (= typically on end of an isolated lengthy supply feeder) to cop that much damage to your PC. Much more likely for inductive spikes on the PTT line into your modem. Hopefully the current symptoms are unrelated to this type of common catastrophic cause and we possibly have a number of seperate problems(+ GFT = Gross Finger Trouble) here? If the SCSI was onboard but Video was seperate card, I don't suppose there was an onboard(but now disabled) video chipset as well? (Again I'm disadvantaged by not being intimate with your mobo and being too lazy to look it up). > >and retry...... along with toggling my H/W detection on bootup(ALT+F1 > > >F5/6) if this is still failing. I'd look at reverting to my originall > >Archive install desktop(this should be VGA anyway), and eventually I'd > >be stripping my config to basics and methodically(but > >tediously)re-enabling each device/group at a time.... > >12. Finally if I'm still stymied and my maintenance(BOOTOS/2) partition > >is still exhibiting similar problems then I'd be tempted to re-install a > >minimal OS2 from CD in my production partition to see what happens..... > >after rechecking my BIOS settings to ensure that these are defaulted but > >still commensurate with my hardware yet temporarily disabling > >L1/L2/Video cache(and removing/exchanging all bar minimum RAM to load > >OS/2) in case the diags missed the fault....while not forgetting that I > >might have a PCI SCSI card and ISA Matrox that possibly requires > >appropriate PnP and legacy resources modified in Bios.... > >13. If I'm still totally disfunctional without any useful guiding > >failure messages during all the above then I'd append EXPLICITLY here > >all that I'd done(in exact sequence) with ALL pertinent details of my > >system configuration(not just a few tantalising but unilaterally > >useless and arguably unstructured extracts Mr Tennenbaum!...). > > > >I only ever reached unlucky 13. once when I first had V3 RedPak on my and probably unlucky to keep repeating these boring old war stories so snipped em... > >(but I know you have had GT utils once but are now using GLU so I don't > >suppose there was a GLU(or) equivalent of GTDisk utility to > >backup/restore partition tables and a chance of having current backups > > My backups are fairly decent, but there's no telling whether > I'll be able to "worst-case" restore all my HD parts., since > some of them would have been made off of corrupted > partitions(??). Hold yer horses - now whose being a pessimist.... if your FS had partial corruption then in all likelyhood any decent backup utility (even xcopy I suppose...) would have displayed an error or logged it...? Assuming it was functional at the time you actually backed up I suppose. However we don't know what your using (knew I'd get an opportunity to get that "dig" in again) specifically so it's impossible to tell at this stage.... (and you may have deleted/disabled error/audit logging anyway). > Shortly after I put in this new HD, I used > Chris Graham's "disaster recovery utility" to back up the > partition tables, but then again, I'm not quite certain how > I'd apply these without the ability to boot os/2 (hm, come > to think of it, maybe I remember a restpart.exe or something > similar). For that matter, I may have used Partition Magic > to move some things around, though I'm generally prudent > enough to make sure to re-backup the partition tables (is > there a way to see the date when these were last changed? > the date on my backup is on the diskette (4/28/99)). I can't readily locate my copy of GLU to check but it would be rather imprudent to design a recovery mechanism that doesn't work from a simple VIO/text/CLI interface(ie a bootable diskette)!....and as regards dates..... Other than a sector/hex editor probably not feasible (perhaps there is partition date in there somewhere but utils like PartMagic don't seem to display it). The HPFS superblock contains time stamp for last chkdsk but I don't think a partition table date as such is available/easily retrievable......or more accurately this dumb SOB can't find it. The simplest way perhaps is to re-save (after renaming originals) the partition tables again and do a binary compare. That might give some crude indication if somethings changed but not in a user friendly way sufficient to tell you what specifically. > >if that is eventually determined to be a more likely > >cause/solution?.... and you have Henks WPS backup on an accessible > >partition/diskette presumably if the eventual outcome also requires a > >desktop rebuild? ) > > > >To write other than a generic(and thus unhelpful non-specific) procedure > >requires a LOT MORE detail of your system. Well you've got other things to do so I guess LOTS MORE DETAIL will have to wait....or until you find a totally clairvoyant poster to resolve the problem for you. > Following the above > >"parrot fashion" without adapting it for your configuration (or > >understanding what its doing and interpreting results) could result in a > >lot of unecessary work (and potential impacts if the integrity of your > >backups is questionable/unknown!). > > > >Otherwise we'll be repeatedly inviting you to try(and/or comment on) the > >obvious: > >1. What's the specific mobo + h/w details etc > >2. Partition and HDD type/structure viz FDISK /QUERY detailing any other > >non/ working OS's(apart from W95/OSV3 already mentioned). > >3. Type/location of applications wrt to 2. Ordered by business > >criticality..... (eg I must retain a WordProc and access to my network > >server minimum.... followed by email....graphics with SVGA 1600x1200 res > >at 16M colors.... my data on G: is also on a verified backup but I don't > >have all my install disks/CD's for apps on F: and/or their > >configs/customisations backed up.... my largest partition is 6Gb on G: > >and takes 4 hours to totally restore via my Travan4 etc etc.... ) > >4. What diags/utils/chkdsk/partmagic do you have and results of what you > >have tried over and above that already posted ..... apparently from your > >Yamaha(or was it a Guzzi?) somewhere in the Mojave desert? > > > >.... > > > >....and if I subsequently found that my probem was caused by faulty RAM > >that just happened to be non-parity memory then I would tend to become > >quite sceptical about the claims that "parity" is now a uneccessary > >expense given modern production yields/quality? > >But then given my mobo supports it I wouldn't personally fit anything > >but parity (or ECC if my PC was mission critical - discussions on double > >bit parity errors uneccessary thanks... or statistical MTBF for > >non-parity EDO whatever Dimms ) > >Unless of course I had access to be able to readily "swap" memory out > >somewhere early in steps 1 - 8 above before expending more time than > >extra cost of parity. ....gotta spare K6-2 cpu.....L2 Cache...etc? > >Can you swap SCSI/HDD to another similar PC? > >Trouble is these iterative diagnostic analysis by replacement methods > >may well be more expedient if we were all in your place and knew the > >resources you had available and no doubt if they were easily available > >you would have already done it. > > > >Or are we facing some desperate time constraint...panic attack here...? > > No, patience I've learned (too well, perhaps, but that's > another story). The ThinkPad can tide me over for at least > a week. When I get a chance I'm going to see about the > drives, and then do some diagnosis. > > Your very generous and intelligent post "Intelligent"? Sh*t - you slipped up there..... must have confused me with someone else... > is most charitable, > and it is received with due appreciation for all the battle- > scarred wisdom with which it was written. There is a great > deal to digest here, and once I get this other w*rk out of > the way, I'll copy your post and it'll form the basis of my > strategy to work through. I hope you won't mind if I come > back with a rephrased sort of outline. If thats your diplomatic way of saying I waffle far too much and it can be condensed into 13 lines or less then No of course I don't mind....and feel free to conserve bandwidth/dasd.... However you should look (as I'm sure you are) at all the other posts and merge all valid suggestions into your "outline". I suspect a collaborative effort could produce a far better "basis" for a strategy tuned to your specific circumstances. At the moment I suspect there is a danger/temptation of trying too many things ad-hoc in an unstructured fashion....... :-( If any contradict or need clarification then ask (I can't see anyone being offended...but some people/ego's are funny/sensitive...so...). I'll be first to admit when I'm not sure(like all the time) ..... and those specifically using your mobo + SCSI + HDD will undoubetdly give you more authoritative and definitive recommendations than my "woolly" generalities. > Thanking you very indeed, Your most welcome even if 1. I/We havn't (yet) progressed a solution. 2. Managed to offend you (yet) for my own amusement (sad.......but I'll keep trying) . 3. You still havn't submitted your homework on the other topic (copying INI's)....(guess you got overtaken by events) :-( Seriously though.....good luck > -- Rgds Tony W Email: horseman@ibm.net A journey into motorbike memorabilia (although interesting - thanks) deleted for brevity(?) and just in case any ex-Angels or Mods still have my name tattooed on their anatomy/"kill lists" as the "gobby limey greaser" .... ...and Venice beach(Ca) and Brighton(UK) do seem a lot quieter than in times long past --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Equi-Tek CompCon (1:109/42) +----------------------------------------------------------------------------+ From: Trevor-Hemsley@dial.pipex.com 17-Sep-99 18:43:28 To: All 18-Sep-99 01:08:05 Subj: Re: dire need of HELP! From: "Trevor Hemsley" On Thu, 16 Sep 1999 18:32:38 -0400, Raphael Tennenbaum wrote: ->Unfortunately my system's at a point -- happened around ->yesterday morning -- where I can no longer boot of any of ->the three OS/2 parts. on the HD (3, 4, maint). I had hoped ->I might be able to run memos off a diskette boot: the first ->time I tried it said it couldn't find NLS, so I tried again ->off the diskette I use to run FC/2 in diskette-boot mode, ->which has three or four dlls -- moucalls, viocall, et al. ->When I tried running memos2 I got -> ->SYS0318: Message file OSO001.MSG cannot be found for message ->3175. That'll be a bug. It's looking for [bootdrive]:\config.sys and not finding it then crashing nastily. I have a fixed version but all it does is stop it crashing if it can't find config.sys or can't find the swappath= line within it. If you want to bypass the problem you can create a dummy config.sys on the diskette you're running from and place a swappath= line in it pointing to a drive containing enough free space for double your physical memory. Trevor Hemsley, London, UK (Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com) --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views (1:109/42) +----------------------------------------------------------------------------+ From: b.l.nelson@larc.nasa.gov 17-Sep-99 15:39:28 To: All 18-Sep-99 01:08:05 Subj: Re: Help!!! with Warp 4 install on K6-2 400! From: Bennie Nelson Random crashes sounds suspiciously like RAM failures. Have you tried troubleshooting the RAM? This would involve using slower BIOS settings. removing/replacing one or more memory modules, etc. While I have not used the K6-2, I have installed OS/2 on several K6-III 400 mhz machines with nary a problem. The motherboards were all from DFI using the VIA MVP3 chipset. Regards, Bennie Nelson "Bryan aka R.I.P." wrote: > > On 16 Sep 1999 17:38:57 GMT, doug.bissett"at"ibm.net (Doug Bissett) wrote: > > >On Wed, 15 Sep 1999 23:07:32, blonketyblonk@yahoo.com (blonketyblonk) > >wrote: > > > >> Help! > >> > >> I'm trying to install Warp 4 on a machine here, I've got: > >> K6-2 400 > >> Matrox G200 > >> 64 MB PC100 RAM > >> SB32AWE > >> NE2000 Compatable NIC > >> > >> I've used the SB and NIC in my old machine, so I know > >> they work. I also have Win98 working 100% ok on this > >> system. > >> > >> The problem I'm having is intermitent lock-ups at just any-ol-time... > >> It's so bad that I can't even complete an install of the base OS > >> without the machine locking up at some random point. > >> > >> ANY HELP would be appriciated on this, while I have upgraded > >> my hardware, I really need to get OS/2 back installed to access > >> some of my applications that I run. > >> > >> Thanks... > >> > > > >I don't know if it will help, but there are known install problems > >with the NE2000 NIC (and compatible) cards. Try removing it, install > >OS/2, then put it back in and install the NE2000 driver, and set up > >your networking. > > > >Hope this helps... > > Hmm... I'll give that a try, but the card has never been a problem. The NIC > card in question was previously used when I was running OS/2 3, and a previous > install of OS/2 4. The only thing I did was I upgraded my machine to a new > motherboard, processor, and video card. ...and as I said above, I'm already running > Win98 on one partition, and now I'm trying to set up my Boot Manager boot to OS/2. > I've done this kind of install more times than I can I care to count, but this is the first > time with the three new items I listed/or on a machine using that fast a processor. > > Thanks, > > Bryan --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: NASA Langley Research Center, Hampton, VA, USA (1:109/42) +----------------------------------------------------------------------------+ From: satoru@candenext.lsa.berkeley.edu 17-Sep-99 19:57:23 To: All 18-Sep-99 01:08:05 Subj: Re: printing through SCSI From: satoru@candenext.lsa.berkeley.edu (Satoru Uzawa) Wim Wauters (w.h.m.wauters.1998@cranfield.ac.uk) wrote: : : Don't have the original manual, but both the original invoice and the : backplate of the printer say: "Apple Personal Laserwriter SC". : Using this info on Apple's support pages gives the full spec: : Interface: SCSI : RAM: 1MB : AND the fact that te printer works fine on a SCSI bus removes all doubts. : Problem is that x86 operating systems do not handle printing on a SCSI : device, although printing is covered in the ASPI language [Advanced SCSI : Protocol Interface by Adapatec, commonly used in DOS/Win/OS/2]. Waoh, you are right, Apple indeed made a SCSI port printer. Thank you for correcting my mistake. I've looked at the Apple Spec page and found that the printer is a QuickDraw device which is the root of your problem. You only can use QuickDraw on Mac so all of your documents for printing have to be converted on your IIcx. Remote printing will work if there is a software which converts postscript or PCL (or something else) to QuickDraw automatically and output to the printer. I'm sorry but with my limited knowledge, I cannot help you with this. You may ask to Mac related news group for existence of such software. If there is one, you can use Columbia CAP package on Unix/Linux environment, at least. Thank you and have a nice day! : Sorry, I didn't make myself clear: : the idea is to use the Apple IIcx to share the Apple Printer on our network. : Problem being: this lovely old Apple has Nubus busses ( Apple's alternative : to ISA and predecessor to PCI ?), the operating systems is 'System 7.5'. : After that, the challenge will be to make the Apple 'talk' to our : Linux/Unix/NT/OS/2 network. We only need a printer qeueu though, should be : all right (LPDdeamon running on TCP/IP ?). : : Fun and Games ! : I'll be back when I laid my pawns on a Nubus netcard ;-) : : Thankx for all your interest. : -- Satoru Uzawa, satoru@candenext.lsa.berkeley.edu (NeXTmail welcome) --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: University of California at Berkeley (1:109/42) +----------------------------------------------------------------------------+ From: phillipcaine@hotmail.com 17-Sep-99 13:03:06 To: All 18-Sep-99 01:08:05 Subj: Re: Warp 4 Won't Boot From: "Phil Caine" The painters just arrived and will put me out of business for a day or so. I'll test your suggestions and post as soon as I'm functional again. Thanks for your Sx. Phil Trevor Hemsley wrote in message news:geribeurzfyrlqvnycvcrkpbz.fi6rhh0.pminews@news.dial.pipex.com... > On Thu, 16 Sep 1999 14:10:08 -0700, Phil Caine wrote: > > ->Darn it, I misled you. The C: drive and the D: drive are separate physical > ->drives. The C: is 18 GB only 6GB is used the remained is free space. The > ->D: drive is 2GB with 1GB free space. I'm using Warp 4 with FP 11. The SCSI > ->is a PnP card. > -> > ->Everything worked fine before I replaced the failed C: drive with the large > ->IBM. I used to boot under PQBoot but it wouldn't work after the IBM install > ->so I 'I'm using BootIt. > > Can you boot up with OS/2 diskettes and run FDISK /QUERY and post the > output? One thing that does occur to me is that you may have changed the > OS/2 boot drive letter. If you've defined any new partitions on the new > drive then, if your OS/2 was installed in a logical drive inside an > extended partition on the second drive, the drive letter of OS/2 will have > changed. Similarly, if you have defined an extended partition on the first > drive that contains logical drives that are entirely outside the INT 13 > support area of the disk (usually 8GB) then these drives may be completely > invisible to OS/2 and/or its boot manager. > > Post the FDISK /QUERY output if this doesn't help. > > > Trevor Hemsley, London, UK > (Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com) > > > --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: SBC Internet Services (1:109/42) +----------------------------------------------------------------------------+ From: muses9@cyberus.ca 18-Sep-99 01:57:24 To: All 18-Sep-99 04:37:14 Subj: Re: ? possible to "format c: /s" with DOS from A:? From: muses9@cyberus.ca (Marko) On Thu, 16 Sep 1999 13:23:18, Bob Germer made history by saying: -> muses9@cyberus.ca (Marko) said: -> > I've tried it, which is why I asked. The format command dies on trying -> > to write the boot sector to C:. If you have actually succeeded in doing -> > this, I'd sure like to know what you did. -> -> I have found that only IBM's PC-DOS 7 can do this with large partitions. -> if the partitioning was done with Windoze 9x, NT, or some flavors of Unix, -> you will need to delete all the partitions and repartition it with FDISK. -> Only PC-DOS 7 FDISK seems able to remove non-DOS paritions, BTW. -> Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com Hi Bob, Thank you for the information. I am in fact using PCDOS7. Do you mean that I just have to delete the partiition in question, or ~all the partitions on C:~? That would make this process undesirable, since I have Boot Manager, W95, W3.11, and WNT4 on my C:. -- Marko Ottawa --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42) +----------------------------------------------------------------------------+ From: lhadley@nospam.net 18-Sep-99 00:54:04 To: All 18-Sep-99 04:37:14 Subj: help - Yamaha 6416S & Future Domain SCSI controller From: lhadley@nospam.net Installed fine under Winblows, locks up at boot under Warp 4 (fp10, but adapter driver installed directly from Warp 4 cd) My system: K6-2-300 64mb Matrox G200 AGP 2 eide HD's on primary - 8gb and 4gb (one partition vfat, 2 fat32, 3 HPFS, bm) 1 ide CD-ROM (44x; cd-xa, master on secondary controller) DLink DE-528CT pci (cable modem) AOpen AW230 pci soundcard the scsi controller is an IBM one oemed from Future Domain (Adaptec) and appears to be a TMC(?)850 or 950 - Warp 4's selective install had it highlighted when I installed SCSI support. Upon reboot, the system appeared to lock up. (Ctrl-Alt-Del didn't work). Rebooting with Alt-F2 showed the system stopping when encountering PARTFILT.FLT (a component of fat32os2) remming out the fat32os2 components didn't change a thing. Is this a version problem or should I try setting some switches on the drivers? Having no prior experience with SCSI, I'm not sure where to go next.... Please cc replies to my email: lhadley1@home.net thanks! !os2 -- DLH AIM id "SirKrustin" In order of preference lhadley1@home.net, lhadley@peterboro.net homepage: http://sirkrustin-online.iwarp.com == Last updated 8/28/1999 ======================================= --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: @Work Internet powered by @Home Network (1:109/42) +----------------------------------------------------------------------------+ From: lhadley@nospam.net 18-Sep-99 01:06:03 To: All 18-Sep-99 04:37:14 Subj: Re: TCP/IP Not Working in WinOS2 From: lhadley@nospam.net I have this problem also - one error message I noticed that others haven't seemed to mention is WinOS2 complains about not seeing "NETWORK.DRV" Any other ideas guys? In <37D88253.22C24AF0@juliand.com>, on 09/09/99 at 11:00 PM, Julian Dominic said: >This used to work until I had to replace my system hard drive. My first >TCP/IP configuration was OS/2 2.1 with TCP/IP V2 + Dos Box. As I >upgraded >over this TCP/IP worked fine in all environments. When I installed a new >hard drive and rebuilt the system to where it is today, Warp 4, Fixpak >11. >TCP/IP in DOS WinOS2 is not recognized. Everything seems to be set up >correctly. >My autoexec says: >PATH=C:\OS2;C:\OS2\MDOS;C:\;C:\OS2\MDOS\WINOS2;c:\tcpip\dos\bin; SET >ETC=c:\tcpip\dos\etc >winsock.dll is in c:\tcpip\dos\bin. It is the only one. >The RESOLV files have entries for my DNS. >What am I missing? >Thanks !os2 -- DLH AIM id "SirKrustin" In order of preference lhadley1@home.net, lhadley@peterboro.net homepage: http://sirkrustin-online.iwarp.com == Last updated 8/28/1999 ======================================= --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: @Work Internet powered by @Home Network (1:109/42) +----------------------------------------------------------------------------+ From: lhadley@nospam.net 18-Sep-99 01:52:03 To: All 18-Sep-99 04:37:14 Subj: Re: Help!!! with Warp 4 install on K6-2 400! From: lhadley@nospam.net In <37e025b4.55346749@news.primenet.com>, on 09/15/99 at 11:07 PM, blonketyblonk@yahoo.com (blonketyblonk) said: >Help! >I'm trying to install Warp 4 on a machine here, I've got: >K6-2 400 >Matrox G200 >64 MB PC100 RAM >SB32AWE >NE2000 Compatable NIC >The problem I'm having is intermitent lock-ups at just any-ol-time... >It's so bad that I can't even complete an install of the base OS without >the machine locking up at some random point. This is either a nfg/poorly designed mobo or possibly due to an overclocked cpu. Do you know *for sure* if it's an actual 400? The reason I ask this is because it's come to my attention that a number of local system builders are overclocking cpus and pocketing the extra cash by selling it as the higher rated chip... !os2 -- DLH AIM id "SirKrustin" In order of preference lhadley1@home.net, lhadley@peterboro.net homepage: http://sirkrustin-online.iwarp.com == Last updated 8/28/1999 ======================================= --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: @Work Internet powered by @Home Network (1:109/42) +----------------------------------------------------------------------------+ From: jdc0014@InfoNET.st-johns.nf.ca 18-Sep-99 01:50:10 To: All 18-Sep-99 04:37:14 Subj: Re: Canon BJC-5000 From: jdc0014@InfoNET.st-johns.nf.ca (John Hong) John E. Jones (jejs@verinet.com) wrote: : Has any found a driver that will work with this printer? OMNI.EXE has a generic driver for it but I don't know if it works. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: St. John's InfoNET (1:109/42) +----------------------------------------------------------------------------+ From: rsteiner@visi.com 17-Sep-99 23:53:29 To: All 18-Sep-99 04:37:14 Subj: Re: Orb works under OS/2! From: rsteiner@visi.com (Richard Steiner) Here in comp.os.os2.misc, "Richard M. Dunham" spake unto us, saying: >Just wanted to let you know that I recently purchased an Orb SCSI >external drive and it is working well under OS/2 using Fixpak 11 >and the updated device drivers fixpak. What do you think of the drive? And has an internal SCSI model been released yet? -- -Rich Steiner >>>---> rsteiner@visi.com >>>---> Bloomington, MN OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-) I'm flexible..just don't change anything. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42) +----------------------------------------------------------------------------+ From: stonehnge@my-deja.com 18-Sep-99 05:27:20 To: All 18-Sep-99 04:37:14 Subj: Re: ? possible to "format c: /s" with DOS from A:? From: Rick Davis HI group! I thought this was an OS2 group...;-} Shows you haw observant I am. To reformat a hard drive (for DOS) - you will need either a bootable floppy or a floppy with the following files on it: IO.SYS, MSDOS.SYS, SYS.EXE, COMMAND.COM, And FORMAT.EXE (the IBM counterparts are necessary if your are formatting for PC-DOS :-]) the syntax is: (from the floppy drive - doesn't matter which one if 2 exist) Format C: [return] after the formatting is complete: a new command: SYS C: This will transfer the system files to C: Alternatively for a hard drive that has lost it's system files (do-do happens!) This restores the hidden system files it helps to have a Boot Diskette you can create one from another floppy that has the above files - you need also ATTRIB.EXE attrib IO.SYS +r +s +h attrib MSDOS.SYS +r +s +h Now you have a boot diskette. The versions must agree! SYS c: transfers the system files to the C: partition Of course you can use the command FORMAT C: /s to accomplish the same thing - but when you format a drive you lose data that is present As for FDISK. FOR MS-DOS (sorry, that's the one I have) the limit is 2GB per partition because it is a 16-bit file system and the highest number in a 2^16 array is 65536 and at 512k per this is appx 2.1GB [largest partition].IMHO -and experience- any partitions (DOS or not) can be removed with v.6.x not sure about 5.x - you do have to do it in reverse order - a non-dos partition can be removed. Alternately, you can use System Commander and remove anything - and not have to know what you are doing. you can also add partitions if you like. You will need a small DOS partition to use this. As for PC-DOS 7 - I have no experience. rick davis WFW/WARP4-FP10 {separate primaries) In article <2wXhN2lSy6=grNR97VD4egviU6XV@news.kraftwerk.net>, Remove silverware to reply wrote: > Bob Germer [] -> comp.os.os2.misc: > > » Only PC-DOS 7 FDISK seems able to remove non-DOS paritions, BTW. > > Tip (for they who don't have access to DOS-7): > > A good utility that so far has been able to remove all type of partitions for > me has been the DOS tool delpart.exe from MS (try FTP search on the file name > or get it from my badly updated http://home2.sbbs2.com/mn/start page). > > Has zapped everything I tried in a second! > > Best regards, > > m a r t i n | n > > -- > Martin Nisshagen PGP 6.0: 0x45D423AC K R A F T W E R K :-) > CS/CE, Chalmers, Sweden ICQ UIN: 689662 2 x 300A @ 450 MHz > d4nisse-at-dtek-chalmers-se home2.sbbs2.com/mn home2.sbbs2.com/mn/kw > Sent via Deja.com http://www.deja.com/ Share what you know. Learn what you don't. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Deja.com - Share what you know. Learn what you do (1:109/42) +----------------------------------------------------------------------------+ From: jdc0014@InfoNET.st-johns.nf.ca 18-Sep-99 03:08:28 To: All 18-Sep-99 04:37:14 Subj: Re: help - Yamaha 6416S & Future Domain SCSI controller From: jdc0014@InfoNET.st-johns.nf.ca (John Hong) lhadley@nospam.net wrote: : Upon reboot, the system appeared to lock up. (Ctrl-Alt-Del didn't work). : Rebooting with Alt-F2 showed the system stopping when encountering : PARTFILT.FLT (a component of fat32os2) remming out the fat32os2 components : didn't change a thing. : Is this a version problem or should I try setting some switches on the : drivers? Having no prior experience with SCSI, I'm not sure where to go : next.... A wild guess...is the Yamaha's termination set on? --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: St. John's InfoNET (1:109/42) +----------------------------------------------------------------------------+ From: rsteiner@visi.com 18-Sep-99 00:04:00 To: All 18-Sep-99 04:37:14 Subj: Re: DOS and OS/2 and boot issue From: rsteiner@visi.com (Richard Steiner) Here in comp.os.os2.setup.misc, wbg@hevanet.com (wbg) spake unto us, saying: >I frankly don't know how System Commander has survived, given the presence >of IBM's superb Boot Manager as a free ridealong on both Warp and >Partition Magic (who liked it so well they licensed it from Big Blue. Boot Manager is very good at what it does, and for most people using a simple multi-boot setup I suspect the two utilities are equivalent. However, I use a copy of System Commander 3.0 on my second box because it has a more complex setup than this one does, and from what I've seen System Commander can do a lot more than Boot Manager. For example, I currently use System Commander on my second box to boot Solaris 2.6 from the second physical drive (something that Boot Manager wasn't able to do at all). Also, System Commander allows me to choose which primary partitions I want visible on an OS-by-OS basis. IBM's Boot Manager assumes that only one primary will be visible. A weird requirement, perhaps, but I've found it to be quite useful on a couple of occasions. -- -Rich Steiner >>>---> rsteiner@visi.com >>>---> Bloomington, MN OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-) Save a tree. Eat a beaver. ! --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42) +----------------------------------------------------------------------------+ From: omurata@ga2.so-net.ne.jp 18-Sep-99 17:19:19 To: All 18-Sep-99 06:00:27 Subj: Re: Canon BJC-5000 From: Tadashi Ohmura "John E. Jones" wrote: > Has any found a driver that will work with this printer? > > Cannon BJC-5500 and BJC-5500J are supported with OMNIJ driver. -- Tadashi Ohmura ( $BBgB<(B $BCi;K(B ) E-mail : omurata@ga2.so-net.ne.jp 5-3-4 kaijin Funabashi City Chiba Pref. 273 JAPAN --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Stella (1:109/42) +----------------------------------------------------------------------------+ From: omurata@ga2.so-net.ne.jp 18-Sep-99 18:41:21 To: All 18-Sep-99 11:03:05 Subj: Re: upgrade Warp4 client to Warp5 client From: Tadashi Ohmura I try to write the several files from "WarpServer for e-business" over Warp4 client without any install process. (1) collect the files from "WarpServer for e-business" (1-A) turn off system, hidden and read-only attribute of OS2* files in the root directory of the boot drive. The following files come up to the root directory. OS2BOOT OS2DUMP OS2LDR OS2LDR.MSG OS2LOGO OS2VER (1-B) \OS2\DLL\DOSCALL1.DLL (1-C) the all files in \OS2\BOOT (1-D) the all files in \OS2\DLL (2) write these files onto the corresponding directories of Warp4. High resolution of screen( 1600*1200 16bit color for me ) is kept under these process without backing to VGA. In this "Warp5 client" environment , I can run these drivers ----------------------------------------------------------------------------- Danis506.add Gamma 5 VFAT-OS2 0.05 MWDD32.SYS ( OS/2 32bit IFS ) EPOMNI.DRV ( Epson Color Printer Driver ) Matrox Display Driver version 2.23.082 Java for OS/2 1.1.7 ----------------------------------------------------------------------------- In this "Warp5 client" environment , I can run these apps. ----------------------------------------------------------------------------- Injoy v1.00, Netscape Communicator 4.61 beta2, WarpZip v2.2 PrintScrn 2.0.1C ( Screen Image Utility ) Enhanced Editor [EPM] with JavaBar. ( Java compile OK ) Acrobat Reader 3.0 ( print OK ) Acrobat Viewer for Java ( color print OK ) DrawIt 3.1 ( color print OK ) ----------------------------------------------------------------------------- In this "Warp5 client" environment , I can run these WPS utility ------------------------------------------------------------------------------- ----------- XFolder 0.85 NPSWPS (WorkPlaceShell Enhancer ) ----------------------------------------------------------------------------- -- Tadashi Ohmura ( $BBgB<(B $BCi;K(B ) E-mail : omurata@ga2.so-net.ne.jp 5-3-4 kaijin Funabashi City Chiba Pref. 273 JAPAN --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Stella (1:109/42) +----------------------------------------------------------------------------+ From: News@The-Net-4U.com 18-Sep-99 09:42:10 To: All 18-Sep-99 11:03:05 Subj: Re: Canon BJC-5000 From: News@The-Net-4U.com (M.P. van Dobben de Bruijn) > "John E. Jones" wrote: > Has any found a driver that will work with this printer? Better do a DejaNews search for this in the comp.os.os2.* hierarchy over the last one-and-a-half month. Believe that the printer was on the DDPak list first and then stricken at a later stage again. Which may have duped if I remember it correct at least one buyer. You may want to contact him on it. Regards from Leeuwarden Peter van Dobben de Bruijn --- usethenet.at.the-net-4u.com (at becomes @) ---- --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: TeleKabel (1:109/42) +----------------------------------------------------------------------------+ From: bobg.REMOVEME.@pics.com 18-Sep-99 08:10:09 To: All 18-Sep-99 11:03:06 Subj: Re: ? possible to "format c: /s" with DOS from A:? From: Bob Germer On , on 09/18/99 at 01:57 AM, muses9@cyberus.ca (Marko) said: > On Thu, 16 Sep 1999 13:23:18, Bob Germer made > history by saying: > -> muses9@cyberus.ca (Marko) said: > -> > I've tried it, which is why I asked. The format command dies on > trying -> > to write the boot sector to C:. If you have actually > succeeded in doing -> > this, I'd sure like to know what you did. > -> > -> I have found that only IBM's PC-DOS 7 can do this with large > partitions. -> if the partitioning was done with Windoze 9x, NT, or some > flavors of Unix, -> you will need to delete all the partitions and > repartition it with FDISK. -> Only PC-DOS 7 FDISK seems able to remove > non-DOS paritions, BTW. -> Bob Germer from Mount Holly, NJ - E-mail: > bobg@Pics.com > Hi Bob, > Thank you for the information. I am in fact using PCDOS7. Do you mean > that I just have to delete the partiition in question, or ~all the > partitions on C:~? That would make this process undesirable, since I > have Boot Manager, W95, W3.11, and WNT4 on my C:. First of all, I didn't read the subject carefully enough. One must BOOT DOS to put DOS on Drive C. One cannot do it from a DOS from Drive A session in OS/2 if memory serves. If, indeed, the C partition has a proper setup and is not FAT32 or some such, then booting the machine from floppy and formatting will work. If memory serves, FDISK can delete a primary partition without deleting extended partitions. I haven't tried it for eons, however. Moreover, I would never attempt it unless I had a verified backup of the entire hard disk on tape first. -- ------------------------------------------------------------------------------- --------------- Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com Proudly running OS/2 Warp 4.0 w/ FixPack 8 MR/2 Ice Registration Number 67 Aut Pax Aut Bellum ------------------------------------------------------------------------------- --------------- --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: djm16@le.ac.uk 18-Sep-99 11:34:19 To: All 18-Sep-99 11:03:06 Subj: parallel port scanner in WIN-OS/2, not recognized From: djm16@le.ac.uk (Dr D.J. Maconochie) System: P200 Warp 4 + FP10 Colorado Primax Scanner + MGI Photosuite Problem: running the scanner software under Win-os2, the scanner is not recognized. I have tried the following: DOS settings: HWtimer = direct, print direct Printer selection: IBM NULL Spooler: disabled Config.sys: basedev=print01.sys /IRQ The software works fine under Win3.1. Any suggestions? apart from buy CFMtwain and a new scanner- none of the supported scanners are available in the UK. David Maconochie --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: University of Leicester, UK (1:109/42) +----------------------------------------------------------------------------+ From: lhadley@nospam.net 18-Sep-99 11:26:24 To: All 18-Sep-99 11:03:06 Subj: Re: help - Yamaha 6416S & Future Domain SCSI controller From: lhadley@nospam.net In <7ruvo9$lb9$1@coranto.ucs.mun.ca>, on 09/18/99 at 03:08 AM, jdc0014@InfoNET.st-johns.nf.ca (John Hong) said: >lhadley@nospam.net wrote: >: Upon reboot, the system appeared to lock up. (Ctrl-Alt-Del didn't work). >: Rebooting with Alt-F2 showed the system stopping when encountering >: PARTFILT.FLT (a component of fat32os2) remming out the fat32os2 components >: didn't change a thing. >: Is this a version problem or should I try setting some switches on the >: drivers? Having no prior experience with SCSI, I'm not sure where to go >: next.... > A wild guess...is the Yamaha's termination set on? I _think_ so. I installed it "as it came", and I remember seeing a jumper there. Incidentally, this drive installed under Winblows and runs fine. I've experimented a bit, and changing the order in the config (ie, moving the basedevs up to just under the IFS=HPFS line) changes NOTHING except where it locks. (the floppy driver this time) I'm strongly suspecting a driver vesrion problem or a basic hardware incompatiblity at this point. !os2 -- DLH AIM id "SirKrustin" In order of preference lhadley1@home.net, lhadley@peterboro.net homepage: http://sirkrustin-online.iwarp.com == Last updated 8/28/1999 ======================================= --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: @Work Internet powered by @Home Network (1:109/42) +----------------------------------------------------------------------------+ From: forkd4nisse@dtek.chalmers.se 18-Sep-99 16:44:08 To: All 19-Sep-99 03:20:28 Subj: Re: ? possible to "format c: /s" with DOS from A:? From: Martin Nisshagen Rick Davis [Deja.com - Share what you know. Learn what you don't.] -> comp.os.os2.misc: ¯ I thought this was an OS2 group...;-} Shows you haw observant I am. I'm well aware that delpart.exe is a DOS util, but it's great to use on systems you need to remove HPFS, NTFS, ext2fs, or other such partitions. Which was my whole point with the tip of using it (not how to install DOS). Best regards, m a r t i n | n -- Martin Nisshagen PGP 6.0: 0x45D423AC K R A F T W E R K :-) CS/CE, Chalmers, Sweden ICQ UIN: 689662 2 x 300A @ 450 MHz d4nisse-at-dtek-chalmers-se home2.sbbs2.com/mn home2.sbbs2.com/mn/kw --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Chalmers University of Technology, Sweden (1:109/42) +----------------------------------------------------------------------------+ From: jpsnyder@mindspring.com 18-Sep-99 09:42:21 To: All 19-Sep-99 03:20:28 Subj: Fixpacks? From: "Mr. Wonderful" Ok, now I have OS/2 Warp 4 installed and running fine. How do I tell what fixpacks I need? I am running it on an IBM ThinkPad 365ED -- System Specs: AMD K6-2/266Mhz 128MB RAM Win98SE Norton Utilities 4.0, Norton AntiVirus 5.0 WindowBlinds 0.97, Chameleon Clock 2.0 TraySaver --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: MindSpring Enterprises (1:109/42) +----------------------------------------------------------------------------+ From: bobg.REMOVEME.@pics.com 18-Sep-99 08:42:16 To: All 19-Sep-99 06:48:22 Subj: Re: DOS and OS/2 and boot issue From: Bob Germer On , on 09/18/99 at 12:04 AM, rsteiner@visi.com (Richard Steiner) said: > Here in comp.os.os2.setup.misc, wbg@hevanet.com (wbg) spake unto us, > saying: > >I frankly don't know how System Commander has survived, given the presence > >of IBM's superb Boot Manager as a free ridealong on both Warp and > >Partition Magic (who liked it so well they licensed it from Big Blue. > Boot Manager is very good at what it does, and for most people using a > simple multi-boot setup I suspect the two utilities are equivalent. > However, I use a copy of System Commander 3.0 on my second box because > it has a more complex setup than this one does, and from what I've seen > System Commander can do a lot more than Boot Manager. > For example, I currently use System Commander on my second box to boot > Solaris 2.6 from the second physical drive (something that Boot Manager > wasn't able to do at all). It works here. I boot from the second physical drive on three machines of the five here. > Also, System Commander allows me to choose which primary partitions I > want visible on an OS-by-OS basis. IBM's Boot Manager assumes that only > one primary will be visible. A weird requirement, perhaps, but I've > found it to be quite useful on a couple of occasions. First of all, one can only have 3 primary and one extended partition on a hard disk if DOS is to operate on it. Boot Manager counts as one of those partitions. Only one of the two remaining primary partitions can be visible at any given time. I can make either primary partition visible with Boot Manager. One can only see one in a given boot, but either of the two can be chosen to be visible to Warp. Normally my DOS/Win 3.1 partition is the visible one. However, I can make the Win98 partition visible if I so choose on the two machines which have separate WIN98 partitions. Those were the first two I set up with 98. I subsequently discovered that installing 98 on the DOS/WIN 3.1 partition allowed me to boot either OS on that partition by using F8 when the boot started and choosing option 7 (prior operating system) which boots PC-DOS 7 and has Win 3.11 available at the win command. -- ------------------------------------------------------------------------------- --------------- Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com Proudly running OS/2 Warp 4.0 w/ FixPack 8 MR/2 Ice Registration Number 67 Aut Pax Aut Bellum ------------------------------------------------------------------------------- --------------- --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: bobg.REMOVEME.@pics.com 18-Sep-99 08:51:23 To: All 19-Sep-99 06:48:22 Subj: Re: DOS and OS/2 and boot issue From: Bob Germer On , on 09/17/99 at 10:09 PM, rgibson@ix.netcom.com (Ron Gibson) said: > On Fri, 17 Sep 1999 03:43:56, wbg@hevanet.com (wbg) wrote: > > : I see that you have two C drives listed here so I'm assuming there's a > > : way to boot so that only one is active otherwise drive letters are gonna > > : get screwed up. Can you elaborate on this point? > > > From the Boot Manager menu, you control which one is active, and all other > > C: partitions (no reason you couldn't have 5 or 6 AFAIK) are considered > > "hidden". It echoes all this in the appropriate column on the > > Boot Manager menu. Nope, one can only have 4 primary partitions and no extended partition or 3 primary and one extended. Boot Manager is one of those 3 primaries. > Well kiss my grits. All this time I've been using boot manager and I > never noticed this. So, I upgraded W31 to W98 and I'd like to keep > DOS/Win3.1 around for just a little while longer. But I'd have to split > a partition out around the 4 gig mark or so and make a primary > partition. Doing that I could set it as active and install my old > DOS/Win3.1 right? One can install Win 98 on the same partition as DOS/WIN 3.1. It will install Windows 98 into a directory tree called Windows.000 (you can change it). It will migrate your Win3.1 apps to the new desktop and preserve the older setup in its entirety. To boot the older version, merely hold down the Control key when Win98 starts to boot and choose option 7 (at least on my setup it's 7) which says Boot prior version of Operating System or words to that effect. If one's Win9x CD is an OEM version supplied with a new machine, one must rename win.com (anywhere it exists on the hard drives) to win.xxx (where xxx is anything other than com). After Win 98 is done installing, ren win.xxx back to win.com and all is well. -- ------------------------------------------------------------------------------- --------------- Bob Germer from Mount Holly, NJ - E-mail: bobg@Pics.com Proudly running OS/2 Warp 4.0 w/ FixPack 8 MR/2 Ice Registration Number 67 Aut Pax Aut Bellum ------------------------------------------------------------------------------- --------------- --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: maxikins@os2bbs.com 18-Sep-99 19:05:13 To: All 19-Sep-99 06:48:22 Subj: Re: Kensington Mouse-in-a-box Scroll? From: maxikins@os2bbs.com (Mark Klebanoff) On Sat, 18 Sep 1999 18:10:09, jdc0014@InfoNET.st-johns.nf.ca (John Hong) wrote: > > Does Kensington's Mouse-in-a-box scroll mouse operate under OS/2? > Most mice will operate under OS/2. I know that my Logitech trackman+ works under the plain old scrollms driver- even the wheel. PS/2 mice work better than serial, but most mice are ps/2 these days --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Verio (1:109/42) +----------------------------------------------------------------------------+ From: racette@cablevision.qc.ca 18-Sep-99 19:42:09 To: All 19-Sep-99 06:48:22 Subj: Re: Kensington Mouse-in-a-box Scroll? From: racette@cablevision.qc.ca (Martin Racette) On Sat, 18 Sep 1999 18:10:09, jdc0014@InfoNET.st-johns.nf.ca (John Hong) wrote: > > Does Kensington's Mouse-in-a-box scroll mouse operate under OS/2? > > Check theire web site at: http://www.kensington.com/ they usually have all the drivers including OS/2's there, and I do know that they support their scroll Ball well, I use one and I got the drivers for it from them //------------------------- Good Luck Bonne Chance Martin http://205.237.57.73/ ICQ #48552954 --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: rgibson@ix.netcom.com 18-Sep-99 21:14:22 To: All 19-Sep-99 06:48:22 Subj: Re: DOS and OS/2 and boot issue From: rgibson@ix.netcom.com (Ron Gibson) On Sat, 18 Sep 1999 12:51:46, Bob Germer wrote: > > Well kiss my grits. All this time I've been using boot manager and I > > never noticed this. So, I upgraded W31 to W98 and I'd like to keep > > DOS/Win3.1 around for just a little while longer. But I'd have to split > > a partition out around the 4 gig mark or so and make a primary > > partition. Doing that I could set it as active and install my old > > DOS/Win3.1 right? > > One can install Win 98 on the same partition as DOS/WIN 3.1. It will > install Windows 98 into a directory tree called Windows.000 (you can > change it). It will migrate your Win3.1 apps to the new desktop and Hmmm.. I installed the W98SE upgrade and that option wasn't obvious. However, I saved that installation and today I broke out a dos system disk, split a partition, sysed it and reinstalled my old W31 in another primary partition. So I'm a happy camper. Can't believe all this time and I never noticed this option. email: rgibson@ix.netcom.com --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Netcom (1:109/42) +----------------------------------------------------------------------------+ From: JHB@jita.demon.co.uk 18-Sep-99 21:44:26 To: All 19-Sep-99 06:48:22 Subj: Re: Fixpacks? From: JHB@jita.demon.co.uk (Jim Backus) A good place to start is: http://service5.boulder.ibm.com/pspfixpk.nsf The basic philosophy for fixpacks is "if it ain't broke don't fix it" but with the date chane to year 2000 imminent it's probaly making sure you're fully up to date with all those recommended for y2k - others are up to you. In message <7s08f4$jtd$1@nntp5.atl.mindspring.net> - "Mr. Wonderful" writes: :> :>Ok, now I have OS/2 Warp 4 installed and running fine. How do I tell = :>what :>fixpacks I need? I am running it on an IBM ThinkPad 365ED :> :>--=20 :>System Specs: :>AMD K6-2/266Mhz :>128MB RAM :>Win98SE :>Norton Utilities 4.0, Norton AntiVirus 5.0 :>WindowBlinds 0.97, Chameleon Clock 2.0 :>TraySaver :> Jim Backus - Electronic Systems Engineer - OS/2 user by choice - member of Amnesty International - supporter of Proportional Representation Bona fide replies to jimb (at) jita dot demon dot co dot uk --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Fourmyle (1:109/42) +----------------------------------------------------------------------------+ From: maxikins@os2bbs.com 18-Sep-99 23:31:01 To: All 19-Sep-99 06:48:22 Subj: Re: Kensington Mouse-in-a-box Scroll? From: maxikins@os2bbs.com (Mark Klebanoff) On Sat, 18 Sep 1999 19:05:22, Dale Erwin wrote: > > What's the difference between a PS/2 mouse and a bus mouse? > -- Beats me --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Verio (1:109/42) +----------------------------------------------------------------------------+ From: rsteiner@visi.com 18-Sep-99 19:13:22 To: All 19-Sep-99 06:48:23 Subj: Re: DOS and OS/2 and boot issue From: rsteiner@visi.com (Richard Steiner) Here in comp.os.os2.setup.misc, Bob Germer spake unto us, saying: >On , on 09/18/99 at 12:04 AM, > rsteiner@visi.com (Richard Steiner) said: > >> For example, I currently use System Commander on my second box to boot >> Solaris 2.6 from the second physical drive (something that Boot Manager >> wasn't able to do at all). > >It works here. I boot from the second physical drive on three machines >of the five here. I'm talking explicitly about Solaris. IBM's Boot Manager will boot OS/2, Linux, and FreeBSD from the second drive (and probably BeOS), but it will not boot Solaris from the second drive. The Boot Manager limitation with Solaris is the reason why I purchased System Commander in the first place -- I was using Boot Manager before I installed System Commander on that machine. -- -Rich Steiner >>>---> rsteiner@visi.com >>>---> Bloomington, MN OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-) Simple! Do this... - Wesley Crusher --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42) +----------------------------------------------------------------------------+ From: rsteiner@visi.com 18-Sep-99 19:20:20 To: All 19-Sep-99 06:48:23 Subj: Re: DOS and OS/2 and boot issue From: rsteiner@visi.com (Richard Steiner) Here in comp.os.os2.setup.misc, wbg@hevanet.com (wbg) spake unto us, saying: >Richard Steiner (rsteiner@visi.com) wrote: > >: However, I use a copy of System Commander 3.0 on my second box because >: it has a more complex setup than this one does, and from what I've seen >: System Commander can do a lot more than Boot Manager. > >: For example, I currently use System Commander on my second box to boot >: Solaris 2.6 from the second physical drive (something that Boot Manager >: wasn't able to do at all). > >wbg: > >Odd - I have Linux on a second spindle, and BM just wakes up LILO (which >is in the first sector of the second spindle) and LILO wakes up Linux. >Seems to work just fine. BM has no difficulty reporting the second >spindle and identifying it as such, either. I must have been unclear. Solaris in particular has limitations which make it incompatible with Boot Manager when it is present on the second physical drive, at least as far as I've been able to determine though research and experimentation. All other OSes I've tried work fine with Boot Manager when placed on the second drive. I was talking about Solaris specifically. >: Also, System Commander allows me to choose which primary partitions I >: want visible on an OS-by-OS basis. IBM's Boot Manager assumes that >: only one primary will be visible. A weird requirement, perhaps, but >: I've found it to be quite useful on a couple of occasions. > >I am not sure I fully grasp what you are saying here. Do you mean >multiple *simultaneous* open primaries, or "serially" available ones? Simultaneous. I have NT on the first primary and DOS on the second, and with System Commander, I can tell System Commander to toggle the PC-DOS partition as "visible" to NT, and the end result maps the DOS primary partition to the end of the fixed disk drive letters (in my case, the PC-DSO partition becomes drive J:). It's useful if I want to copy something between the DOS primary and the NT primary without having to use an intermediate drive. >BM does assume that only one example of a drive letter will be >available at one time; the one you have selected from the >Boot Manager menu - I have always understood that to be an underlying >BIOS limitation . . . ?? It has nothing to do with the BIOS (as far as I know). -- -Rich Steiner >>>---> rsteiner@visi.com >>>---> Bloomington, MN OS/2 + Linux + BeOS + FreeBSD + Solaris + WinNT4 + Win95 + DOS + VMWare + Fusion + vMac + Executor = PC Hobbyist Heaven! :-) Circular Definition: see Definition, Circular. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: FIELDATA FORTRAN ENTHUSIASTS CLUB (1:109/42) +----------------------------------------------------------------------------+ From: mchasson@ibm.net 18-Sep-99 20:35:04 To: All 19-Sep-99 06:48:23 Subj: Re: parallel port scanner in WIN-OS/2, not recognized From: mchasson@ibm.net In <7rvprv$61sr7@harrier.le.ac.uk>, on 09/18/99 at 11:34 AM, djm16@le.ac.uk (Dr D.J. Maconochie) said: >System: P200 >Warp 4 + FP10 >Colorado Primax Scanner + MGI Photosuite >Problem: running the scanner software under Win-os2, the scanner is not >recognized. I have tried the following: >DOS settings: HWtimer = direct, print direct >Printer selection: IBM NULL >Spooler: disabled >Config.sys: basedev=print01.sys /IRQ >The software works fine under Win3.1. >Any suggestions? apart from buy CFMtwain and a new scanner- none of the >supported scanners are available in the UK. >David Maconochie David, The answer to this one lies in the driver. If the windows 3.1 driver is a twain file then it will work. If the driver is a .vxd file, then it wont. I have a Umax parallel port which works very well in win-os2. For you information windows uses virtual device drivers which cannot be seen by os2. THis may help, the Umax is very cheap in the USA; less than $60. -- ---------------------------------------------------- ------ Monroe Chasson mchasson@ibm.net ----------------------------------------------------------- MR2ICE reg#51 --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne (1:109/42) +----------------------------------------------------------------------------+ From: gbritton@!britton.dhs.org 19-Sep-99 01:38:20 To: All 19-Sep-99 06:48:23 Subj: Partition re-arranging From: "Gerry Britton" have 3 physical drives: 1-SCSI Furball 2.1 G BM <--Primary C:[hidden] Warp4 FP whatever 500Meg <--Primary C:Aurora 700Meg <--Primary E: proggies 720Meg <--Logical 360Meg used F: Emergency/Maintenance Boot 54Meg <--Logical 2-SCSI Furball 2.1G D:All kinds of stuff 2100Meg <--Primary 1300Meg used 3-WD 13G EIDE -Free Space- 2000Meg G:Big_Drive 10000Meg <--Logical 1500Meg used I'm looking for suggestions as to how to re-organize the partitions to allow installation of other OS's, at least NT, Win98, RH6.0 etc. I've tried various ways, all quite unsatisfactory, so I'm open to suggestions. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: @Home Network Canada (1:109/42) +----------------------------------------------------------------------------+ From: mchasson@ibm.net 18-Sep-99 21:01:29 To: All 19-Sep-99 06:48:23 Subj: Scanner Recognizing LPT2 From: mchasson@ibm.net THis may be of interest to those of you who delve into arcana. I have a Umax PP setup on LPT2 which has worked very well. Then we had the painters, and I took everything down and moved it. I ran for the three weeks without the scanner. I tried to set it up again and found I had no luck. The software did not work on LPT2 in win-os2. It worked fine in Win 3.1 on the Dos partition. So I read all the damned ini files and there was no help there, until I suddenly recalled that I had had a second printer connected through the scanner. I am not using it at the moment so I did not install it this time. Just on a hunch I plugged a cable end into the back of the scanner where the printer goes, and you know, it is all back to normal. What is this??? Some kind of non SCSI termination. -- ---------------------------------------------------- ------ Monroe Chasson mchasson@ibm.net ----------------------------------------------------------- MR2ICE reg#51 --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne (1:109/42) +----------------------------------------------------------------------------+ From: bogus.due2UCE@atlantic.net 18-Sep-99 18:40:02 To: All 19-Sep-99 06:48:23 Subj: Re: Offline Storage Options From: Felix Miata John Hong wrote: > Alan Beagley (abeagley@datatone.com) wrote: > : Re: using another hard disk for backup. As I read the newspaper report the > : other day of a flash flood (4.5" in a very short time) further east on Long > : Island, I read about the man with the computer business located in basement > : premises, who was interviewed while he was carrying his waterlogged > : equipment upstairs. All his work, all his records were lost, he complained. > : And I was reminded how useless is any backup system that does not allow for > : off-site backups. So: if you use a removeable hard disk and take it home > : each night or put it in the safety-deposit box, you're fine; otherwise > : forget it. > Just a little curious question, but... Would water damage a > CDROM? I mean, once it got wet, what would happen to it if we left it > sit and dry. Would we still be able to use it or is it toast? I lost several music CDs, less than 5% of a whole collection, as a result of submersion for less than 4 hours in salt water. Damage was typical of corrosion: no apparent affect at first, but with time, the foil inner layer developed holes too big for error correction to handle. -- A man who lacks judgment derides his neighbor, but a man of understanding holds his tongue. Proverbs 11:12 NKJV Team OS/2 Felix Miata *** http://mrmazda.members.atlantic.net --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Webmasters, have you read: http://www.mcsr.olemis (1:109/42) +----------------------------------------------------------------------------+ From: george.barrowcliff@bergenbrunswi... 19-Sep-99 04:20:15 To: All 19-Sep-99 06:48:23 Subj: Warp 4 Freeze on Reboot Message sender: george.barrowcliff@bergenbrunswig.com From: "George Barrowcliff" Installing Warp 4 on new 550 MHz IBM 300PL processors. These come with NTin the first 2GB, so I kept NT and installed in the next 2GB with 2GB for an extended dos partition. The installs seem to go fine, except when the final reboot of the install, after the blue OS/2 screen, the config messages pop up, then the boot drive statistics are displayed, cleared and a flashing underscore cursor in the upper left of the screen. Alt-F1 and selecting the command line session shows that everything seems normal, nothing funny in the install log. Selecting VGA several times on boot up seems to get it working in the VGA mode. I've done three systems now and each one acts a little different but all are finally running. I have 10 more to go and would like to understand why these systems act this way. The video chip set is S3 Trio and is correctly detected. Should these be installed as VGA then updated later to SVGA? What a shame. IBM has introduced these killer processors and not a single word anywhere in any of the documentation about OS/2 except to say in the sales literature that it '.. has been tested with OS/2 Warp..' I went to the West Warpfest today and there probably wasn't 50 people in the product display area at 2:00 PM. GWB --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42) +----------------------------------------------------------------------------+ From: szrob@ns.net 19-Sep-99 03:07:13 To: All 19-Sep-99 06:48:23 Subj: How to Update a CDRom From: szrob@ns.net (John Roberts) Greetings all: I loaded Os2 Warp 4 last week. All went well. I updated to fix pac 5. Now I just installed a new cdrom drive. I ran the install program and selected the type in the cdrom window. After I hit the next button several times, the program asks for the image (Warp4 on cd) to load. Trouble is my cd drive (drive G) is no longer seen by the system. Help!! This must be easy; at least for someone. evidently not me. Any help would be greatly appreciated. John Roberts --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Verio (1:109/42) +----------------------------------------------------------------------------+ From: nightmare@uni-muenster.de 17-Sep-99 21:41:15 To: All 19-Sep-99 06:48:23 Subj: 4.96mt406.94m.600m.m5.00gm.ki From: anonymous remailing service [updated 2451439.28779] The reckoning is already begun! Note: Nostradamus' "seven month" is *definitely* Ethanim[Tishri], 1999 AD[Century X-Quatrain 72]: Av 5759 molad: Tue, Jul 13, 1999 AD @ 04:37:38 AM JST (Julian date 2451372.60947) S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29* 30 *total solar eclipse is molad of Elul; this marks Jesus' 2001st tropical-solar birthday, tribulation ensues; the demise of the divided fourth empire of "iron/miry clay" is imminent! Note also that the C/Lee fragment spotted during this solar eclipse was recognized by only a few, precisely as expected[ref. Michel de Nostradamus C3Q34] This "monstre" will be seen clearly within several weeks. Elul 5759 molad: Wed, Aug 11, 1999 AD @ 01:06:01 PM JST (Julian date 2451401.96251) S M T W T F S 1* 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 *Jesus' 2001st Hebrew Calendar Birthday, Aztec Calendar `13 Cane', Day of Destiny, next month Ethanim[Tishri] commences second half of Jesus' 7-year Ministry--Enter the Lion! These 3 1/2 years of tribulation are shortened for the elect's sake[Gk. eklektos, {mutually}"selected"] thus no one, not any man, neither any angel, not even Jesus knows the day nor the hour, but the Father ONLY. This [7th]month is undoubtedly Nostradamus' "sept mois", and *this* Gregorian[Roman] year 1999 Anno Domini is the correct year, so *this* is it: Prepare for YHWH's Wrath! ------- HEBREW/JEWISH CIVIL CALENDAR YEAR 5760 ------- (385/"perfect" leap year, Type 11, 4-7-P; notably is identical type of calendar year as Jesus' crucifixion, 3791[30-31 AD]) Tishri 5760 molad: Thu, Sep 09, 1999 AD @ 11:44:58 PM JST (Julian date 2451431.40623) S M T W T F S 1* 2 3 4 5 6 7 8 9 10< 11 12 13+ 14 15> 16 17 18 19 20 21 22<< 23 24 25 26 27 28 29 <<<30 *Rosh ha-Shannah, Saturday, September 11th, 1999; marks the beginning of globally-catastrophic events foretold in many scriptures and warnings; Jesus was baptised---commencing His 7-year Ministry---1972 years ago, Rosh ha-Shanah, Sat, Sept 20, 27 AD[1 Tishri 3788]; Feast of Tabernacles[15-21 Ethanim]; < 19 20 21 22 23 24 25 26 27 28 29 30 *John the Baptist's 2002nd Hebrew Calendar Birthday; +Passover, 1969th anniversary of Jesus' crucifixion; /High Sabbath, 1969th anniversary of Jesus' entombment; >I'star, 1969th anniversary of Jesus' resurrection. Iyyar 5760 molad: Thu, May 04, 2000 AD @ 06:25:54 AM JST (Julian date 2451668.68465) S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Sivan 5760 molad: Fri, Jun 02, 2000 AD @ 02:30:57 PM JST (Julian date 2451698.02149) S M T W T F S 1 2 3 4 5 6 7 8 9* 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 *Pentecost("day of completion", Acts 2:1), June 12. Tammuz 5760 molad: Sat, Jul 01, 2000 AD @ 09:28:41 PM JST (Julian date 2451727.31159) S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Av 5760 molad: Mon, Jul 31, 2000 AD @ 04:19:30 AM JST (Julian date 2451756.59687) S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Elul 5760 molad: Tue, Aug 29, 2000 AD @ 12:03:46 PM JST (Julian date 2451785.91928) S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 "every eye shall see him" [ref. Apokalupsis Ioanes] Happy earthchanges, Daniel --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: mail2news@nym.alias.net (1:109/42) +----------------------------------------------------------------------------+ From: raphaelt@netnews.worldnet.att.net 18-Sep-99 21:24:14 To: All 19-Sep-99 18:48:06 Subj: Re: dire need of HELP! From: raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum) Tony Wright wrote: >snip of great post I'm here to say your keen insight and dare I say it, kindness during this episode have been more than helpful, Tony. I probably read your post four or five times. After a not very entertaining 36 hours spent pulling cards, changing SIMMs, running diagnostics, I'm sure everyone will be delighted to hear what was probably obvious from the start: the hard drive seems to be toast. Fortunately, I guess. And it's still under warrantee. Anyone who cares to hear the saga... I pulled the SIMMs one at a time, moved each individually into another socket etc -- same problems; still meanwhile, diskette boot never failed. I pulled the modem (should have done this first). I took Mat Nieuwenhoven's advice and ran a virus tester (should have done this second but of course a vast tributary of de Nile runs through this place). I turned off Level 2 cache. Actually what I did do first wasn't really such a bad idea: replacing the internal wide-scsi cable, which is the only thing that connects from the wide connector on the onboard scsi bus -- tape and cd-rom are off the ultra port. Well, then I also double-checked that the drive was terminated properly, and the ID was set right; also that the scsi bios was set properly (HIGH ON LOW OFF, whatever it is, I can't remember). Still the same mess. I've been using another drive off the ultra bus as sort of backup -- I could have reformatted that and tried to boot from it: but then I remembered I've got an old Fujitsu (and I mean old) drive hanging around, so I put that in and hung it off the ultra connector after changing the SCSI id to 3 from 0. I reformatted (low-level) it from scratch, diskette-booted, then partitioned and formatted it. Set the Adaptec to boot from it instead of the IBM Ultrastar, then diskette-booted and started copying everything over from the Ultrastar's maintenance partition, just to see. (One thing I never would have suspected: when there are two disks with Boot Managers, even if you're set one as the boot disk from the SCSI bios, when Boot Manager shows up, it'll incorporate BOTH BMs, kinda weird if you're not expecting it.) I disconnected the UltraStar, rebooted, and waited.... and my maintenance partition came straight up. I can't say I was doing backflips, but I was pleased enough. I re-enabled L2 cache, set up Trevor's MEMOS2 to run for however long it needed, and went out on a cheap date ("Run Lola Run," entertaining, great editing -- kind of five movies for the price of one) but she wanted sushi afterwards, so I'd have to wait to whether my chips was dead meat. (And no, I didn't get any sushi, .) Then I tried the same with my old Warp3 partition: tried copying it to the Fujitsu from the Ultrastar -- alas, Trap 003. Then I attempted a restore to the Fujitsu from my tar archive of a few months ago -- I seldom use Warp3 anymore, so it didn't matter for the purposes of a test; my Warp4 install on the Ultrastar was about ten letters higher, forget that -- but same results. This was around 2AM last night, so while I was a bit discouraged I figured I needed the sleep anyway. This morning I got out that old Warp3 box and did an install from scratch. I figured installs work the system as hard as anything, and if it made it through on the Fujitsu, I could figure it being the Ultrastar. It did, so I am. Most of today was spent getting Netscape and other stuff running so that I can use the desktop for some stuff (filling in html on a laptop isn't much fun). Some unasked for notes, advice, homilies: 1) DON'T throw things out. I've had this Warp3 box on the shelf for I don't know how long, and many's the time I've thought, "why don't you just dump it -- and reformat all those disks for FixPack 32 while you're at it? Well, now I see why I kept them all. And while you might think RSU is a much better way to apply a fix than diskettes: believe me, if you haven't done one in 15 months and then you go onto Hobbes to try to sort out which is the best fixtool while you're simultaneously running a search (because you don't have your archived notes available) to find the location of Warp3 fixpacks, it won't take much to change your mind. 2) As to the question, which is better, Warp 3 or 4 -- the funny (sad actually) thing is that both are equally wanting, as equally pleasing. I was very fond of Warp 3, and went to 4 sort of reluctantly -- personally I think it does look a little nicer. I would say that Warp 3 stinks of unfulfilled promise, while Warp 4 reeks of somewhat brave but attenuated follow-through. (So much promise for a Warp 5 client: the JFS, to get rid of some big vestigial M$-ness; a real and final resolution of some of the sillinesses; a genuine committment to getting multimedia to be right... And we're still up against the same moving target thing with IBM! What was the primary reason for effectively ceasing OS/2 development? It wasn't giving it up to MS -- it was "thin clients," wasn't it? They're sure selling a lot of those now, aren't they? And while we're at it, OpenDoc sucked, right?) 3) I suppose I kinda figured all along it might be the HD but there was a) heh, denial, and b) the sense it's an IBM, it must be good -- but most especially, that old saw that c) the specs for SCSI drives are more strict, they're better quality than IDE, etc etc. (Now, when I say I've tried to be careful with it, I mean that I'll keep the a/c on in here when I personally could have done without it; or that I've kept power on/off cycles to a bare minimum -- switching it off only when I'd be away for more than three days. But -- who knows.) Now comes the tricky part: calling up IBM and asking them to issue me the warranty replacement BEFORE I send this drive back. I think under the circumstances I ought to be entitled, but you never know. Since you sort of asked -- I'm a writer (shameless in every sense) but around here I suppose that's like saying I use a computer. (However I am marginally better at writing, and get well underpaid for it.) Sometimes I'm an html slave (but a very "special" one!) Anyway, all this relief and joy on my part is obviously premature and presages nothing but utter disaster. But I would like to take this opportunity to pretend I'm accepting a cyber-Oscar (instead of a booby prize of four days' straight worth of trap screens) and thank each and every one of you swell eggs for chipping in here while I was freaking: il Grecque, David Kunz, Chris the Hamei -- who gets a portion of the first acknowledgement for sensing it really was the HD losing it. And of course Trevor Hemsley, I wouldn't be here if not for him -- plus there's Max from down Under -- and of course, you, Tony. (Don't worry, I won't say you really love me.) I must say as far as I'm concerned this community is anything but marginalized or insignificant, as I saw someone claiming some time ago: you guys are the best, no wonder I spend so much time here. Though I'm still not sure I have anything significant to offer about INI files, 'specially after you and Henk. 'gards, Ray -- Ray Tennenbaum '99 YZF-R6 readme@ http://www.ray-field.com --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: AT&T WorldNet Services (1:109/42) +----------------------------------------------------------------------------+ From: Trevor-Hemsley@dial.pipex.com 19-Sep-99 15:48:00 To: All 19-Sep-99 18:48:07 Subj: Re: Trouble Install with Warp 3.0 From: "Trevor Hemsley" On Sun, 19 Sep 1999 04:14:53 -0600, John E. Jones wrote: ->I have the a large HD(8.4Gb), so I went to IBM's site, and downloaded the ->fix for the installation disks. In the readme, it says to copy IBM1S506.ADD, ->IBMIDECD.FLT and OS2DASD.DMD to Disk 1. The only problem is that there is ->not enough room to put these suckers on there. I tried all of the following: ->deleting the three files off of the diskette first. I made new disks from ->the CD-ROM images. I copied the first disk to another. Anyway, what am I ->missing here? I would think that IBM would be smart enough to realize that ->they do not fit. Or, it's just late, and I am not thinking. If you don't have an Adaptec EISA SCSI card then you can delete AIC7770.ADD. If you don't have an Adaptec PCI SCSI card then you can delete AIC7870.ADD. REM the basedev line in CONFIG.SYS for the file(s) you delete. Don't delete anything else - the install program checks for most other things. Trevor Hemsley, London, UK (Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com) --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views (1:109/42) +----------------------------------------------------------------------------+ From: baden@unixg.ubc.ca 19-Sep-99 15:53:20 To: All 19-Sep-99 18:48:07 Subj: Re: Jstreet for Java problem From: baden@unixg.ubc.ca (Baden Kudrenecky) In <27533693774630634544334@unknown.host>, erwin Traas writes: >Hi, > >at last i found a java mailer which i can use cross platform. But under os2 i >get an error, it cannot start the prgram because it cannot find something. I've >denloaded the 1.1.8 version of java but still no luck. > >I use the following file to start the program :: >set classpath=g:\jstreet\innoval.jar;G:\TEMP\\JAVA11\lib\classes.zip >java.exe innoval.mailer.jstreet I use use a command file to start it, and it looks similar: @set classpath=E:\Applications\JStreet\innoval.jar;e:\java11\lib\classes.zip @start /N "J Street Mailer" /MIN java.exe innoval.mailer.jstreet >What am i doing wrong ( the g drive is formatted fat16, this to be able to use >the same program under windows ). That could be a big problem, however, I think there is a different install routine for FAT names. ================================================= 3. Unzip the .ZIP file into that directory. Be sure you're using an unzip program which extracts subdirectories and case sensitive filenames just as they are inside the .ZIP file. You should end up with a few files in the directory in which you unzipped, and a "doc" subdirectory, below that directory, which contains two files with mixed case names: Contents.htm and Index.htm, as well as several files with all-lowercase names. (If you're installing on a FAT [as opposed to VFAT] partition, their names will all be uppercase instead, but that's fine since FAT is not a case-sensitive file system.) If you unzip under Windows 95 or NT, and you are going to use the short filename mode (for compatibility with OS/2, etc.), you will have to rename HotJavaBean.jar to HOTJAVAB.JAR. If you unzip into a FAT partition under OS/2, your unzip program will have already given it that name so you won't have to worry about it. ================================================= >Thanks in advance >E. Traas > baden baden@unixg.ubc.ca http://baden.nu/ OS/2, Solaris & Linux --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: @Home Network Canada (1:109/42) +----------------------------------------------------------------------------+ From: horseman@ibm.net 19-Sep-99 18:47:12 To: All 19-Sep-99 18:48:07 Subj: Re: dire need of HELP! From: Tony Wright Raphael Tennenbaum wrote: > Tony Wright wrote: > > >snip of great post > > I'm here to say your keen insight and dare I say it, > kindness during this episode have been more than helpful, > Tony. I probably read your post four or five times. I rather you didn't dare mention "kindness" it does my street cred "sarky" image no good at all!. "4 or 5 times", is that all? - I just re-read my own 6 times and I still can't understand the blithering crap I wrote! :-( > After a not very entertaining 36 hours spent pulling cards, you mean apart from the time pulling gir.... ... never mind... > changing SIMMs, running diagnostics, I'm sure everyone will > be delighted to hear what was probably obvious from the > start: the hard drive seems to be toast. Fortunately, I > guess. And it's still under warrantee. > snipped the reply which I did read,appreciate and > understand(mostly)......for brevity > Now comes the tricky part: calling up IBM and > asking them to issue me the warranty replacement BEFORE I > send this drive back. I think under the circumstances I > ought to be entitled, but you never know. > Hate to be a party pooper after all that effort..... but now comes an even trickier part: Depending on their mood IBM will run their diagnostics and/or if they don't find anything they will possibly simply re-LLF the damn thing and return it NFF if it holds up on their soak test... :-( (Too convenient to blame SCSI adapter or OS's FS perhaps if no other explanation is readily forthcoming). Thus if you have luckily got a replacement some other unsuspecting user will be appending on a NT forum saying that how he got a superb bargain on a IBM recon SCSI HDD from a dealers basement bargain counter but has recently experienced a few disconcerting BSOD's on NT after a couple months usuage... :-( So as it wasn't clear(and I did re-read your feedback 4 times) whether you had retried LLF on the suspect drive (tis worth discussing this with Service Centre etc before attempting to return it) and/or can re-test on another SCSI adapter or PC, then you might want to consider these (hopefully unlikely) scenarios/alternatives? That is before a possibly lengthy RTV/RMA cycle and it possibly end's up back with you again anyway? ....and we all end up on that fruitless path of denigrating(or supporting) IBM's service support again.... (They were very good,excellent,superlative service when I etc....... No I disagree, they were lousy incompetents when I....etc) Needless to say this is a catch22 cos after checking with service point/dealer, then 4 options present themselves: 1. They accept the drive and replace it no questions asked(we do hope so after all that pain....)...or 2. If they hadn't thought of it(one hopes they will) they will check with Technical that LLF will not compromise any diagnostic info and you will LLF only to find it fails anyway and have to return it. 3.You will LLF and it will appear to fix the problem and you successfully use the drive until precisely 1 day after warranty expires at which time it will fail totally.......despite repeated LLF's.... and pleas to IBM/Dealer that you were conned/previously reported error etc..... you will join the endless queue of people pushing pins into my wax effigy.... 4. You LLF and continue using the drive flawlessly for many years until you are forced to replace OS/2V4 with latest Win2005 as the OS/2 fat client was no longer supported since last FP in Nov 2001(graciously extended from May 2001 by IBM due to mass user mail campaigns) at which point you have far more obtuse bugs to deal with anyway! ....and a diminutive 4.3/8Gb incredibly slow and space constrained SCSI HDD is a pathetic comparison to your latest entry level IBM 1Tb Holographic Optical Storage unit.....which doesn't have(nor will except on IBM OS2V6 server) OS/2 drivers anyway.....but is absolutely essential to contain William Gates the 4th's monolithic OS+Office Suite + Browser/Emailer + HTMLv8 auto generator + Video Conferencing + GPS/Kitchen utensil/Garage door interface module that everybody else is using... :-( > Since you sort of asked -- I'm a writer (shameless in every > sense) but around here I suppose that's like saying I use a > computer. (However I am marginally better at writing, and > get well underpaid for it.) Sometimes I'm an html slave > (but a very "special" one!) Anyway, all this relief and joy > on my part is obviously premature and presages nothing but > utter disaster. But I would like to take this opportunity > to pretend I'm accepting a cyber-Oscar (instead of a booby > prize of four days' straight worth of trap screens) and > thank each and every one of you swell eggs for chipping in > here while I was freaking: il Grecque, David Kunz, Chris the > Hamei -- who gets a portion of the first acknowledgement for > sensing it really was the HD losing it. And of course > Trevor Hemsley, I wouldn't be here if not for him -- plus > there's Max from down Under -- and of course, you, Tony. > (Don't worry, I won't say you really love me.) Phew - close call - there where a few rumours starting.... Ha! - I just love the way you commended all the others and then promptly insulted them by including me in the list as well. (Anecdote: just 4 days of trap screens Eh?...... You don't win the "Prat of the Decade" let alone "booby prize" unless you exceed 220 hours of diagnostic analysis,trap dumps and phone calls, 29 reloads including FP's, Boulder Testcase WD90C24 testcase video drivers, CPU + mobo + memory exchanged at least once - sometimes twice........ and still end up loyally recommending Thinkpads,OS/2 and IBM service to sceptical clients......) > I must say as far as I'm concerned this community is > anything but marginalized or insignificant, as I saw someone > claiming some time ago: you guys are the best, no wonder I > spend so much time here. Though I'm still not sure I have > anything significant to offer about INI files, 'specially > after you and Henk. That's right - you dirty rat! Pose the question/challenge then "jump ship" after you've wet yourself laughing as I drop myself right in it..... (but there's a sort of poetic justice watching me getting ceremoniously hoisted by my own petard....) ...and a very patient Henk is valiantly attempting to decipher my obtuse and verbose writing style while trying to impart pearls of wisdom and clarity into the moronic convoluted neural synapses that I laughing call my brain.... > 'gards, Ray > > -- > Ray Tennenbaum '99 YZF-R6 ??? I tried this call sign on 1.8MHz USB and got no reply? Try G4KVX and he'll relay via landline.... QSK.... > readme@ http://www.ray-field.com Seriously, I do hope IBM/Dealer/Service point whoever do manage to retain a valued and loyal customer and provide a truly working unit/replacement/extended warranty whatever.... Good Luck... -- Rgds Tony W Email: horseman@ibm.net "79's and 88's...." --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Equi-Tek CompCon (1:109/42) +----------------------------------------------------------------------------+ From: racette@cablevision.qc.ca 19-Sep-99 19:08:19 To: All 19-Sep-99 18:48:07 Subj: Re: Kensington Mouse-in-a-box Scroll? From: racette@cablevision.qc.ca (Martin Racette) On Sat, 18 Sep 1999 19:05:22, Dale Erwin wrote: > Mark Klebanoff wrote: > > > > On Sat, 18 Sep 1999 18:10:09, jdc0014@InfoNET.st-johns.nf.ca (John > > Hong) wrote: > > > > > > > > Does Kensington's Mouse-in-a-box scroll mouse operate under OS/2? > > > > > Most mice will operate under OS/2. I know that my Logitech trackman+ > > works under the plain old scrollms driver- even the wheel. PS/2 mice > > work better than serial, but most mice are ps/2 these days > > What's the difference between a PS/2 mouse and a bus mouse? The size of the connector :-) //------------------------- Good Luck Bonne Chance Martin http://205.237.57.73/ ICQ #48552954 --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: whonea@codenet.net 19-Sep-99 13:44:18 To: All 19-Sep-99 18:48:07 Subj: Re: dire need of HELP! From: whonea@codenet.net (Will Honea) On Sun, 19 Sep 1999 01:24:29, raphaelt@netnews.worldnet.att.net (Raphael Tennenbaum) wrote: > Tony Wright wrote: > > >snip of great post > > I'm here to say your keen insight and dare I say it, > kindness during this episode have been more than helpful, > Tony. I probably read your post four or five times. > > After a not very entertaining 36 hours spent pulling cards, > changing SIMMs, running diagnostics, I'm sure everyone will > be delighted to hear what was probably obvious from the > start: the hard drive seems to be toast. Fortunately, I > guess. And it's still under warrantee. Congratulations! When skill and cunning fail, there's always brute force. I would point you to Jan van Wijk's excellent DFSEE program for your toolkit - it's the best disk analysis tool I've found and includes OS/2, NT and DOS versions - free. It's quite useful when confirming conclusions like this although I usually start with it. Will Honea --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: jejs@verinet.com 19-Sep-99 04:14:26 To: All 20-Sep-99 00:54:18 Subj: Trouble Install with Warp 3.0 From: "John E. Jones" I have the a large HD(8.4Gb), so I went to IBM's site, and downloaded the fix for the installation disks. In the readme, it says to copy IBM1S506.ADD, IBMIDECD.FLT and OS2DASD.DMD to Disk 1. The only problem is that there is not enough room to put these suckers on there. I tried all of the following: deleting the three files off of the diskette first. I made new disks from the CD-ROM images. I copied the first disk to another. Anyway, what am I missing here? I would think that IBM would be smart enough to realize that they do not fit. Or, it's just late, and I am not thinking. Thanks, John jejs@verinet.com --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Verinet Communications, Inc. (970/224-5551) (1:109/42) +----------------------------------------------------------------------------+ From: osmo.vuorio@sonera.fi 19-Sep-99 10:47:17 To: All 20-Sep-99 00:54:18 Subj: Re: PCMCIA, CD-ROm and Laptop - how to install ? From: osmo.vuorio@sonera.fi (osmo vuorio) In article <37E44444.AB0FEB96@toppoint.de>, Marten Feldtmann says: > >I=B4ve the following hardware: > > * Toshiba 2110 Notebook > * 2 GB IDE harddisc internal IDE > * 1450 PCMCIA SCSI adapter from Adaptec > * External SCSI-cdrom ! > http://service.software.ibm.com/os2ddpak/html/os_2inst/ibmcorpo/index.htm Osmo --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Telecom (1:109/42) +----------------------------------------------------------------------------+ From: chris@scotgate2.demon.co.uk 18-Sep-99 18:00:06 To: All 20-Sep-99 00:54:19 Subj: Re: upgrade Warp4 client to Warp5 client From: chris@scotgate2.demon.co.uk (Chris H Lindley) On Sat, 18 Sep 1999 18:41:42 +0900, omurata@ga2.so-net.ne.jp wrote: > I try to write the several files from "WarpServer for e-business" over Warp4 client >without any install process. > >>>>>snipped<<<<< Hi, All those apps you mentioned run under both Warp 4 and Aurora. So what's the advantage to what you suggest? Can you break the 512meg limit? Cheers Chris -- ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG Ý Chris H. Lindley Yorkshire, UK ¦ Ý chris@scotgate2.demon.co.uk Ferg on #os/2 and #os2uk, EFnet ¦ Ý WarpUK:UK OS/2 Users group www.warp.in-uk.net ¦ Ý Molecular Biology & OS/2 www.scotgate.demon.co.uk ¦ TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: jejs@verinet.com 19-Sep-99 12:52:00 To: All 20-Sep-99 00:54:19 Subj: Config.sys problem on install From: "John E. Jones" OK, here is where I am now. I have a large hard drive, and I am install OS/2 3.0. I did the initial boot from both diskettes, the CD copied files on my hard drive. On the first re-boot, I applied the fix at Hobbes for large hd's. I re-booted allowing the hd to take the boot process. Now, I am getting this error on boot: The system cannot find the file SEAMLESS specified in the PROTSHELL statement on line 5 of the CONFIG.SYS. Line 5 of my config.sys is : PROTSHELL=/OS2/PMSHELL.EXE Any ideas? John jejs@verinet.com --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Verinet Communications, Inc. (970/224-5551) (1:109/42) +----------------------------------------------------------------------------+ From: e.traas@hccnet.nl 19-Sep-99 09:05:03 To: All 20-Sep-99 00:54:19 Subj: Jstreet for Java problem From: erwin Traas Hi, at last i found a java mailer which i can use cross platform. But under os2 i get an error, it cannot start the prgram because it cannot find something. I've denloaded the 1.1.8 version of java but still no luck. I use the following file to start the program :: set classpath=g:\jstreet\innoval.jar;G:\TEMP\\JAVA11\lib\classes.zip java.exe innoval.mailer.jstreet What am i doing wrong ( the g drive is formatted fat16, this to be able to use the same program under windows ). Thanks in advance E. Traas --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Hobby Computer Club News Network (1:109/42) +----------------------------------------------------------------------------+ From: iqsnkk@cyberdude.com 20-Sep-99 00:51:25 To: All 20-Sep-99 03:38:11 Subj: DO YOU WANT TO SAVE A LOT OF MONEY? 770 From: iqsnkk@cyberdude.com Auction-2K offers you a chance to buy and sell items on a worldwide auction for Free! That's right! Pay nothing to list or sell your stuff when you become a registered user. Registration is Free too! Register now at www.members.home.net/auction2k/ xkbfxtzlfirn --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: @Work Internet powered by @Home Network (1:109/42) +----------------------------------------------------------------------------+ From: fat_ox@hotmail.com 20-Sep-99 08:12:09 To: All 20-Sep-99 03:38:12 Subj: Re: dire need of HELP! From: "OS/2 Fan" On Sat, 18 Sep 1999 21:24:29 -0400, Raphael Tennenbaum wrote: >But I would like to take this opportunity...and >thank each and every one of you swell eggs for chipping in >here while I was freaking: il Grecque... Thanks Ray and good luck sorting stuff out, I hate those reinstall/restore cycles myself. Hope you get stuff on the road again soon. Regards, Xtralarge OS/2 fan Opinions expressed are mine only. Ignore them and killfile me. Leave the University and/or my ISP alone, I don't speak for them, they have nothing to do with it, and they probably have more lawyers than you anyway. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: An OTEnet S.A. customer (1:109/42) +----------------------------------------------------------------------------+ From: jejs@verinet.com 19-Sep-99 22:51:24 To: All 20-Sep-99 03:38:12 Subj: Re: Config.sys problem on install From: "John E. Jones" Never mind on this one. I had a busted install the first time around. The second time it worked. John John E. Jones wrote in message news:yiaF3.817$F3.189194240@news.frii.net... > OK, here is where I am now. I have a large hard drive, and I am install OS/2 > 3.0. I did the initial boot from both diskettes, the CD copied files on my > hard drive. On the first re-boot, I applied the fix at Hobbes for large > hd's. I re-booted allowing the hd to take the boot process. Now, I am > getting this error on boot: The system cannot find the file SEAMLESS > specified in the PROTSHELL statement on line 5 of the CONFIG.SYS. > > Line 5 of my config.sys is : PROTSHELL=/OS2/PMSHELL.EXE > > Any ideas? > > John > jejs@verinet.com > > > --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Verinet Communications, Inc. (970/224-5551) (1:109/42) +----------------------------------------------------------------------------+ From: oheiabbd@zedat.fu-berlin.de 20-Sep-99 12:15:16 To: All 20-Sep-99 10:50:27 Subj: Re: Adding LAN support and Peer-to-peer? From: oheiabbd@zedat.fu-berlin.de (Oliver Heidelbach) On Fri, 17 Sep 1999 18:29:06, engs0011@sable.ox.ac.uk (Ian Johnston) wrote: > When I installed Warp 4 I had no network adaptor. Now I have, and I want to > use my machine as a peer server. At install, I chose not to have the relevant > bits ... now I can't see how to install them. Help! > Ian, you'll need to run npconfig.exe which is in the \IBMINST directory. If you don't have that directory on your disk copy it from the Warp install CD. That's about it. Regards, Oliver Heidelbach --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Freie Universitaet Berlin (1:109/42) +----------------------------------------------------------------------------+ From: abeagley_DeleteThisToReply@datat... 20-Sep-99 11:09:09 To: All 20-Sep-99 14:52:06 Subj: Re: Remote install problem Message sender: abeagley_DeleteThisToReply@datatone.com From: Alan Beagley I have solved the problem. It was 90-plus % operator incompetence, but aided and abetted by less-than-crystal-clear options in the Selective Install screens. The first time I tried to do this installation I noticed that the PCMCIA Support was marked "No support," so I clicked the button to add support, but the next screen said nothing about network cards: the only options were FAX/modem, Hard Disk, and Flash Memory. I thought, "Well, I don't have any of those, and the drivers for the PCMCIA network card are already selected and in place on the Remote Install Diskettes, so I guess I don't have to select any PCMCIA Support now." It was only when I compared the newly created CONFIG.SYS on the hard disk with the one on the Remote Install floppies that I realized there were no lines to load IBM2TOS1.SYS and PCMCIA.SYS. All is now well. Warp 4 runs much better in 28MB of RAM than it did in 8MB, and I think the new HD is faster too -- larger cache. I still can't help wondering, however, why PCMCIA Support defaulted to "No" even when the drivers were on the Remote Install floppies and the corresponding lines were present in CONFIG.SYS. I do not remember being faced with this dilemma when I did the original installation; perhaps the Warp 4 installation simply "migrated" the Warp 3 CONFIG.SYS file. Alan Alan Beagley wrote: > I have used the Remote Install routine to install Warp 4 several times > without problems, including on a Toshiba notebook computer. > > Now, after having some time ago "blown away" Warp on that notebook > because it had insufficient memory and disk space, I have added memory > and replaced the hard disk by a much bigger one. > > The Remote Install all goes fine until just after the point at which I > am to choose networking options. The computer shuts down, but when it > reboots, the 3Com 3C589C PCMCI Ethernet adapter fails to activate. > > The LANTRAN.LOG file reports: > > PRO00026: The media access control (MAC) driver is not registered or > cannot be found. The request to bind NETBEUI to ELPC3OS2_NIF cannot be > completed. > XI10066: Attach failed with rc = 59. > XI10066: Attach failed with rc = 59. > > Where should I look for the problem? As far as I can see, all the > necessary > drivers are there (e.g., ELPC3OS2.NIF is in \IBMCOM\MACS). What should > the PROTOCOL.INI file look like? Mine is: > > [PROT_MAN] > > DRIVERNAME = PROTMAN$ > > [ELPC3OS2_nif] > > MaxTransmits = 20 > DriverName = ELPC3$ > > [IBMLXCFG] > > ELPC3OS2_nif = ELPC3OS2.NIF > NETBEUI_NIF = NETBEUI.NIF > > [NETBEUI_NIF] > > BINDINGS = ELPC3OS2_nif > DriverName = netbeui$ > > Alan --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: thomashellsen@my-deja.com 20-Sep-99 14:26:20 To: All 20-Sep-99 14:52:06 Subj: Re: Left-handed mouse in DOS box. From: Thomas Hellsén In article <37E05BAC.2B5C8A1B@juliand.com>, Julian Dominic wrote: > I've used the mouse left-handed for ten years have always noticed this > feature. Since my first exposure to a mouse was in a true DOS > environment, I assumed that the mouse worked the same way in full sreen > virtual DOS. There is no mouse support at the c: prompt in DOS circa > 5.02. It was up to the application. I didn't know about the switch you > used in DOS 7. I really doubt that full screen DOS has been enhanced > since DOS circa 5.02, IMHO. If there is a switch that would make this > work, I too would to happy to know it. > > The switch is documented in the PC-DOS 7 help. I don't know in which version they added it, but it seems absent from MDOS in OS/2. As a last trick, I tried using a PC-DOS 7 VDM (Virtual DOS Machine) and I used PC-DOS 7's mouse driver with that switch. Didn't work: on startup (VDM boot), I was informed that the settings had been transferred to the existing (loaded) mouse driver. Which does not support the switch, so nothing happened. Oh well... Unless of course the VDM can gain direct access to the mouse somehow and use its own mouse driver? Sent via Deja.com http://www.deja.com/ Share what you know. Learn what you don't. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Deja.com - Share what you know. Learn what you do (1:109/42) +----------------------------------------------------------------------------+ From: fritzo@humboldt.net 20-Sep-99 12:18:08 To: All 20-Sep-99 20:06:16 Subj: text scrolling in windowed DOS session From: fritzo@humboldt.net(Fritz Oppliger) When I run Qmodem or Qbasic in a windowed session and have it output data to the screen such that it continuously scrolls, often entire lines get scrolled incorrectly - the line may be too short or altogether missing. If I change the window size then most of the info is updated correctly but then scrolls off the screen again replaced by truncated lines etc. Is there a DOS setting that could help prevent this? give it more time or some such? Running RedSpine Warp3 FP3x... Thanks much fritzo@humboldt.net(Fritz Oppliger) KE6VDA --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: buzzcut@ninehundred.net 20-Sep-99 07:42:18 To: All 20-Sep-99 21:25:21 Subj: Re: Installed a larger HD, now desktop hangs at boot time From: buzzcut@ninehundred.net Just my 2 cents worth.... How far did you get in the boot process? Past the OS2LOGO? If not I have a similar problem. I can boot from floppy but not from harddisk. I HAVE loaded the new support for large drives, but if ibm1s506.add is loaded from the hard disk nothing happens after. I am trying to install to a new 8.1GB drive on a Toshiba laptop. I can install and boot Windoze95 and linux, which does boot fine from the hard disk after installation. I belive that there is still a problem in ibm1s506 with certain machine/drive combinations. I have tried all the documented options as well. I have put the 8.1GB hard drive in another machine, used the same install disks, and successfully booted os2 from the hard disk following the phase 1 of the installation. It is only in the toshiba that there is a hang on boot following phase 1 of the install.... Mark In <37B9B667.CB2@airwire.com>, on 08/17/99 at 07:16 PM, Jeff Hildebrand said: >I replaced two smaller HDs (1.2GB and 256MB) with a much larger 4GB >drive. Here's what I had originally: >1.2GB: > 200MB DR-DOS FAT Primary > ~300MB OS/2 Warp 4 HPFS Boot Extended > ~700MB OS/2 data HPFS Extended (remainder of drive) >256MB: > 120MB OS/2 HPFS Extended > ~136MB FAT Extended >These were on the same IDE cable (yes, I know the small drive was killing >performance on the large one). When I switched to the new drive, I copied >the two boot partitions over verbatim (with >DriveCopy), or at least, I thought I did. As it turned out, the drive >geometry was slightly different, and so DC had to do a little work on >those partitions. As a result of this, the OS/2 boot partition may extend >a cylinder or two beyond 1024 (I am in LBA mode, so it may not matter, >but from a CHS perspective, I could have crossed that boundary). >I copied over the third partition without attempting to resize it, copied >the FAT partition from the second drive and made it a little larger. The >OS/2 partition on the second drive was effectively empty. >Now, I had quite a bit of disk space left over, slightly over 2GB in >fact, and I created one huge HPFS partition. FDISK didn't complain, nor >did format. So now I have a drive that looks something like this: > 200MB DR-DOS FAT Primary > ~300MB OS/2 Warp 4 HPFS Boot Extended > ~700MB OS/2 data HPFS Extended (remainder of drive) > ~400MB FAT Extended (not sure of this size) > ~2.4GB? HPFS Extended (again, not sure of the exact size) >Oh yeah, the system: it's an AMD 486DX2/80, 32MB of RAM, AMI WinBIOS (or >whatever it was called). Warp 4 is installed, and Fixpak 5. >Here's the problem: when I boot the system I get a bunch of >drivers spitting out messages (as I expect), the screen clears, I hear >the monitor switch modes and the screen is painted gray (still okay). >After a bit, the original Warp 4 desktop bitmap comes up, and then the >drive light goes out. And it sits there. The cursor is the clock, the >WarpCenter isn't there, nor are any of the icons. Nothing in the Startup >Folder runs. I can reboot with Ctrl-Alt-Del and the system shuts down >nicely, and rebooting *may* bring the system back. >However, last night, after several reboots I still couldn't get the boot >process to complete. (The wife almost took my head off ask she wanted to >type up a letter.) I booted from floppies and edited my config.sys and >removed WARPCENTER from the >AUTOSTART line (I *think* it's autostart). I rebooted the system and OS/2 >came up just fine. I even started the WarpCenter >manually and my desktop was pretty much back to normal. >So it looks like the WarpCenter is the problem, but why? Is >that last HPFS partition too large? Netscape 2.02 is always >complaining about a lack of space every time I try to download files to >that partition. But then why can I start the >WarpCenter manually? Has an important file been moved above >the 1024 cyl threshold? That would mean that editing the config didn't >really solve the problem (unless it was the config.sys itself that has >partially over the 1024 cyl boundary). >Has anyone else seen this? Is this a known problem that a >Fixpak after #5 fixes? >Thanks. >Jeff -- -------------------------------------------------------------- mstamos@home.com "The beauty of the second amendment is that it will not be needed until they try to take it." --Thomas Jefferson Protect your rights: www.vetothegovernor.org -------------------------------------------------------------- --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42) +----------------------------------------------------------------------------+ From: buzzcut@ninehundred.net 20-Sep-99 08:07:19 To: All 20-Sep-99 21:25:21 Subj: Re: Installed a larger HD, now desktop hangs at boot time From: buzzcut@ninehundred.net Just my 2 cents worth.... How far did you get in the boot process? Past the OS2LOGO? If not I have a similar problem. I can boot from floppy but not from harddisk. I HAVE loaded the new support for large drives, but if ibm1s506.add is loaded from the hard disk nothing happens after. I am trying to install to a new 8.1GB drive on a Toshiba laptop. I can install and boot Windoze95 and linux, which does boot fine from the hard disk after installation. I belive that there is still a problem in ibm1s506 with certain machine/drive combinations. I have tried all the documented options as well. I have put the 8.1GB hard drive in another machine, used the same install disks, and successfully booted os2 from the hard disk following the phase 1 of the installation. It is only in the toshiba that there is a hang on boot following phase 1 of the install.... Mark In <37B9B667.CB2@airwire.com>, on 08/17/99 at 07:16 PM, Jeff Hildebrand said: >I replaced two smaller HDs (1.2GB and 256MB) with a much larger 4GB >drive. Here's what I had originally: >1.2GB: > 200MB DR-DOS FAT Primary > ~300MB OS/2 Warp 4 HPFS Boot Extended > ~700MB OS/2 data HPFS Extended (remainder of drive) >256MB: > 120MB OS/2 HPFS Extended > ~136MB FAT Extended >These were on the same IDE cable (yes, I know the small drive was killing >performance on the large one). When I switched to the new drive, I copied >the two boot partitions over verbatim (with >DriveCopy), or at least, I thought I did. As it turned out, the drive >geometry was slightly different, and so DC had to do a little work on >those partitions. As a result of this, the OS/2 boot partition may extend >a cylinder or two beyond 1024 (I am in LBA mode, so it may not matter, >but from a CHS perspective, I could have crossed that boundary). >I copied over the third partition without attempting to resize it, copied >the FAT partition from the second drive and made it a little larger. The >OS/2 partition on the second drive was effectively empty. >Now, I had quite a bit of disk space left over, slightly over 2GB in >fact, and I created one huge HPFS partition. FDISK didn't complain, nor >did format. So now I have a drive that looks something like this: > 200MB DR-DOS FAT Primary > ~300MB OS/2 Warp 4 HPFS Boot Extended > ~700MB OS/2 data HPFS Extended (remainder of drive) > ~400MB FAT Extended (not sure of this size) > ~2.4GB? HPFS Extended (again, not sure of the exact size) >Oh yeah, the system: it's an AMD 486DX2/80, 32MB of RAM, AMI WinBIOS (or >whatever it was called). Warp 4 is installed, and Fixpak 5. >Here's the problem: when I boot the system I get a bunch of >drivers spitting out messages (as I expect), the screen clears, I hear >the monitor switch modes and the screen is painted gray (still okay). >After a bit, the original Warp 4 desktop bitmap comes up, and then the >drive light goes out. And it sits there. The cursor is the clock, the >WarpCenter isn't there, nor are any of the icons. Nothing in the Startup >Folder runs. I can reboot with Ctrl-Alt-Del and the system shuts down >nicely, and rebooting *may* bring the system back. >However, last night, after several reboots I still couldn't get the boot >process to complete. (The wife almost took my head off ask she wanted to >type up a letter.) I booted from floppies and edited my config.sys and >removed WARPCENTER from the >AUTOSTART line (I *think* it's autostart). I rebooted the system and OS/2 >came up just fine. I even started the WarpCenter >manually and my desktop was pretty much back to normal. >So it looks like the WarpCenter is the problem, but why? Is >that last HPFS partition too large? Netscape 2.02 is always >complaining about a lack of space every time I try to download files to >that partition. But then why can I start the >WarpCenter manually? Has an important file been moved above >the 1024 cyl threshold? That would mean that editing the config didn't >really solve the problem (unless it was the config.sys itself that has >partially over the 1024 cyl boundary). >Has anyone else seen this? Is this a known problem that a >Fixpak after #5 fixes? >Thanks. >Jeff -- -------------------------------------------------------------- buzzcut@ninehundred.net "The beauty of the second amendment is that it will not be needed until they try to take it." --Thomas Jefferson Protect your rights: www.vetothegovernor.org -------------------------------------------------------------- --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Posted via Supernews, http://www.supernews.com (1:109/42) +----------------------------------------------------------------------------+ From: racette@cablevision.qc.ca 20-Sep-99 18:00:19 To: All 20-Sep-99 21:25:21 Subj: New Keyboard ???? From: racette@cablevision.qc.ca (Martin Racette) Hi guys, I'm looking to get a new computer, but those available here, they all come with keyboard with those "Internet Buttons", to fetch E-Mail, to connect, etc..., so I would like to know if those keyboard will work with OS/2 Warp 4, and if there is any use for those buttons //------------------------- Thank you in advance Merci a l'avance Martin http://205.237.57.73/ ICQ #48552954 --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: jmirand2@my-deja.com 20-Sep-99 17:10:04 To: All 20-Sep-99 21:25:22 Subj: Re: upgrade Warp4 client to Warp5 client From: jmirand2@my-deja.com Dear Mr. Ohmura, What you have done is very interesting. Can you run DOS and Win-OS2 applications as you do in Warp 4? TIA José Sent via Deja.com http://www.deja.com/ Share what you know. Learn what you don't. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Deja.com - Share what you know. Learn what you do (1:109/42) +----------------------------------------------------------------------------+ From: John_Cummings@hc-sc.gc.ca 20-Sep-99 18:14:23 To: All 20-Sep-99 21:25:22 Subj: e-business upgrade From: "John " Hi, Were currently running OS/2 Warp Server 4 and will very shortly be upgrading to IBM's new e-business software. The main reason for this upgrade is to take advantage of e-business' new JFS which now allows individual file size up to 2 terabytes (previous was 2 GB). Although we will be doing testing on this product in the lab, I first wanted to see if anyone had any comments or had experienced any problems with their upgrade. Appreciate the feedback. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Health Canada - Santé Canada (1:109/42) +----------------------------------------------------------------------------+ From: rappleby@cadvision.com 20-Sep-99 18:40:08 To: All 21-Sep-99 02:02:04 Subj: XFree86 and 127.0.0.1 Loopback From: rappleby@cadvision.com (Ray Appleby) I'm trying to setup XFree86 so I can try GIMP/2 but I can't seem to get the 'localhost' 127.0.0.1 setup as loopback. I've tried using 'INETD' and 'IFCONFIG lo 127.0.0.1 up' and also tried to use the TCP/IP notebook but when I run tcpcfg2 it won't let me in because the host (127.0.0.1) is not responding. Ping seems to work OK. I have TCP/IP 4.1 with WR08620 installed and Java 1.1.8 installed. JAVA.EXE full version "JDK 1.1.8 IBM build o118-19990605 (JIT enabled: javax V3.5-IBMJDK1.1-19990605)" Any ideas how to get the 'localhost' responding. I know virtually nothing about TCP/IP configuration so be gentle. ;-) Any help would be greatly appreciated. Best Regards, Ray Appleby rappleby@cadvision.com [Team OS/2] Multitasking at OS/2 Warp4 Speed. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: CADVision Development Corporation (http://www.cad (1:109/42) +----------------------------------------------------------------------------+ From: pbranch@enter.net 20-Sep-99 19:31:02 To: All 21-Sep-99 02:02:04 Subj: Re: Trouble Install with Warp 3.0 From: "pbranch" I'm having the same problem. The files that IBM tells me to delete are not even on my Warp 3 red spine disk1. The files in the IDEDASD.EXE package are much larger than the ones they replace. The files that must stay on Disk1 leave no room for the updates. Any help out there? Lee lbranch@ptd.net osmo vuorio wrote in message ... >In article , "John E. Jones" says: >> > >>not enough room to put these suckers on there. I tried all of the following: >>deleting the three files off of the diskette first. I made new disks from >>the CD-ROM images. I copied the first disk to another. Anyway, what am I >>missing here? I would think that IBM would be smart enough to realize that >>they do not fit. Or, it's just late, and I am not thinking. > >Ok, there is some information how-to > >http://service.software.ibm.com/os2ddpak/html/6330F82FCE1DE4998625669B0059C 153.html > >Osmo --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Enter.Net (1:109/42) +----------------------------------------------------------------------------+ From: jpedone_no_spam@flash.net 21-Sep-99 02:21:02 To: All 21-Sep-99 02:02:04 Subj: Re: XFree86 and 127.0.0.1 Loopback From: jpedone_no_spam@flash.net In , rappleby@cadvision.com (Ray Appleby) writes: >I'm trying to setup XFree86 so I can try GIMP/2 but I can't seem to >get the 'localhost' 127.0.0.1 setup as loopback. I've tried using >'INETD' and 'IFCONFIG lo 127.0.0.1 up' and also tried to use the inetd is the super daemon process. You should only use it if you intend to run some servers (like ftp or telnet). The other command should be: ifconfig lo 127.0.0.1 without the "up". Also make sure you have the line: 127.0.0.1 localhost in x:\mptn\etc\hosts and x:\tcpip\dos\etc\hosts J. Pedone jpedone@flash.net http://www.flash.net/~jpedone Breaking Windows isn't just for kids anymore. "Daddy, what does FORMATTING DRIVE C mean?" --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42) +----------------------------------------------------------------------------+ From: cannon@sonic.net 20-Sep-99 22:39:12 To: All 21-Sep-99 06:30:10 Subj: XFree86 - No screens From: Andrew Cannon Here is an example output after executing startx: XFree86 Version 3.3.5 / X Window System (protocol Version 11, revision 0, vendor release 6300) Release Date: August 3 1999 If the server is older than 6-12 months, or if your card is newer than the above date, look for a newer version before reporting problems. (see http://www.XFree86.Org/FAQ) Operating System: OS/2 IBM Configured drivers: Mach64: accelerated server for ATI Mach64 graphics adaptors (Patchlevel 0) xf86-OS/2: Console opened xf86-OS/2: Keyboard opened xf86-OS/2: Started Vio thread, Tid=2 xf86-OS/2: Started hard error Vio mode monitor thread, Tid=3 xf86-OS/2: Started Kbd monitor thread, Tid=4 xf86-OS/2: Opened kbd monitor, rc=0 xf86-OS/2: Kbd monitor registered, rc=0 xf86-OS/2: Started Kbd bit-bucket thread, Tid=5 xf86-OS/2: Kbd Queue created, rc=0 XF86Config: g:/apps/XFree86/lib/X11/XF86Config (**) stands for supplied, (--) stands for probed/default values (**) XKB: keymap: "xfree86(us)" (overrides other XKB settings) (**) OsMouse selected for mouse input (**) Mach64: Graphics device ID: "atixpression" (**) Mach64: Monitor ID: "mag17dxf" (--) Mach64: Mode "1024x768" needs hsync freq of 70.24 kHz. Deleted. (--) Mach64: Mode "1152x864" needs hsync freq of 70.88 kHz. Deleted. (--) Mach64: Mode "1280x1024" needs hsync freq of 74.59 kHz. Deleted. (--) Mach64: Mode "1600x1200" needs hsync freq of 75.00 kHz. Deleted. (--) Mach64: Mode "1152x864" needs hsync freq of 76.01 kHz. Deleted. (--) Mach64: Mode "1280x1024" needs hsync freq of 78.86 kHz. Deleted. (--) Mach64: Mode "1024x768" needs hsync freq of 80.21 kHz. Deleted. (--) Mach64: Mode "1280x1024" needs hsync freq of 81.13 kHz. Deleted. (--) Mach64: Mode "1600x1200" needs hsync freq of 87.50 kHz. Deleted. (--) Mach64: Mode "1152x864" needs hsync freq of 89.62 kHz. Deleted. (--) Mach64: Mode "1280x1024" needs hsync freq of 91.15 kHz. Deleted. (--) Mach64: Mode "1600x1200" needs hsync freq of 93.75 kHz. Deleted. (--) Mach64: Mode "1600x1200" needs hsync freq of 105.77 kHz. Deleted. (--) Mach64: Mode "1280x1024" needs hsync freq of 107.16 kHz. Deleted. (--) Mach64: Mode "1800X1440" needs hsync freq of 96.15 kHz. Deleted. (--) Mach64: Mode "1800X1440" needs hsync freq of 104.52 kHz. Deleted. (**) FontPath set to "g:/apps/XFree86/lib/X11/fonts/misc/,g:/apps/XFree86/lib/X11/fonts/75dpi/:unsca led,g:/apps/XFree86/lib/X11/fonts/75dpi/" (--) Mach64: PCI: Mach64 GX rev 1, Aperture @ 0xe4000000, Sparse I/O @ 0x02ec xf86ReadBIOS: BIOS map failed, addr=c0000, rc=87 *** None of the configured devices were detected.*** Fatal server error: no screens found When reporting a problem related to a server crash, please send the full server output, not just the last messages G:\apps\XFree86\bin\xinit.exe: Server error. ------ The FAQ mentioned the problem, but neither suggestion worked. Any ideas would be appreciated, Thanks, -- Andy Cannon http://www.sonic.net/~cannon --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Sonic,Santa Rosa CA,http://www.sonic.net (1:109/42) +----------------------------------------------------------------------------+ From: ijjmrq@ghg.com 15-Sep-99 18:14:29 To: All 21-Sep-99 17:28:11 Subj: Sex Photo from 12 to 16 years old! 8841 From: ijjmrq@ghg.com SEX PHOTO FROM 12 to 16 YEARS OLD! gggyjsqrcoizbvciskzttekefeqvjmouksyjvkgqnbrrrvknnnbtpjoevpersxoppioejfwyiqwdicf nhbbcqgzpgbbrssuw begin 644 C:\Posting\Linki.htm M/&AT;6P^#0H-"CQH96%D/@T*/'1I=&QE/E!,14%312!#2$])0T4\+W1I=&QE M/@T*/&UE=&$@;F%M93TB1T5.15)!5$]2(B!C;VYT96YT/2)-:6-R;W-O9G0@ M1G)O;G1086=E(#,N,"(^#0H\+VAE860^#0H-"CQB;V1Y/@T*/&1I=B!A;&EG M;CTB8V5N=&5R(CX\8V5N=&5R/@T*#0H\=&%B;&4@8F]R9&5R/2(P(B!W:61T M:#TB,3`P)2(^#0H@(#QTF4](C$B/CQB71O<',N8V]M+SPO83X\<#XF;F)S<#L\+W1D/@T*("`\+W1R/@T*("`\='(^ M#0H@("`@/'1D('=I9'1H/2(U,"4B/CQP(&%L:6=N/2)C96YT97(B/CQB:6<^ M/&9O;G0@8V]L;W(](B,P,#`P1D8B/CQS=')O;F<^04-4($]&($1%1DQ/4D%4 M24]./"]S=')O;F<^/"]F;VYT/CPO8FEG/CPO<#X-"B`@("`\<"!A;&EG;CTB M8V5N=&5R(CX\8FEG/CQF;VYT(&-O;&]R/2(C,#`P,$9&(CX\F4](C,B(&-O;&]R/2)R M960B/D-H;V]S92!9;W5R(%!L96%S=7)E(3PO9F]N=#X\9F]N=`T*("`@(&9A M8V4](F%R:6%L(B!S:7IE/2(K-"(^/&(^/&)R/@T*("`@(#PO8CX\+V9O;G0^ M/"]U/CQH71H:7,N:'1M;"(^:'1T<#HO+W=W=RYA M9'5L='!R;V1U8W1I;VYS+F-O;2]T racette@cablevision.qc.ca (Martin Racette) writes: > Hi guys, > > I'm looking to get a new computer, but > those available here, they all come with > keyboard with those "Internet Buttons", > to fetch E-Mail, to connect, etc..., so > I would like to know if those keyboard > will work with OS/2 Warp 4, and if there > is any use for those buttons Yes and yes, but who'd WANT those stupid windoze keys? Or all the weird extra keys they put in keyboards these days? I recently got a Happy Hacking Keyboard Lite from pfuca.com. -- Anssi Saari - as@sci.fi --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Tampere University of Technology (1:109/42) +----------------------------------------------------------------------------+ From: Frank@get-lost.spam 21-Sep-99 10:24:10 To: All 21-Sep-99 17:28:13 Subj: Re: Trouble Install with Warp 3.0 From: Frank@get-lost.spam (Frank) On Mon, 20 Sep 1999 19:31:04, "pbranch" wrote: > I'm having the same problem. The files that IBM tells me to delete are not > even on my Warp 3 red spine disk1. The files in the IDEDASD.EXE package are > much larger than the ones they replace. The files that must stay on Disk1 > leave no room for the updates. Any help out there? > On a NON PS/2 system delete all the **2**.add files and remove tracks of these files in your config.sys. On a PS/2 system delete all the **1**.add files, and remove all tracks of these files in your config.sys Greeeetings, Frank The box said:"Requires Windows 95/98, NT or better" .......... So I too installed OS/2. Reply per Email to franklyware@-NOSPAM-beer.com --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: doug.bissett"at"ibm.net 21-Sep-99 18:48:08 To: All 21-Sep-99 17:28:13 Subj: Re: Trouble Install with Warp 3.0 From: doug.bissett"at"ibm.net (Doug Bissett) On Tue, 21 Sep 1999 10:24:21, Frank@get-lost.spam (Frank) wrote: > On a NON PS/2 system delete all the **2**.add files and remove tracks > of these files in your config.sys. > On a PS/2 system delete all the **1**.add files, and remove all tracks > of these files in your config.sys > Translate "NON PS/2 system" to "NON MICROCHANEL system", and, "PS/2 System" to "MICROCHANEL system", and you will have it right. Not all PS/2 systems are microchanel machines, and not all microchanel machines are PS/2's. If you don't know what microchanel is, you, probably, don't have it. Hope this helps... ****************************** From the PC of Doug Bissett doug.bissett at ibm.net The " at " must be changed to "@" ****************************** --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne (1:109/42) +----------------------------------------------------------------------------+ From: hunters@thunder.indstate.edu 21-Sep-99 22:53:12 To: All 21-Sep-99 21:23:03 Subj: Re: Trouble Install with Warp 3.0 From: hunters@thunder.indstate.edu In article , Frank@get-lost.spam (Frank) wrote: > On a NON PS/2 system delete all the **2**.add files and remove tracks > of these files in your config.sys. I was told that these are for MCA devices... MCA is MicroChannel FTWDK. -- -Steven Hunter *OS/2 Warp 4 * |Warpstock '99 | Oct 16-17| hunters@thunder.indstate.edu *AMD K6-2 400* | Atlanta GA | Sent via Deja.com http://www.deja.com/ Share what you know. Learn what you don't. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Deja.com - Share what you know. Learn what you do (1:109/42) +----------------------------------------------------------------------------+ From: pbackman@remoove.algonet.se 21-Sep-99 22:05:00 To: All 22-Sep-99 04:29:00 Subj: Re: XFree86 and 127.0.0.1 Loopback From: pbackman@remoove.algonet.se (Per Backman) On Tue, 21 Sep 1999 02:21:05, jpedone_no_spam@flash.net wrote: > without the "up". Also make sure you have the line: > > 127.0.0.1 localhost > > in x:\mptn\etc\hosts and x:\tcpip\dos\etc\hosts > > And do hit ENTER after the line, or else it will not work! There must be a linebreak. That was the problem for me at least (I think it is described in the readmefile too). Per B. ************************************************************ The PHOTO&NATURIST page; In English, auf deutsch, po polsku; http://home1.2.sbbs.se/pbackman/ ICQ UIN; 40714141 ************************************************************ --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Telenordia (1:109/42) +----------------------------------------------------------------------------+ From: gkrupp@ibm.net 21-Sep-99 20:47:27 To: All 22-Sep-99 04:29:01 Subj: No Video Player From: gkrupp@ibm.net (Georg Krupp) Hy, I affed some new harddisks to my computer. Now I can't load any video films from CD. Each time I get a error code 5019 reporting, that OS/2 can't find the data. Does anybody know a solution? Am I to reinstall ? I did of course change the CD-letter assigned to my CD-ROM in STPM.EXE. Georg --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne (1:109/42) +----------------------------------------------------------------------------+ From: Nullmudshark-505@worldnet.att.net 21-Sep-99 19:17:24 To: All 22-Sep-99 04:29:01 Subj: Re: BIG BooBoo I think. From: "Dave" if it because you applied the DDFix pak before the OS fix pak, yup its fixable. Just d/l the fixpak for the OS and the kicker disks. Boot off the kickers and install the fixpak. On Mon, 20 Sep 1999 16:20:05 -0500, Mr. Wonderful wrote: >Ok, I just got done d/l'ng and installing the Device Driver FixPack, but did it >without installing FixPack 11 or any other fixpacks. Now it comes up with the >following error on reboot---"File PMMERGE=>PMVIOP,122 Specified in >the ProtShell statement on line 2 of the config.sys file does not contain a valid >program. Line 2 is ignored. The System is stopped. Correct the proceeding >error and restart the system." I have went into command line mode and checked >to make sure the PMSHELL.EXE file specified on line 2 is in the OS2 directory >and it is. I tried to REM out the line, and it comes up with an error along the >same lines as the one above. The file in the OS2 directory is the following > >PMSHELL.EXE 8-14-96 3:16am 6020 bytes 61 > >Did I make a big mistake, and if so is it fixable? If so, please HELP!!!!!!!! > > >TIA!!!!! > > --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: nope (1:109/42) +----------------------------------------------------------------------------+ From: afjbell@onlink.net 21-Sep-99 20:21:04 To: All 22-Sep-99 04:29:01 Subj: ThinkPad and Paintbrush From: "Alex Bell" I have posted about this problem before, but am still having troubles. So please bear with me. The problem is that I cannot use Paintbrush under WinOS2 on my ThinkPad to do a job which it was able to do on my desktop. When I try to load a BMP I get the message that there is insufficient memory. I could load the file into Paintbrush when I had a desktop, even though the desktop had less RAM than the ThinkPad. To my untutored eyes the most obvious difference between the config.sys on the ThinkPad and that for the desktop is that the ThinkPad config.sys loads what I think are PCMCIA drivers. BASEDEV=PCMCIA.SYS BASEDEV=IBM2SS14.SYS BASEDEV=AUTODRV2.SYS DEVICE=D:\THINKPAD\VPCMCIA.SYS DEVICE=D:\THINKPAD\PCMSSDIF.SYS Is it possible that these drivers (or others I have missed) are loading into a memory area which Paintbrush expects to use? If so, is it possible to rem them out safely when I want to use Paintbrush? - not very often, but when I need it I need it badly. I know I would not then be able to the PCMCIA modem, but when I need that I would go back to the original config.sys. Or is there another way I can get Paintbrush to work? I should mention that I have made a desktop icon for it so I could get access to its properties, and have set DPMI memory limit to 64Mb, have set DOS HIGH, and have set XMS memory limit to 64Kb - all to no avail. Regards, Alex --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Ontario Northland--ONLink (1:109/42) +----------------------------------------------------------------------------+ From: rappleby@cadvision.com 21-Sep-99 22:00:14 To: All 22-Sep-99 04:29:02 Subj: Re: XFree86 and 127.0.0.1 Loopback (Still Negatory) From: rappleby@cadvision.com (Ray Appleby) On Tue, 21 Sep 1999 22:05:00, pbackman@remoove.algonet.se (Per Backman) wrote: Thanks for the suggestions - tcpcfg2 still won't recognize the local host. :-( > On Tue, 21 Sep 1999 02:21:05, jpedone_no_spam@flash.net wrote: > > > without the "up". Also make sure you have the line: > > > > 127.0.0.1 localhost > > > > in x:\mptn\etc\hosts and x:\tcpip\dos\etc\hosts > > > > > And do hit ENTER after the line, or else it will not work! There must > be a linebreak. That was the problem for me at least (I think it is > described in the readmefile too). > > Per B. > ************************************************************ > The PHOTO&NATURIST page; > In English, auf deutsch, po polsku; > http://home1.2.sbbs.se/pbackman/ > ICQ UIN; 40714141 > ************************************************************ > Best Regards, Ray Appleby rappleby@cadvision.com [Team OS/2] Multitasking at OS/2 Warp4 Speed. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: CADVision Development Corporation (http://www.cad (1:109/42) +----------------------------------------------------------------------------+ From: mystix1210@my-deja.com 22-Sep-99 08:40:07 To: All 22-Sep-99 10:37:23 Subj: Re: Need to re-install Warp 4 but can't see! From: mystix1210@my-deja.com In article <7rsnj6$mh8$1@nnrp1.deja.com>, mystix1210@my-deja.com wrote: > Afterwards when I went home I discovered some other > things I had to do so after some re-aranging I had to > yet re-install Warp again,but before I did I followed > your advice but to no avail. Still the signal didn't > sync to my monitor. I can't figure out for the life > of me why though. My old ATI card never had this > problem, but of course it's gone now. Well I finally figured out the problem. On the back of the video card there is an NTSC RCA jack. As a default I have a cable plugged into it. Apparantly it must set some kind of different sync rates with the Warp VGA driver than my monitor can handle. As long as I unplug the cable before installation it seems to be fine. Sent via Deja.com http://www.deja.com/ Share what you know. Learn what you don't. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Deja.com - Share what you know. Learn what you do (1:109/42) +----------------------------------------------------------------------------+ From: ben.hamilton@fmr2001.com 20-Sep-99 16:25:09 To: All 22-Sep-99 10:37:23 Subj: Printer/networking From: Ben Hamilton I am having problems with a printer driver install. My "server" machine is running OS/2 Warp 4, and my two workstations are Win98 machines. I have installed the latest OMNI printer driver for my Epson Stylus Color 440, configured the share, and rebooted, yet the Win98 machines cannot see the printer. What am I forgetting? The network is working fine in all other aspects (drive sharing, TCP/IP access to the Internet via the Injoy Firewall). Thanks, -- Ben Hamilton -- ben.hamilton@fmr2001.com -- -- Spam filter in use! -- Remove "2001" from email address if replying via email. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: FISC-DEV (1:109/42) +----------------------------------------------------------------------------+ From: jpedone_no_spam@flash.net 22-Sep-99 10:27:20 To: All 23-Sep-99 04:15:25 Subj: Re: ThinkPad and Paintbrush From: jpedone_no_spam@flash.net In , "Alex Bell" writes: >I have posted about this problem before, but am still having troubles. So >please bear with me. > >The problem is that I cannot use Paintbrush under WinOS2 on my ThinkPad to do >a job which it was able to do on my desktop. When I try to load a BMP I get >the message that there is insufficient memory. I could load the file into >Paintbrush when I had a desktop, even though the desktop had less RAM than >the ThinkPad. > FWIW - you'll also get this message if you run out of file handles. Check the DOS_FILES setting in the WIN-OS/2 session properties area. It's probably set to about 20 - just increase it to 30 or 40. J. Pedone jpedone@flash.net http://www.flash.net/~jpedone Windows Multitask! Formats C: and locks the keyboard at the same time! Computers are a more fun way to do the same work you'd have to do without them. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: FlashNet Communications, http://www.flash.net (1:109/42) +----------------------------------------------------------------------------+ From: fat_ox@hotmail.com 22-Sep-99 18:29:13 To: All 23-Sep-99 04:15:25 Subj: Joystick under OS/2? From: "OS/2 Fan" Hello all, This should be an easy one: I have a Newcomm 32 PnP card, Crystal chipset, and I've got a joystick connected to it. DOS games under WinOS/2 detect it, but OS/2 games like Trials of Battle don't and ask for the OS/2 joystick driver to be installed. How do I do this? I can't find it under Selective Install or Device Driver Install. Any help appreciated as always. TIA. Regards, Xtralarge OS/2 fan Opinions expressed are mine only. Ignore them and killfile me. Leave the University and/or my ISP alone, I don't speak for them, they have nothing to do with it, and they probably have more lawyers than you anyway. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: An OTEnet S.A. customer (1:109/42) +----------------------------------------------------------------------------+ From: rjf@yyycomasia.com 22-Sep-99 14:38:28 To: All 23-Sep-99 04:15:25 Subj: Re: New Keyboard ???? From: rjf@yyycomasia.com (rj friedman) On Tue, 21 Sep 1999 17:36:28, Anssi Saari wrote: îYes and yes, but who'd WANT those stupid windoze keys? Or all the îweird extra keys they put in keyboards these days? I recently got a îHappy Hacking Keyboard Lite from pfuca.com. Righto - I have seen pictures of those keyboards and plan on purchasing one for my next one. Currently I use a mini type keyboard - without the numeric keypad of dedicated cursor keys - and DEFINITELY without those windows keys. ________________________________________________________ [RJ] OS/2 - Live it, or live with it. rj friedman Team ABW Taipei, Taiwan rjf@yyycomasia.com To send email - remove the `yyy' ________________________________________________________ --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: SEEDNet News Service (1:109/42) +----------------------------------------------------------------------------+ From: barnard@theedgedesign.com 22-Sep-99 11:50:22 To: All 23-Sep-99 04:15:25 Subj: trouble installing network components on Warp 4 From: Norm Barnard I apologize in advance if this question has been previously answered. I'm installing Warp4 (Merlin) on a pII 266 with an 8 gb IDE drive. I added all the large drive updates so everything there is fine. The problem is when I try to install the networking components (running install.cmd from the cd) it attempts to install and then reports that I dont have enough drive space to do it. I don't know how much space the networking components are, but my guess is that they don't take up 8 gb. Any help would be appreciated. Thanks, Norm -- =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- Norm Barnard PGP:www.netlink.net/~barnard/pgpkey.html ICQ: 22983718 =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- The Edge Design www.theedgedesign.com (616)344-1301 =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: The Edge Design (1:109/42) +----------------------------------------------------------------------------+ From: marten@toppoint.de 22-Sep-99 20:10:08 To: All 23-Sep-99 04:15:25 Subj: Re: PCMCIA, CD-ROm and Laptop - how to install ? From: Marten Feldtmann osmo vuorio wrote: > > In article <37E44444.AB0FEB96@toppoint.de>, Marten Feldtmann says: > > > >I=B4ve the following hardware: > > > > * Toshiba 2110 Notebook > > * 2 GB IDE harddisc internal IDE > > * 1450 PCMCIA SCSI adapter from Adaptec > > * External SCSI-cdrom ! > > > > http://service.software.ibm.com/os2ddpak/html/os_2inst/ibmcorpo/index.htm > > Osmo That did it - thanks ! Marten --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Privat (1:109/42) +----------------------------------------------------------------------------+ From: milindr@bellsouth.net 22-Sep-99 20:41:23 To: All 23-Sep-99 04:15:25 Subj: Re: New Keyboard ???? From: milindr@bellsouth.net (Milind Rao) I have read of at least one tool that reconfigures the stupid Windows key. So I suppose all the keys can be reconfigured. Regards Milind --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: JHB@jita.demon.co.uk 22-Sep-99 21:49:06 To: All 23-Sep-99 04:15:25 Subj: Re: New Keyboard ???? From: JHB@jita.demon.co.uk (Jim Backus) As other have said the keyboard should work as a basic keyboard. If you wanted to make use of the extra keys, you might be able to get at them through Rexx. I've just been looking at my copy of TYR in 21 days and there are functions that return the scan codes. You could get a Rexx script loaded in Startup to do something useful with them. But like the others I positively look for 101 or 102 key K/Bs preferably american layout as I've got used to it - they are _rare_ in the UK. In message - racette@cablevision.qc.ca (Martin Racette) writes: :> :>Hi guys, :> :>I'm looking to get a new computer, but :>those available here, they all come with :>keyboard with those "Internet Buttons", :>to fetch E-Mail, to connect, etc..., so :>I would like to know if those keyboard :>will work with OS/2 Warp 4, and if there :>is any use for those buttons :> :>//------------------------- :>Thank you in advance :> :>Merci a l'avance :> :>Martin :> :>http://205.237.57.73/ :> :>ICQ #48552954 Jim Backus - Electronic Systems Engineer - OS/2 user by choice - member of Amnesty International - supporter of Proportional Representation Bona fide replies to jimb (at) jita dot demon dot co dot uk --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Fourmyle (1:109/42) +----------------------------------------------------------------------------+ From: jdparker@erols.com 22-Sep-99 20:13:10 To: All 23-Sep-99 04:15:25 Subj: Re: Installed a larger HD, now desktop hangs at boot time From: Jim Parker See imbedded comment below Jim buzzcut@ninehundred.net wrote: > Just my 2 cents worth.... > > How far did you get in the boot process? Past the OS2LOGO? If not I have > a similar problem. I can boot from floppy but not from harddisk. I HAVE > loaded the new support for large drives, but if ibm1s506.add is loaded > from the hard disk nothing happens after. I am trying to install to a new > 8.1GB drive on a Toshiba laptop. I can install and boot Windoze95 and > linux, which does boot fine from the hard disk after installation. I > belive that there is still a problem in ibm1s506 with certain > machine/drive combinations. I have tried all the documented options as > well. > > I have put the 8.1GB hard drive in another machine, used the same install > disks, and successfully booted os2 from the hard disk following the phase > 1 of the installation. It is only in the toshiba that there is a hang on > boot following phase 1 of the install.... > > Mark > > In <37B9B667.CB2@airwire.com>, on 08/17/99 at 07:16 PM, > Jeff Hildebrand said: > > >I replaced two smaller HDs (1.2GB and 256MB) with a much larger 4GB > >drive. Here's what I had originally: > > >1.2GB: > > 200MB DR-DOS FAT Primary > > ~300MB OS/2 Warp 4 HPFS Boot Extended > > ~700MB OS/2 data HPFS Extended (remainder of drive) > >256MB: > > 120MB OS/2 HPFS Extended > > ~136MB FAT Extended > > >These were on the same IDE cable (yes, I know the small drive was killing > >performance on the large one). When I switched to the new drive, I copied > >the two boot partitions over verbatim (with > >DriveCopy), or at least, I thought I did. As it turned out, the drive > >geometry was slightly different, and so DC had to do a little work on > >those partitions. As a result of this, the OS/2 boot partition may extend > >a cylinder or two beyond 1024 (I am in LBA mode, so it may not matter, > >but from a CHS perspective, I could have crossed that boundary). > > >I copied over the third partition without attempting to resize it, copied > >the FAT partition from the second drive and made it a little larger. The > >OS/2 partition on the second drive was effectively empty. > > >Now, I had quite a bit of disk space left over, slightly over 2GB in > >fact, and I created one huge HPFS partition. FDISK didn't complain, nor > >did format. So now I have a drive that looks something like this: > > > 200MB DR-DOS FAT Primary > > ~300MB OS/2 Warp 4 HPFS Boot Extended > > ~700MB OS/2 data HPFS Extended (remainder of drive) > > ~400MB FAT Extended (not sure of this size) > > ~2.4GB? HPFS Extended (again, not sure of the exact size) > > >Oh yeah, the system: it's an AMD 486DX2/80, 32MB of RAM, AMI WinBIOS (or > >whatever it was called). Warp 4 is installed, and Fixpak 5. > > >Here's the problem: when I boot the system I get a bunch of > >drivers spitting out messages (as I expect), the screen clears, I hear > >the monitor switch modes and the screen is painted gray (still okay). > >After a bit, the original Warp 4 desktop bitmap comes up, and then the > >drive light goes out. And it sits there. The cursor is the clock, the > >WarpCenter isn't there, nor are any of the icons. Nothing in the Startup > >Folder runs. I can reboot with Ctrl-Alt-Del and the system shuts down > >nicely, and rebooting *may* bring the system back. > > >However, last night, after several reboots I still couldn't get the boot > >process to complete. (The wife almost took my head off ask she wanted to > >type up a letter.) I booted from floppies and edited my config.sys and > >removed WARPCENTER from the > >AUTOSTART line (I *think* it's autostart). I rebooted the system and OS/2 > >came up just fine. I even started the WarpCenter > >manually and my desktop was pretty much back to normal. > > >So it looks like the WarpCenter is the problem, but why? Is > >that last HPFS partition too large? Netscape 2.02 is always > >complaining about a lack of space every time I try to download files to > >that partition. Perhaps Netscape 2.02 can't handle a number greater than 2G (2 raised to the 31 st power - 1) which is the largest number that can be held in a 32-bit signed integer. Try allocating some dummy files to get the space available less than 2G. Later you can delete these files when your partition fills up more. > But then why can I start the > >WarpCenter manually? Has an important file been moved above > >the 1024 cyl threshold? That would mean that editing the config didn't > >really solve the problem (unless it was the config.sys itself that has > >partially over the 1024 cyl boundary). > > >Has anyone else seen this? Is this a known problem that a > >Fixpak after #5 fixes? > > >Thanks. > > >Jeff > > -- > -------------------------------------------------------------- > mstamos@home.com > > "The beauty of the second amendment is that it will not be > needed until they try to take it." > --Thomas Jefferson > > Protect your rights: www.vetothegovernor.org > -------------------------------------------------------------- --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: Trevor-Hemsley@dial.pipex.com 22-Sep-99 22:09:12 To: All 23-Sep-99 04:15:26 Subj: Toshiba Libretto PCMCIA floppy disk and USB port From: "Trevor Hemsley" I picked up a cheap secondhand Toshiba Libretto 100CT over the weekend. This is a laptop about the same size as a VHS video cassette with a 7.1" screen, 32Mb, 2GB HD. It came with Win98 installed. I backed up its install files and blew away the contents of the HD, installed the HD into one of my other machines and copied OS/2 onto it then reinstalled it in the laptop. OS/2 works fine on here. I have drivers for the video card (Neomagic), PCMCIA sockets (SSPCIC1.SYS), soundcard, the 3Com 3c589 ethernet card and just about everything else that it has. Now, I'd really like to try to get the floppy drive to work. This is a special unit that's made by someone called Y-E Data (www.yedata.com.jp I think) and appears to have drivers for Win9x, and Win NT only. It's detected by "Plug and Play for PCMCIA" and shows up as an I/O card. It's not assigned any resources and is not accessible though. Has anyone found drivers for this beast or for anything similar? It also has a docking station that contains a USB socket. This reports itself as NEC - USB Open Host Controller (Serial Bus - USB) which is a PCI device from vendor NEC (1033) with Device id 0035. Is this one that's likely to be supported by the OS/2 USB drivers? I tried loading the drivers but they immediately unloaded themselves and I don't know if this is because there's nothing attached or because the chipset isn't supported. Trevor Hemsley, London, UK (Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com) --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views (1:109/42) +----------------------------------------------------------------------------+ From: Trevor-Hemsley@dial.pipex.com 22-Sep-99 21:54:29 To: All 23-Sep-99 04:15:26 Subj: Re: trouble installing network components on Warp 4 From: "Trevor Hemsley" On Wed, 22 Sep 1999 11:50:44 -0400, Norm Barnard wrote: ->I apologize in advance if this question has been previously answered. -> ->I'm installing Warp4 (Merlin) on a pII 266 with an 8 gb IDE drive. ->I added all the large drive updates so everything there is fine. The ->problem is when I try to install the networking components (running ->install.cmd from the cd) it attempts to install and then reports that ->I dont have enough drive space to do it. I don't know how much space ->the networking components are, but my guess is that they don't take up 8 ->gb. Any help would be appreciated. It's in the readme file in the root of the CD. Add a SET CONNECT_DASD=NO to CONFIG.SYS and it'll skip the disk space checking. I may have the line wrong so check the readme for yourself. Trevor Hemsley, London, UK (Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com) --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views (1:109/42) +----------------------------------------------------------------------------+ From: barnard@theedgedesign.com 22-Sep-99 17:45:17 To: All 23-Sep-99 04:15:26 Subj: Re: trouble installing network components on Warp 4 From: Norm Barnard Trevor Hemsley wrote: > On Wed, 22 Sep 1999 11:50:44 -0400, Norm Barnard wrote: > > ->I apologize in advance if this question has been previously answered. > -> > ... extra stuff deleted .... > > It's in the readme file in the root of the CD. Add a SET CONNECT_DASD=NO > to CONFIG.SYS and it'll skip the disk space checking. I may have the line > wrong so check the readme for yourself. > > Trevor Hemsley, London, UK > (Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com) Oh I get it, your supposed to read the readme files...... I should take that as a sign to not do system installs at 1:00 am :) Thanks for the help. > Norm -- =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- Norm Barnard PGP:www.netlink.net/~barnard/pgpkey.html =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- The Edge Design www.theedgedesign.com (616)344-1301 =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: The Edge Design (1:109/42) +----------------------------------------------------------------------------+ From: jricci@.nospam.ibm.net 22-Sep-99 22:46:06 To: All 23-Sep-99 04:15:26 Subj: Re: Joystick under OS/2? From: jricci@.nospam.ibm.net (Joe Ricci) Joystick drivers installed with TOB, Else available with DD pak Just install using MMINSTALL On Wed, 22 Sep 1999 22:29:27, "OS/2 Fan" wrote: > Hello all, > This should be an easy one: I have a Newcomm 32 PnP card, Crystal > chipset, and I've got a joystick connected to it. DOS games under > WinOS/2 detect it, but OS/2 games like Trials of Battle don't and ask > for the OS/2 joystick driver to be installed. How do I do this? I > can't find it under Selective Install or Device Driver Install. Any > help appreciated as always. TIA. > > Regards, > Xtralarge OS/2 fan > > Opinions expressed are mine only. Ignore them and > killfile me. Leave the University and/or my ISP alone, > I don't speak for them, they have nothing to do with it, > and they probably have more lawyers than you anyway. > > --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: @Home Network Canada (1:109/42) +----------------------------------------------------------------------------+ From: jdparker@erols.com 22-Sep-99 20:31:19 To: All 23-Sep-99 06:08:14 Subj: Re: Warp 4 Freeze on Reboot From: Jim Parker George Barrowcliff wrote: > Installing Warp 4 on new 550 MHz IBM 300PL processors. > These come with NTin the first 2GB, so I kept NT and installed in the next > 2GB with 2GB for an extended dos partition. > The installs seem to go fine, except when the final reboot of the install, > after the blue OS/2 screen, the config messages pop up, then the boot drive > statistics are displayed, cleared and a flashing underscore cursor in the > upper left of the screen. > Alt-F1 and selecting the command line session shows that everything seems > normal, nothing funny in the install log. Selecting VGA several times on > boot up seems to get it working in the VGA mode. I've done three systems > now and each one acts a little different but all are finally running. > I have 10 more to go and would like to understand why these systems act > this way. The video chip set is S3 Trio and is correctly detected. > Should these be installed as VGA then updated later to SVGA? > > What a shame. IBM has introduced these killer processors and not a single > word anywhere in any of the documentation about OS/2 except to say in the > sales literature that it '.. has been tested with OS/2 Warp..' > > I went to the West Warpfest today and there probably wasn't 50 people in > the product display area at 2:00 PM. > > GWB I read in a Partition Magic manual that OS/2 had to be installed completely within the first 4GB of a drive. The problem is: What is a GB? Is it 1,000,000,000 or (1024 X 1024 X 1024) = 1,073,741,824? Most drive manufactures regard it as 1,000,000,000. If you're thinking its 1,073,741,824, you may have busted the limit. Have you tried reducing the size of your OS/2 partition so that it fits within the limit? Jim --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: nospam@savebandwidth.invalid 22-Sep-99 23:41:14 To: All 23-Sep-99 16:41:02 Subj: Re: Joystick under OS/2? From: nospam@savebandwidth.invalid (John Thompson) In , "OS/2 Fan" writes: >This should be an easy one: I have a Newcomm 32 PnP card, Crystal >chipset, and I've got a joystick connected to it. DOS games under >WinOS/2 detect it, but OS/2 games like Trials of Battle don't and ask >for the OS/2 joystick driver to be installed. How do I do this? I >can't find it under Selective Install or Device Driver Install. Any >help appreciated as always. You can get the OS/2 joystick driver from: ftp://hobbes.nmsu.edu/pub/os2/system/drivers/misc/joystick.zip Or the IBM on-line device driver site: http://ftp.software.ibm.com/os2ddpak/html/ -John (John.Thompson@ibm.net) --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: The Crimson Permanent Assurance (1:109/42) +----------------------------------------------------------------------------+ From: hunters@thunder.indstate.edu 23-Sep-99 04:03:29 To: All 23-Sep-99 16:41:02 Subj: Re: Joystick under OS/2? From: hunters@thunder.indstate.edu In article , "OS/2 Fan" wrote: http://service.software.ibm.com/os2ddpak/html/joystick/index.htm Enjoy! -- -Steven Hunter *OS/2 Warp 4 * |Warpstock '99 | Oct 16-17| hunters@thunder.indstate.edu *AMD K6-2 400* | Atlanta GA | Sent via Deja.com http://www.deja.com/ Share what you know. Learn what you don't. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Deja.com - Share what you know. Learn what you do (1:109/42) +----------------------------------------------------------------------------+ From: jricci@.nospam.ibm.net 23-Sep-99 06:29:08 To: All 23-Sep-99 16:41:02 Subj: Os2 on logical partition From: jricci@.nospam.ibm.net (Joe Ricci) To install OS2 in a 2 drive system, Is it correct that the logical partition on which OS2 is installed must be the first drive? --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: @Home Network Canada (1:109/42) +----------------------------------------------------------------------------+ From: my.address@work.office 23-Sep-99 08:40:02 To: All 23-Sep-99 16:41:02 Subj: Re: Os2 on logical partition From: my.address@work.office (Klaus Hoffmann) In article , Joe Ricci says... > >To install OS2 in a 2 drive system, >Is it correct that the logical partition on which OS2 is installed >must be the first drive? > No. -- Klaus Hoffmann Email: hoffmann#klaus@topmail#de Replace hash marks by dots for mailing. Spam seems to lurk everywhere these days... --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: unknown (1:109/42) +----------------------------------------------------------------------------+ From: fat_ox@hotmail.com 23-Sep-99 11:11:02 To: All 23-Sep-99 16:41:02 Subj: Re: Joystick under OS/2? From: "OS/2 Fan" Thanks to eveyone that responded! Regards, Xtralarge OS/2 fan Opinions expressed are mine only. Ignore them and killfile me. Leave the University and/or my ISP alone, I don't speak for them, they have nothing to do with it, and they probably have more lawyers than you anyway. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: An OTEnet S.A. customer (1:109/42) +----------------------------------------------------------------------------+ From: rmcder@nospam.banet.net 23-Sep-99 11:14:18 To: All 23-Sep-99 20:16:00 Subj: Re: Toshiba Libretto PCMCIA floppy disk and USB port From: rmcder@nospam.banet.net (Ron McDermott) On Wed, 22 Sep 1999 21:09:25, "Trevor Hemsley" wrote: > I picked up a cheap secondhand Toshiba Libretto 100CT over the weekend. > This is a laptop about the same size as a VHS video cassette with a 7.1" > screen, 32Mb, 2GB HD. It came with Win98 installed. I backed up its > install files and blew away the contents of the HD, installed the HD into > one of my other machines and copied OS/2 onto it then reinstalled it in > the laptop. OS/2 works fine on here. I have drivers for the video card > (Neomagic), PCMCIA sockets (SSPCIC1.SYS), soundcard, the 3Com 3c589 > ethernet card and just about everything else that it has. > > Now, I'd really like to try to get the floppy drive to work. This is a > special unit that's made by someone called Y-E Data (www.yedata.com.jp I > think) and appears to have drivers for Win9x, and Win NT only. It's > detected by "Plug and Play for PCMCIA" and shows up as an I/O card. It's > not assigned any resources and is not accessible though. I'm using a 70CT and haven't tried using OS/2 on it. Just wanted to mention that someone made up Linux drivers for it as well, but I haven't seen anything for OS/2 either. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne (1:109/42) +----------------------------------------------------------------------------+ From: klcroxen@fas.harvard.edu 23-Sep-99 13:12:18 To: All 23-Sep-99 20:16:00 Subj: Re: Os2 on logical partition From: klcroxen@fas.harvard.edu (Kevin Croxen) On 23 Sep 1999 08:40:04 GMT, Klaus Hoffmann wrote: >In article , Joe >Ricci says... >> >>To install OS2 in a 2 drive system, >>Is it correct that the logical partition on which OS2 is installed >>must be the first drive? >> >No. >-- >Klaus Hoffmann But, if using OS/2's Bootmanager, the primary partition containing Bootmanager itself must be on the first physical drive. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Harvard University, Cambridge, Massachusetts (1:109/42) +----------------------------------------------------------------------------+ From: rgibson@ix.netcom.com 23-Sep-99 14:55:10 To: All 23-Sep-99 20:16:01 Subj: Re: DOS and OS/2 and boot issue From: rgibson@ix.netcom.com (Ron Gibson) On Sun, 19 Sep 1999 00:20:41, rsteiner@visi.com (Richard Steiner) wrote: > >: However, I use a copy of System Commander 3.0 on my second box because > >: it has a more complex setup than this one does, and from what I've seen > >: System Commander can do a lot more than Boot Manager. I think I might have started this thread and I wanted to update you on what I've done and let you'll know about a possible good deal for you. I installed W98 and so now I have W98, W3.1, OS/2 W3, Linux and back up to a removable mounted hard disk. The problem was backing up W98. Even some native W98 software fails to restore easily. Solution was PowerQuest Disk Image that supports all these file systems perfectly, is very fast (images at 3megs/sec with a couple of low end ATA-66 drives). Now here's the deal I got. PowerQuest has put out a package called PowerBundle that includes Drive Image, Partition Magic and McAfee Virus Scan. I got the bundle at Best Buy for $89 and it has a $25 rebate coupon that I was told yesterday by PQ that they are honoring. That makes it cheaper than the retail price on Drive Image alone! BTW, PQ's Boot Magic is part of the package. email: rgibson@ix.netcom.com --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Netcom (1:109/42) +----------------------------------------------------------------------------+ From: jent@ix.netcom.com 23-Sep-99 10:48:01 To: All 23-Sep-99 20:16:01 Subj: Netscape 4.61 From: Steven Jent I have just installed the newest Communicator alongside the old Navigator 2.02. Communicator seems to work alright, so I would like to delete the Navigator directory, but CONFIG.SYS still contains some references to it, and I can't figure out how to replace them with corresponding references to Communicator (which, to my surprise, the installation process didn't add to the file). The old directory is NETSCAPE, the new one is NETSCOMM. These are excerpts from the lines I have changed, replacing NETSCAPE\etc with NETSCOMM\etc, trying to fill in the paths to all the relevant DLLs, EXEs, and ZIPs. LIBPATH=G:\NETSCOMM\PROGRAM;G:\NETSCOMM\PROGRAM\JAVA\BIN;G:\NETSCOMM\PROGRAM\LA NG\en_US;G:\NETSCOMM; SET PATH=G:\NETSCOMM\PROGRAM; SET HELP=G:\NETSCOMM\SIUTIL; SET CLASSPATH=G:\NETSCOMM\PROGRAM\JAVA\CLASSES\JIL3240.ZIP;G:\NETSCOMM\PROGRAM\JAVA \CLASSES\SYS3240.ZIP;G:\NETSCOMM\PROGRAM\JAVA\CLASSES\118\118.ZIP;G:\NETSCOMM\P ROGRAM\JAVA\CLASSES\117\117.ZIP; Can anyone tell me what paths I have left out? The thing that really puzzles me is that the Java toolkit samples, which ran fine until I started dinking with CONFIG.SYS, now all die, whereas Java programs within the browser work correctly. I would have expected that if I were going to break anything, it would be the browser. Do local Java programs actually rely on the classes in the browser directory? (By the way, the toolkit is version 1.1.8.) Thanks, Steven Jent --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Netcom (1:109/42) +----------------------------------------------------------------------------+ From: doug.bissett"at"ibm.net 23-Sep-99 16:31:05 To: All 23-Sep-99 20:16:01 Subj: Re: New Keyboard ???? From: doug.bissett"at"ibm.net (Doug Bissett) On Mon, 20 Sep 1999 18:00:38, racette@cablevision.qc.ca (Martin Racette) wrote: > Hi guys, > > I'm looking to get a new computer, but > those available here, they all come with > keyboard with those "Internet Buttons", > to fetch E-Mail, to connect, etc..., so > I would like to know if those keyboard > will work with OS/2 Warp 4, and if there > is any use for those buttons > > //------------------------- > Thank you in advance > > Merci a l'avance > > Martin > > http://205.237.57.73/ > > ICQ #48552954 I just saw one of those keyboards for the first time. Kinda neat, but I suspect that the extra keys won't do anything in OS/2. I can't think of any reason why the basic keyboard won't work properly. There is a package (look for WIN95KEY.ZIP, in the usual places), that will assign stuff to the 3 windows keys (on the main keyboard, between the Ctrl and Alt keys). I haven't tried it, so I can't comment on how well it works. Perhaps a later version will also incorporate those fancy new keys. Hope this helps... ****************************** From the PC of Doug Bissett doug.bissett at ibm.net The " at " must be changed to "@" ****************************** --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Global Network Services - Remote Access Mail & Ne (1:109/42) +----------------------------------------------------------------------------+ From: Trevor-Hemsley@dial.pipex.com 23-Sep-99 18:42:13 To: All 23-Sep-99 20:16:01 Subj: Re: Warp 4 Freeze on Reboot From: "Trevor Hemsley" On Wed, 22 Sep 1999 20:31:39 -0400, Jim Parker wrote: -> I read in a Partition Magic manual that OS/2 had to be installed completely ->within the first 4GB of a drive. The problem is: What is a GB? The easier answer is that it isn't true anyway so the question is wasted ;-) The limitation is 1024 cylinders. Using most BIOS implementations of LBA for IDE disks this means that you can boot from anywhere in the first 1024 x 255 x 63 x 512 bytes of the disk (8GB). The same limitation is true for most SCSI cards and drives too. Warp 3 has a bug that means that any partition formatted using HPFS using the Warp 3 version of UHPFS.DLL can't be booted if it is outside the first 2GB of the disk. A search of http://hobbes.nmsu.edu for gt2gbw3.zip will yield a file that lets you get round this. Trevor Hemsley, London, UK (Trevor-Hemsley@dial.pipex.com or 75704.2477@compuserve.com) --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: UUNET WorldCom server (post doesn't reflect views (1:109/42) +----------------------------------------------------------------------------+ From: mwalsh1@elp.rr.com 23-Sep-99 14:27:11 To: All 23-Sep-99 20:16:02 Subj: Re: Printer/networking From: "Matt Walsh" Did you install the win9x access client onto the win 9x machines? Get it at: http://service.boulder.ibm.com/asd-bin/doc/en_us/catalog.htm If you run a tcpip net you can do internet printer, but that's not common. On Mon, 20 Sep 1999 16:25:18 -0500, Ben Hamilton wrote: >I am having problems with a printer driver install. My "server" machine >is running OS/2 Warp 4, and my two workstations are Win98 machines. I >have installed the latest OMNI printer driver for my Epson Stylus Color >440, configured the share, and rebooted, yet the Win98 machines cannot >see the printer. What am I forgetting? The network is working fine in >all other aspects (drive sharing, TCP/IP access to the Internet via the >Injoy Firewall). > >Thanks, > >-- Ben Hamilton >-- ben.hamilton@fmr2001.com >-- >-- Spam filter in use! >-- Remove "2001" from email address if replying via email. > > Matt Walsh El Paso, TX Computin' & Shootin' in the dust. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Time Warner Communications, El Paso TX (1:109/42) +----------------------------------------------------------------------------+ From: oliver.rick@oor.de 22-Sep-99 23:54:26 To: All 24-Sep-99 04:26:03 Subj: Re: XFree86 and 127.0.0.1 Loopback (Still Negatory) From: oliver.rick@oor.de (Oliver Rick) On Tue, 21 Sep 1999 Ray Appleby wrote: >> Also make sure you have the line: >> 127.0.0.1 localhost >> in x:\mptn\etc\hosts and x:\tcpip\dos\etc\hosts > Thanks for the suggestions - tcpcfg2 still won't recognize the local > host. :-( Add SET USE_HOSTS_FIRST=1 to your CONFIG.SYS file. /Olli/ -- IBM OS/2 Warp Update Summary: http://www.warpupdates.de/english/warpupdates.html --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Out of Rosenheim/2 (1:109/42) +----------------------------------------------------------------------------+ From: psf@idirect.com 23-Sep-99 21:20:10 To: All 24-Sep-99 04:26:03 Subj: Warp 4 drive partitions... From: psf@idirect.com (Paul Fedorenko) I recently bought a 6.4 GB hard drive. It was installed at the store, pre-partitioned... Partition 1 -- 2GB rest of drive is free space. I've been trying to create a partition in the 4.4 GB block of free space on the drive, but FDISK doesn't let me do anything but delete partitions. I went to IBM's support web page and downloaded updated drivers for the installation boot disc, but that didn't help So... What I'd like to know is... If I removed all the partitions on the drive, would it be possible to use FDISK to install Boot Manager as the first partition, then repartition the drive in a similar manner to the way it was before? With Win95 in a 2 GB partition, and OS/2 installed on the remainder of the drive? Reply via e-mail if possible. I don't check here often... Thanks in advance... Paul Paul Fedorenko psf@idirect.com Internet Direct Tech Support "ah, but a man's reach should exceed his grasp or what is a heaven for" -- Robert Browning, "Andrea Del Sarto" 1895 --------------------------------------------------------------------- : Internet Direct. Have you heard about our : : (416)233-2999, 1000 lines Do-It-Yourself Webserver? : : T3 bandwidth, 9600-33,600bps+ISDN http://web.idirect.com : --------------------------------------------------------------------- --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: ComputerLink Internet Direct. (1:109/42) +----------------------------------------------------------------------------+ From: rgibson@ix.netcom.com 23-Sep-99 22:45:13 To: All 24-Sep-99 04:26:03 Subj: Re: driver needed - HP35480A DAT From: rgibson@ix.netcom.com (Ron Gibson) On Tue, 21 Sep 1999 22:02:28, djm16@le.ac.uk (Dr D.J. Maconochie) wrote: > I have ordered BackAgain from BMT micro for <$100 actually $92. Their no-tape > version is even less. > > How much is it worht to you to be able to do a full restore after just booting > from floppies? Certainly worth $92 bucks to me. Gee I can do that with my extra removable ATA-66 drive and drive image for total $210, hardware and software. And I bet it's a whole lot faster :-) email: rgibson@ix.netcom.com --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Netcom (1:109/42) +----------------------------------------------------------------------------+ From: psf@idirect.com 23-Sep-99 22:03:10 To: All 24-Sep-99 04:26:03 Subj: Re: **Attention, Motherboard & OS/2 From: psf@idirect.com (Paul Fedorenko) : Which Chipset? : Which brand? : Is their a url to purchase? I'd basically recommend any motherboard made by Asus, Shuttle or Tyan. They all use an Intel 440BX chipset, and are probably the three best manufacturers to go with for any operating system these days. Paul -- Paul Fedorenko psf@idirect.com Internet Direct Tech Support "ah, but a man's reach should exceed his grasp or what is a heaven for" -- Robert Browning, "Andrea Del Sarto" 1895 xceed his grasp or what is a heaven for" -- Robert Browning, "Andrea Del Sarto" 1895 ---------------------------------------------------------------- : Stop on by the Internet TeleCafe! telnet://telecafe.com:9000 : ---------------------------------------------------------------- --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: ComputerLink Internet Direct. (1:109/42) +----------------------------------------------------------------------------+ From: e.traas@hccnet.nl 24-Sep-99 00:44:22 To: All 24-Sep-99 04:26:03 Subj: JAVA newsreader wanted ?? From: erwin Traas Is there a newsreader for java out there ?? --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Hobby Computer Club News Network (1:109/42) +----------------------------------------------------------------------------+ From: afjbell@onlink.net 23-Sep-99 20:41:05 To: All 24-Sep-99 04:26:04 Subj: Re: ThinkPad and Paintbrush From: "Alex Bell" On Wed, 22 Sep 1999 10:27:40 GMT, jpedone_no_spam@flash.net wrote: > >FWIW - you'll also get this message if you run out of file handles. >Check the DOS_FILES setting in the WIN-OS/2 session properties >area. It's probably set to about 20 - just increase it to 30 or 40. > > >J. Pedone >jpedone@flash.net >http://www.flash.net/~jpedone > Thanks, John. I increased dos_files to 60 to no avail. --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Ontario Northland--ONLink (1:109/42) +----------------------------------------------------------------------------+ From: hcskvs@aol.com 24-Sep-99 02:32:01 To: All 24-Sep-99 04:26:04 Subj: This Is The Best The Internet Has To Offer 7747 From: hcskvs@aol.com Hi, My name is Ellie and I just stumbled across what has to be the BEST source on the internet! Its totally free and easy to have the most fun ever! http://www.amylinks.com/ Visit Amys Links, its totally worth it! ecxpfuoppvfwtrxhg --- WtrGate+ v0.93.p7 sn 165 * Origin: Origin Line 1 Goes Here (1:109/42) +----------------------------------------------------------------------------+ From: MasterBlaster2000@hotmail.com 23-Sep-99 20:44:08 To: All 24-Sep-99 04:26:04 Subj: Re: Warp 4 drive partitions... From: "Master Blaster" I have a friend who is trying to install the OS/2; however, fdisk won't allow him to partition the harddrive at all, rendering all attempts futile. He is only allowed to delete partitions but not to create them. His HD is 6 Gig. Any ideas. TIA -- MasterBlaster Paul Fedorenko wrote in message news:oQwG3.281$D%.5250@quark.idirect.com... > I recently bought a 6.4 GB hard drive. It was installed at the store, > pre-partitioned... > > Partition 1 -- 2GB > rest of drive is free space. > > I've been trying to create a partition in the 4.4 GB block of free space > on the drive, but FDISK doesn't let me do anything but delete partitions. > I went to IBM's support web page and downloaded updated drivers for the > installation boot disc, but that didn't help > > So... What I'd like to know is... If I removed all the partitions on the > drive, would it be possible to use FDISK to install Boot Manager as the > first partition, then repartition the drive in a similar manner to the way > it was before? With Win95 in a 2 GB partition, and OS/2 installed on the > remainder of the drive? > > Reply via e-mail if possible. I don't check here often... > > Thanks in advance... > > Paul > > Paul Fedorenko psf@idirect.com > Internet Direct Tech Support > > "ah, but a man's reach should exceed his grasp or what is a heaven for" > > -- Robert Browning, > "Andrea Del Sarto" > 1895 > --------------------------------------------------------------------- > : Internet Direct. Have you heard about our : > : (416)233-2999, 1000 lines Do-It-Yourself Webserver? : > : T3 bandwidth, 9600-33,600bps+ISDN http://web.idirect.com : > --------------------------------------------------------------------- --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: EarthLink Network, Inc. (1:109/42) +----------------------------------------------------------------------------+ From: terence@nikoyo.com 24-Sep-99 16:20:22 To: All 24-Sep-99 10:53:13 Subj: install Warp 4.0 through PCMCIA CD-Rom From: Terence Cheng I'd like to install Warp 4.0 to my notebook throgh a AHA1460 PCMCIA Scsi card and attach with an external CD-ROM. I'd download the install disk update from: http://service.software.ibm.com/os2ddpak/html/os_2inst/ibmcorpo/index.htm I tried the PCMCIA Scsi with Intel PCMCIA disk. However, when boot from the disk, it show invalid switch... Could anyone told me what is the problem? The PCMCIA controller is Ricoh RL5C475 CardBus Best Regards, Terence Cheng Systems Engineer ________________________________________ NIKOYO (HK) Limited Tel: (852)2839-9162 Fax: (852)2576-5043 mailto:terence@nikoyo.com --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Nikoyo (HK) Limited (1:109/42) +----------------------------------------------------------------------------+ From: piquant00@uswestmail.net 24-Sep-99 14:39:15 To: All 24-Sep-99 13:22:29 Subj: Re: Warp 4 drive partitions... From: piquant00@uswestmail.net (Annie K.) On Thu, 23 Sep 1999 21:20:20, psf@idirect.com (Paul Fedorenko) wrote: :What I'd like to know is... If I removed all the partitions on the :drive, would it be possible to use FDISK to install Boot Manager as the :first partition, then repartition the drive in a similar manner to the way :it was before? With Win95 in a 2 GB partition, and OS/2 installed on the :remainder of the drive? Yes. -- Anthropomorphic Hamburger --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Team OS/2 (1:109/42) +----------------------------------------------------------------------------+ From: ariek3.14159265358979323846@ibm.net 24-Sep-99 15:30:08 To: All 24-Sep-99 15:24:08 Subj: Hebrew webpages: what browser displays text in correct order? From: ariek3.14159265358979323846@ibm.net (Arie Kazachin) Hello! I'm using NS 2.02 and/or WebEx 1.1f under WARP 3 (Hebrew NLV, FP40) to see Hebrew webpages. For most of them, the direction of Hebrew text appears wrong: from left to right instead of from right to left, as it should be in Hebrew text. Interesting to note that the paragraphs are right aligned, as they should be. I visited a webpage which explains, how to view Hebrew pages and did what had been suggested there, but still the Hebrew text appears "flipped" in almost all Hebrew webpages. I'm saying "almost" because few days ago I accidentally stumbled over a webpage in which the Hebrew text appeared correctly. I was very surprized and asked a friend of mine to check both this and some other Hebrew webpages on his Win95 machine. He told me that he can see both pages OK and it might be a matter of two different standards for Hebrew webpages: one is a rare format from Microsoft Israel (which, according to him, used almost nowhere) and another is the "de facto standard" of Hebrew webpages used in almost all Hebrew sites. The site explaining how to view Hebrew pages mentiones that a title of the HTML document must include the line: I accessed a webpage with "wrong" direction of Hebrew text, saved the HTMP file of the page, added the above line to the header but this had no effect. Examining two HTML sources, one which I see OK and one in which the Hebrew text is "flipped" I saw that indeed, the order of ASCII codes corresponding to Hebrew letters is different in the two files: in the source of the "correctly displayed" page, the first (leftmost) ASCII character of the text field corresponds to the first (rightmost) Hebrew letter, which means: my browsers "flip" the text field before displaying it. In the source of the "wrongly displayed" page, the first (leftmost) ASCII character corresponds to the last (also leftmost) Hebrew letter, which means: most Hebrew pages expect the browser not to flip the text field. Can anyone knowledgeable in HTML formats explain me, how is the direction of a text to display is controlled: is it "hardcoded" in the browser or there are some codes in the HTML file which control it? Does anyone view Hebrew pages correctly by NS 2.02 or WebEx? If yes, I would like to know the setup (I played with the "Language" settings but to no avail). I almost started downloading the NS Communicator 4.61 but reading "installation requirements" I saw that only WARP 4 and various WARP servers had been mentioned so before I download about 10MB, I would like to know if the Communicator can run under WARP 3? THANKS IN ADVANCE TO ANY HELP ! ! ! ****************************************************************************** * Arie Kazachin, Israel, e-mail: ariek3.14159265358979323846@ibm.net * ****************************************************************************** NOTE: before replying, leave only letters in my userID. Sorry, SPAM trap. ___ .__/ | | O / _/ / | | I HAVE NOWHERE ELSE TO GO !!! | | | | | | | /O\ | _ \_______[|(.)|]_______/ | * / \ o ++ O ++ o | | | | |< \ \_) \ | \ | \ | \ | \ | \ | \ | \_| --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Unspecified Organization (1:109/42) +----------------------------------------------------------------------------+ From: mkaply@NOSPAMus.ibm.com 24-Sep-99 10:58:20 To: All 24-Sep-99 15:24:08 Subj: Re: Hebrew webpages: what browser displays text in correct order? From: Michael Kaply NS 4.61 for OS/2 added full support for viewing hebrew and arabic web pages, including the ability to reverse the browser UI from left to right. You can view pages with both implicit and visual hebrew encodings. Mike Kaply IBM --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: IBM (1:109/42) +----------------------------------------------------------------------------+ From: jldavid@enteract.com 24-Sep-99 14:35:00 To: All 24-Sep-99 20:01:11 Subj: Help! Suddenly cannot install ANYTHING! From: Jeff David Yesterday I downloaded and installed Netscape 4.61. A big improvement over 4.04. However, ever since, I can not install or uninstall anything. When I try, I get the message: "Could not open package file install.iap" So, what did I do and how can I fix it?? Jeff David --- WtrGate+ v0.93.p7 sn 165 * Origin: Usenet: Cynics, Inc (1:109/42) +----------------------------------------------------------------------------+ +============================================================================+